Please expand each category for details…

Back to Top

x

 

cDNAx

  • Functional Cloning of Recurrence-specific Antigens Identifies Molecular Targets to Treat Tumor Relapse
    Nicolas Boisgerault, Timothy Kottke, Jose Pulido, Jill Thompson, Rosa Maria Diaz, Diana Rommelfanger-Konkol, Addie Embry, Dyana Saenz, Eric Poeschla, Hardev Pandha, Kevin Harrington, Alan Melcher, Peter Selby, Richard Vile
    Mol. Ther. (7.1), 2013-06-11, ,
    … GCV. 38,39. VSV-cDNA libraries (ASEL/IEEL) were constructed as described in ref. 22 , containing cDNA from normal human prostate (BioChain, Hayward, CA) or from three-pooled TC2R recurrent tumors respectively. VSV-cDNA …
  • Activation of TrkB with TAM-163 results in opposite effects on body weight in rodents and non-human primates
    Mylène Perreault, Guo Feng, Sarah Will, Tiffany Gareski, David Kubasiak, Kimberly Marquette, Yulia Vugmeyster, Thaddeus J Unger, Juli Jones, Ariful Qadri, Seung Hahm, Ying Sun, Cynthia M Rohde, Raphael Zwijnenberg, Janet Paulsen, Ruth E Gimeno
    PLoS ONE (4.4), 2013-05-23, 8, e62616
    … TrkB from cynomolgus monkey, and dog was cloned by PCR using the Stratagene Easy-A High-Fidelity system (Stratagene, La Jolla, CA) with brain cDNA from each species as a template (BioChain, Hayward, CA, USA), and the following primers: Cynomolgus monkey:5 …
  • Next-Generation qPCR for the High-Throughput Measurement of Gene Expression in Multiple Leukocyte Subsets
    Mateusz G Adamski, Yan Li, Erin Wagner, Hua Yu, Chloe Seales-Bailey, Steven A Soper, Michael Murphy, Alison E Baird
    J Biomol Screen (2.5), 2013-05-20, ,
    … Serial dilution of commercial cDNA (Universal cDNA Reverse Transcribed by Random Hexamer: Human Normal Tissues;BioChain, Newark, CA), covering 4 orders of magnitude, with no template control (NTC) was used to test primers in qPCR (StepOnePlus Real-Time PCR …
  • Effect of sterol composition on the activity of the yeast G-protein-coupled receptor Ste2
    Sanae Morioka, Tomohiro Shigemori, Keisuke Hara, Hironobu Morisaka, Kouichi Kuroda, Mitsuyoshi Ueda
    Appl. Microbiol. Biotechnol. (3.3), 2013-05-16, 97, 4013-20
    … of the cholesterol-producing yeast strain, DHCR24 (Δ24-dehydrocholesterol reductase (Dhcr24p)- encoding gene) and DHCR7 (7-dehydrocholesterol reduc- tase (Dhcr7p)-encoding gene) were amplified by PCR from a human brain cDNA library (BioChain Institute, CA, USA …
  • Membrane transporters for sulfated steroids in the human testis–cellular localization, expression pattern and functional analysis
    Daniela Fietz, Katharina Bakhaus, Britta Wapelhorst, Gary Grosser, Sabine Günther, Jörg Alber, Barbara Döring, Sabine Kliesch, Wolfgang Weidner, Christina E Galuska, Michaela F Hartmann, Stefan A Wudy, Martin Bergmann, Joachim Geyer
    PLoS ONE (4.4), 2013-05-13, 8, e62638
    … Expression patterns of SOAT, OATP6A1, OATP1C1 and OSCP1 were examined by using human multiple tissue cDNA panels (BioChain, Newark, CA, USA). … OATP1C1 was cloned from human brain cDNA (BioChain) because of its higher expression rate in this organ. …
  • Identifying RNA editing sites using RNA sequencing data alone
    Gokul Ramaswami, Rui Zhang, Robert Piskol, Liam P Keegan, Patricia Deng, Mary A O’Connell, Jin Billy Li
    Nat. Methods (20.7), 2013-01-30, 10, 128-32
    … Samples 1 and 2 were from the same individual (a 26-year-old male), and gDNA from the frontal lobe of the same individual was also obtained (all from BioChain Institute). … We obtained cDNA and gDNA from the cerebellum of a 26-year-old human male (BioChain Institute). …
  • Methods for qPCR gene expression profiling applied to 1440 lymphoblastoid single cells
    Kenneth J Livak, Quin F Wills, Alex J Tipping, Krishnalekha Datta, Rowena Mittal, Andrew J Goldson, Darren W Sexton, Chris C Holmes
    Methods (4.5), 2013-01-14, 59, 71-9
    … 2.3. Testing of assays with cDNA prepared from bulk RNA. The assays were tested with Universal Human cDNA (BioChainC4234565-R) and with cDNA prepared from bulk total RNA extracted from cell lines GM06991, GM10839, GM12801, and GM12802. …
  • 23 Dye-Based High-Throughput qPCR in Microfluidic Platform BioMarkTM
    Svec, Rusnakova, Korenkova
    Pcr Technology: … 0, , ,
    … Tests were performed using the Universal human cDNA (BioChain Institute Inc.) in different concentrations or after preamplification: Preamplfication of 20 genes (SPIDIA) was carried out in Biorad IQ SupermixTM and contained 5 11L of universal cDNA in 50 11L reaction volume …
  • Engineering Macaca fascicularis cytochrome P450 2C20 to reduce animal testing for new drugs
    Francesco Rua, Sheila J Sadeghi, Silvia Castrignanò, Giovanna Di Nardo, Gianfranco Gilardi
    J. Inorg. Biochem. (3.3), 2012-12-15, 117, 277-84
    … Sigma-Aldrich (Italy). 2.2. Cloning of recombinant P450 2C20 and P450 2C20/BMR. The gene coding for the M. fascicularis P450 2C20 was amplified from the liver cDNA pool of M. fascicularis (BioChain, UK). The primers used …
  • ABCB5 expression and cancer stem cell hypothesis in oral squamous cell carcinoma
    Martin Grimm, Michael Krimmel, Joachim Polligkeit, Dorothea Alexander, Adelheid Munz, Susanne Kluba, Constanze Keutel, Jürgen Hoffmann, Siegmar Reinert, Sebastian Hoefert
    Eur. J. Cancer (4.9), 2012-11-02, 48, 3186-97
    … contaminants. Normal matched human mucosal cDNA was purchased by BioChain (Hayward, CA, USA) as control. The … previously. 20 Normal human mucosal protein was purchased by BioChain (Hayward, CA, USA) as control. After …
  • Identification of retinol binding protein 1 promoter hypermethylation in isocitrate dehydrogenase 1 and 2 mutant gliomas
    Arthur P Chou, Reshmi Chowdhury, Sichen Li, Weidong Chen, Andrew J Kim, David E Piccioni, Julia M Selfridge, Reema R Mody, Stephen Chang, Shadi Lalezari, Jeffrey Lin, Desiree E Sanchez, Ryan W Wilson, Matthew C Garrett, Bret Harry, Jack Mottahedeh, Phioanh L Nghiemphu, Harley I Kornblum, Paul S Mischel, Robert M Prins, William H Yong, Timothy Cloughesy, Stanley F Nelson, Linda M Liau, Albert Lai
    J. Natl. Cancer Inst. (14.7), 2012-10-03, 104, 1458-69
    … primers. Normal brain cDNA isolated from one frozen surgical tissue, four frozen autopsy tissues, and two commercially available cDNA libraries (BioChain, Hayward, CA; Invitrogen, Grand Island, NY) were used as controls. …
  • Exome sequencing and functional validation in zebrafish identify GTDC2 mutations as a cause of Walker-Warburg syndrome
    M Chiara Manzini, Dimira E Tambunan, R Sean Hill, Tim W Yu, Thomas M Maynard, Erin L Heinzen, Kevin V Shianna, Christine R Stevens, Jennifer N Partlow, Brenda J Barry, Jacqueline Rodriguez, Vandana A Gupta, Abdel-Karim Al-Qudah, Wafaa M Eyaid, Jan M Friedman, Mustafa A Salih, Robin Clark, Isabella Moroni, Marina Mora, Alan H Beggs, Stacey B Gabriel, Christopher A Walsh
    Am. J. Hum. Genet. (11.7), 2012-09-07, 91, 541-7
    … both during fetal development and in the adult. cDNA samples from postmortem fetal and adult human tissues were obtained commercially (BioChain Institute and Clontech). qPCR was performed with SYBR Green reagents …
  • Development of a novel ectonucleotidase assay suitable for high-throughput screening
    Kris F Sachsenmeier, Carl Hay, Erin Brand, Lori Clarke, Kim Rosenthal, Sandrine Guillard, Steven Rust, Ralph Minter, Robert Hollingsworth
    J Biomol Screen (2.5), 2012-08-12, 17, 993-8
    … Human NT5E (NM_002526), minus the GPI linkage region, was obtained from placenta cDNA (BioChain, Newark, CA) using standard RT PCR and cloned into a mammalian expression vector (amino acids 1–552 cloned; GPI linkage region from amino acids 556–572 was not …
  • t(12;13)(q14;q31) leading to HMGA2 upregulation in acute myeloid leukaemia
    Kaja B Nyquist, Ioannis Panagopoulos, Jim Thorsen, Roberta Roberto, Hilde S Wik, Anne Tierens, Sverre Heim, Francesca Micci
    Br. J. Haematol. (4.9), 2012-06-25, 157, 769-71
    … Fig. 1A). No expression was detected in normal bone marrow cDNA (BioChain, San Diego, CA, USA) used as control, which was expected because HMGA2 is not expressed in adult bone marrow (Fusco & Fedele, 2007). To …
  • Exploring the dynamic range of the kinetic exclusion assay in characterizing antigen-antibody interactions
    Christine Bee, Yasmina N Abdiche, Donna M Stone, Sierra Collier, Kevin C Lindquist, Alanna C Pinkerton, Jaume Pons, Arvind Rajpal
    PLoS ONE (4.4), 2012-05-04, 7, e36261
    … The complete coding regions of cyno DKK2 and rhesus DKK4 were obtained by PCR from cyno liver (DKK2) or rhesus testis (DKK4) cDNAs (BioChain, Hayward, CA), using minimally degenerate 5′ and 3′ primers, which were designed based on the available rhesus …
  • Striatal pleiotrophin overexpression provides functional and morphological neuroprotection in the 6-hydroxydopamine model
    Sara E Gombash, Jack W Lipton, Timothy J Collier, Lalitha Madhavan, Kathy Steece-Collier, Allyson Cole-Strauss, Brian T Terpstra, Anne L Spieles-Engemann, Brian F Daley, Susan L Wohlgenant, Valerie B Thompson, Fredric P Manfredsson, Ronald J Mandel, Caryl E Sortwell
    Mol. Ther. (7.1), 2012-03-01, 20, 544-54
    … Human PTN was cloned from human brain complementary DNA (BioChain Institute, Hayward, CA) and inserted into an AAV plasmid backbone downstream of a synthetic chicken β-actin promoter/cytomegalovirus enhancer promoter hybrid. …
  • A self-contained enzyme activating prodrug cytotherapy for preclinical melanoma
    Gwi-Moon Seo, Raja Shekar Rachakatla, Sivasai Balivada, Marla Pyle, Tej B Shrestha, Matthew T Basel, Carl Myers, Hongwang Wang, Masaaki Tamura, Stefan H Bossmann, Deryl L Troyer
    Mol. Biol. Rep. (1.9), 2012-01-22, 39, 157-65
    … with 5% CO2. Generation of double-stable cells for inducible expression of InCE We cloned the rabbit carboxylesterase (InCE) gene by PCR from a rabbit liver cDNA library from BioChain (Hayward, CA). Primers used were as …
  • The role of residue C410 on activation of the human vitamin D receptor by various ligands
    Hilda S Castillo, Amanda M Ousley, Anna Duraj-Thatte, Kelli N Lindstrom, Dina D Patel, Andreas S Bommarius, Bahareh Azizi
    J. Steroid Biochem. Mol. Biol. (2.9), 2012-01-05, 128, 76-86
    … The human vitamin D receptor gene was isolated and amplified from human skin cDNA (BioChain, Hayward, CA) via PCR using the following primers: 5′-gcc gga att cat gga ggc aat ggc ggc-3′ and 5′-ggacta gtt cag gag atc tca ttg cca aac ac-3′ (Operon, Huntsville, AL). …
  • Claire Gillaux, Céline Méhats, Daniel Vaiman, Dominique Cabrol, and Michelle Breuiller-Fouché
    Functional Screening of TLRs in Human Amniotic Epithelial Cells
    J. Immunol., Sep 2011; 187: 2766 – 2774.
    … …DNA contamination by performing PCR reactions done without reverse transcription of the RNA extracts. A cDNA from human lung (Biochain, Hayward, CA) was used as a positive control. Zymography The proteolytic activity of pro-MMP-9 secreted into the culture…
  • Barbara Rosati, Qinghong Yan, Mi Sun Lee, Shian-Ren Liou, Brian Ingalls, Jason Foell, Timothy J. Kamp, and David McKinnon
    Robust L-type calcium current expression following heterozygous knockout of the Cav1.2 gene in adult mouse heart
    J. Physiol., Jul 2011; 589: 3275 – 3288.
    … …independent commercial suppliers (Ambion, Inc., Austin, TX, USA and BioChain Institute Inc., Hayward, CA, USA). cDNAs were prepared from…independent commercial suppliers (Ambion, Inc., Austin, TX, USA and BioChain Institute Inc., Hayward, CA, USA). cDNAs were prepared from… …
  • Xingfu Xu, Yoon J. Lee, Johanna B. Holm, Mark D. Terry, Robert E. Oswald, and William A. Horne
    The Ca2+ Channel β4c Subunit Interacts with Heterochromatin Protein 1 via a PXVXL Binding Motif
    J. Biol. Chem., Mar 2011; 286: 9677 – 9687.
    … …sequences were added to the 5-end of primers for ligation into the vector pET-15b. Human brain first-strand cDNA was purchased from Biochain (Hayward, CA), and 10 ng of cDNA was used as templates for PCR amplification. The thermal cycling program was as follows: 1… …
  • Diansong Zhou, Alban J. Linnenbach, Ruifeng Liu, Rick A. Luzietti, Jennifer J. Harris, Catherine L. Booth-Genthe, and Scott W. Grimm
    Expression and Characterization of Dog Cytochrome P450 2A13 and 2A25 in Baculovirus-Infected Insect Cells
    Drug Metab. Dispos., Jul 2010; 38: 1015 – 1018.
    … …Newport, RI). Polymerase chain reaction (PCR)-Ready First-Strand cDNA from female beagle dog normal liver was obtained from BioChain Institute, Inc. (Hayward, CA). Bac-to-Bac baculovirus expression system and Sf9 (Spodoptera frugiperda) insect cells, protein… …
  • Yu Chen, Yongli Yao, Yuka Sumi, Andrew Li, Uyen Kim To, Abdallah Elkhal, Yoshiaki Inoue, Tobias Woehrle, Qin Zhang, Carl Hauser, and Wolfgang G. Junger
    Purinergic Signaling: A Fundamental Mechanism in Neutrophil Activation
    Sci. Signal., Jun 2010; 3: ra45.
    … …12 ), except that an Eppendorf Mastercycler Realplex real-time PCR system was used. Human brain complementary DNA (cDNA; BioChain Inc.) was used as a positive control. Predesigned QuantiTect primers were purchased from Qiagen. The supplier validated the… …
  • Edward W. Dervan, Hong Chen, Su Ling Ho, Nikola Brummel, Jasmin Schmid, David Toomey, Margarita Haralambova, Edith Gould, Deborah M. Wallace, Jochen H. M. Prehn, Colm J. O’Brien, and Derek Murphy
    Protein Macroarray Profiling of Serum Autoantibodies in Pseudoexfoliation Glaucoma
    Invest. Ophthalmol. Vis. Sci., Jun 2010; 51: 2968 – 2975.
    … …First-strand cDNA of brain (C1234035) and optic nerve (C1234064-10) tissue of healthy young male donors was obtained from Biochain (Hayward, CA). The cDNA was then assayed in triplicate (Rotorgene 3000 Real Time PCR system; Corbet, Research, Australia) and…
  • Franz Gruswitz, Sarika Chaudhary, Joseph D. Ho, Avner Schlessinger, Bobak Pezeshki, Chi-Min Ho, Andrej Sali, Connie M. Westhoff, and Robert M. Stroud
    Function of human Rh based on structure of RhCG at 2.1 Å
    PNAS, May 2010; 107: 9638 – 9643.
    … …Expression, Purification, and Crystallization. Human Rh C glycopro- tein (RhCG) was obtained from a human kidney cDNA library (Biochain Institute, Inc.) by PCR with primers specific for the 5 and 3 regions (forward primer: ACCATGGCCTGGAACAC- CAAC; reverse primer… …
  • Fenghua Yuan, Jimmy El Hokayem, Wen Zhou, and Yanbin Zhang
    FANCI Protein Binds to DNA and Interacts with FANCD2 to Recognize Branched Structures
    J. Biol. Chem., Sep 2009; 284: 24443 – 24452.
    … …of Recombinant FA Proteins cDNAs for human FANCI and FANCD2 were obtained by PCR amplification from a universal cDNA pool (BioChain Institute, Inc.). The FANCI cDNA matches the NCBI Reference Sequence NM_001113378, and the FANCD2 cDNA matches NM_001018115… …
  • Dorothee Günzel, Salah Amasheh, Sandra Pfaffenbach, Jan F. Richter, P. Jaya Kausalya, Walter Hunziker, and Michael Fromm
    Claudin-16 affects transcellular Cl\#8722; secretion in MDCK cells
    J. Physiol., Aug 2009; 587: 3777 – 3793.
    … …performed on MDCK-C7 cDNA and on commercial dog kidney cDNA (BioChain, Hayward, CA, USA) using HOTSTAR DNA polymerase (Qiagen, Hilden…performed on MDCK-C7 cDNA and on commercial dog kidney cDNA (BioChain, Hayward, CA, USA) using HOTSTAR DNA polymerase (Qiagen, Hilden… …
  • Hui-Wen Lo, Hu Zhu, Xinyu Cao, Amy Aldrich, and Francis Ali-Osman
    A Novel Splice Variant of GLI1 That Promotes Glioblastoma Cell Migration and Invasion
    Cancer Res., Aug 2009; 10.1158/0008-5472.CAN-09-0886.
    … …purchased from Sigma unless otherwise stated. cDNAs of normal tissues and genomic DNAs from peripheral leukocytes were from BioChain. Human GBM cell lines were established in our laboratory from primary specimens (7), with the exception of U87MG, T98G, U373MG… …
  • Nandor Gabor Than, Roberto Romero, Morris Goodman, Amy Weckle, Jun Xing, Zhong Dong, Yi Xu, Federica Tarquini, Andras Szilagyi, Peter Gal, Zhuocheng Hou, Adi L. Tarca, Chong Jai Kim, Jung-Sun Kim, Saied Haidarian, Monica Uddin, Hans Bohn, Kurt Benirschke, Joaquin Santolaya-Forgas, Lawrence I. Grossman, Offer Erez, Sonia S. Hassan, Peter Zavodszky, Zoltan Papp, and Derek E. Wildman
    A primate subfamily of galectins expressed at the maternal–fetal interface that promote immune cell death
    PNAS, Jun 2009; 106: 9731 – 9736.
    … …PowerScript Reverse Transcriptase (BD Biosciences) for P. anubis and A. fusciceps samples. The cDNA for M. mulatta was purchased from Biochain Institute. The amplification of nucleotide sequences from genomic and complementary DNAs was performed by “primer walk” by… …
  • Songqing Li, Shang L. Lian, Joanna J. Moser, Mark L. Fritzler, Marvin J. Fritzler, Minoru Satoh, and Edward K. L. Chan
    Identification of GW182 and its novel isoform TNGW1 as translational repressors in Ago2-mediated silencing
    J. Cell Sci., Dec 2008; 121: 4134 – 4144.
    … …lines (ATCC, Manassas, VA), and normal adult human testis (BioChain, Hayward, CA) using primer TNRC-1 (5-ATAATGCCAAGCGAGCTACAG…PCR amplification was conducted on the human testis cDNA (BioChain) using primer TNRC-5a [5-TTTGGAAGATCTATGAGAGAATTGGAAGCTAAAGCT-3… …
  • Shiho Kawamura, Kieran Hervold, Felipe-Andr¨¨s Ramirez-Weber, and Thomas B. Kornberg
    Two Patched Protein Subtypes and a Conserved Domain of Group I Proteins That Regulates Turnover
    J. Biol. Chem., Nov 2008; 283: 30964 – 30969.
    … …mRNA and the FirstChoice RLM-RACE kit (Ambion). Canis familiaris and Rhesus monkey (Macaca mulatta) cDNAs were purchased from BioChain Institute. Primer Design for Reverse Transcription-PCR-Primers were designed based upon predicted CTD sequences and were chosen… …
  • Cynthia Shannon Weickert, Ana L. Miranda-Angulo, Jenny Wong, William R. Perlman, Sarah E. Ward, Vakkalanka Radhakrishna, Richard E. Straub, Daniel R. Weinberger, and Joel E. Kleinman
    Variants in the estrogen receptor alpha gene and its mRNA contribute to risk for schizophrenia
    Hum. Mol. Genet., Aug 2008; 17: 2293 – 2309.
    … …constructed by PCR amplification of full-length human wild-type ESR1 or delta7 ESR1 from commercially available MCF-7 cDNA (BioChain Institute, Inc. Hayward, CA, USA). Primer pairs used in the amplification contained both XhoI and BamI restriction sites. Primer… …
  • Yan Qun Chen, Ming-Shang Kuo, Shuyu Li, Hai H. Bui, David A. Peake, Philip E. Sanders, Stefan J. Thibodeaux, Shaoyou Chu, Yue-Wei Qian, Yang Zhao, David S. Bredt, David E. Moller, Robert J. Konrad, Anne P. Beigneux, Stephen G. Young, and Guoqing Cao
    AGPAT6 Is a Novel Microsomal Glycerol-3-phosphate Acyltransferase
    J. Biol. Chem., Apr 2008; 283: 10048 – 10057.
    … …Human AGPAT6-Human normal tissue cDNA panels were obtained from BioChain (Hayward, CA) and PrimGen (Bothell, WA). TaqMan real time quantitative…Procedures using human normal tissue cDNA panel obtained from BioChain (A) or PrimGen (B). Data were expressed as mean S.D. (n… …
  • Sheli R. Radoshitzky, Jens H. Kuhn, Christina F. Spiropoulou, C¨¦sar G. Albariño, Dan P. Nguyen, Jorge Salazar-Bravo, Tatyana Dorfman, Amy S. Lee, Enxiu Wang, Susan R. Ross, Hyeryun Choe, and Michael Farzan
    Receptor determinants of zoonotic transmission of New World hemorrhagic fever arenaviruses
    PNAS, Feb 2008; 105: 2664 – 2669.
    … …provided by Colin Parrish (Cornell University, Ithaca, NY). R. norvegicus TfR1 (rTfR1) was cloned from a rat liver cDNA library (BioChain) by using the following primers: 5-AATAACTACTTCGAAGCCACCATGGATCAAGCCAGATCAGCATTCTC-3 and 5-AATAACTACCTCGAGTTAAAACTCATTGTCAATATTCCAAATGTCACCAG-3…
  • YanQun Chen, Ming-Shang Kuo, Shuyu Li, Hai H. Bui, David A. Peake, Philip E. Sanders, Stefan J. Thibodeaux, Shaoyou Chu, Yue-Wei Qian, Yang Zhao, David S. Bredt, David E. Moller, Robert J. Konrad, Anne P. Beigneux, Stephen G. Young, and Guoqing Cao
    AGPAT6 Is a novel microsomal glycerol-3-phosphate acyltransferase (GPAT)
    J. Biol. Chem., Jan 2008; 10.1074/jbc.M708151200.
    … …AGPAT6–Human normal tissue cDNA panels were obtained from BioChain (Hayward, CA) and PrimGen (Bothell, WA). TaqMan real-time quantitative…Procedures using human normal tissue cDNA panel obtained from BioChain (A) or PrimGen (B). Data were expressed as mean ? SD (n = 3… …
  • Glenn D. Rosen, Jilin Bai, Yu Wang, Christopher G. Fiondella, Steven W. Threlkeld, Joseph J. LoTurco, and Albert M. Galaburda
    Disruption of Neuronal Migration by RNAi of Dyx1c1 Results in Neocortical and Hippocampal Malformations
    Cereb Cortex, Nov 2007; 17: 2562 – 2572.
    … …Dyx1c1 as described below. The cDNA prepared from frontal, parietal, and occipital lobes of human embryonic brain (20 weeks, Biochain Institute, Hayward, CA) was amplified with respective forward and reverse primers (GGG AGA AAT TCA GAA AAT ATA TTT AC and TTA… …
  • April Smith Torhan, Boonlert Cheewatrakoolpong, Lia Kwee, and Scott Greenfeder
    Cloning and characterization of the hamster and guinea pig nicotinic acid receptors
    J. Lipid Res., Sep 2007; 48: 2065 – 2071.
    … …GPR109A (nicotinic acid receptor) receptor Guinea pig and hamster genomic DNA and cDNA from various tissues were purchased from Biochain Institute, Inc. (Hayward, CA). The Advantage 2 PCR kit was purchased from Clontech (Mountain View, CA). All primers were synthesized… …
  • Jeannette M Moebius, Darius Widera, Juergen Schmitz, Christian Kaltschmidt, and Christoph Piechaczek
    Impact of polysialylated CD56 on natural killer cell cytotoxicity
    BMC Immunol. 2007; 8: 13. Published online 2007 August 6. doi: 10.1186/1471-2172-8-13.
    … …Human normal adult brain cDNA (1 µl per PCR reaction) and human fetal brain cDNA (2 µl per PCR reaction) were purchased from Biochain Institute, Inc (Hayward, CA, USA)…. …
  • Waddah A. Alrefai, Xiaoming Wen, Wen Jiang, Jonathan P. Katz, Kris A Steinbrecher, Mitchell B Cohen, MD, Ifor R. Williams, Pradeep K. Dudeja, and Gary D. Wu
    Molecular Cloning and Promoter Analysis of Down-Regulated in Adenoma DRA
    Am J Physiol Gastrointest Liver Physiol, Aug 2007; 10.1152/ajpgi.00029.2007.
    … …small intestine, one step real time PCR was performed utilizing cDNA from duodenum, jejunum and ileum that were obtained from BioChain (Hayward, CA) DNase I footprinting-688(DRA)LUC was digested with Hind III and end labeled with 32 P using Klenow. After releasing… …
  • Xudong Liao, Wei Wang, Shenghan Chen, and Qingyu Wu
    Role of glycosylation in corin zymogen activation
    J. Biol. Chem., Jul 2007; 10.1074/jbc.M703687200.
    … …A human corin cDNA fragment containing the entire open-reading frame was amplified by PCR from a human fetal heart library (BioChain, Hayward, CA) using Phusion High-Fidelity polymerase with sense primer 5′-AGA GAA AAG CGA CCA AGA TAA A-3′ and anti-sense primer… …
  • Nattachet Plengvidhya, Suwattanee Kooptiwut, Napat Songtawee, Asako Doi, Hiroto Furuta, Masahiro Nishi, Kishio Nanjo, Wiwit Tantibhedhyangkul, Watip Boonyasrisawat, Pa-thai Yenchitsomanus, Alessandro Doria, and Napatawn Banchuin
    PAX4 Mutations in Thais with Maturity Onset Diabetes of the Young
    J. Clin. Endocrinol. Metab., Jul 2007; 92: 2821 – 2826.
    … …PAX4 variant Full-length human wild-type PAX4 cDNA was amplified from PCR Ready First Strand cDNA of normal human placenta (BioChain Institute, Inc., PSA Vista, Singapore) by PCR using platinum Pfx DNA polymerase (Invitrogen, Leek, The Netherlands) and subcloned… …
  • Marie Brulliard, Dalia Lorphelin, Olivier Collignon, Walter Lorphelin, Benoit Thouvenot, Emmanuel Gothi? Sandrine Jacquenet, Virginie Ogier, Olivier Roitel, Jean-Marie Monnez, Pierre Vallois, Frances T. Yen, Olivier Poch, Marc Guenneugues, Gilles Karcher, Pierre Oudet, and Bernard E. Bihain
    Nonrandom variations in human cancer ESTs indicate that mRNA heterogeneity increases during carcinogenesis
    PNAS, May 2007; 104: 7522 – 7527.
    … …Tissue Versus Normal Adjacent Tissue. cDNA from cancerous and adjacent normal kidney tissues obtained from the same individual (BioChain; CliniSciences, Montrouge, France) were amplified by PCR with oligonucleotides complementary to the ENO1 gene (positions 1505-1524… …
  • Claudia Palena, Dmitry E. Polev, Kwong Y. Tsang, Romaine I. Fernando, Mary Litzinger, Larisa L. Krukovskaya, Ancha V. Baranova, Andrei P. Kozlov, and Jeffrey Schlom
    The Human T-Box Mesodermal Transcription Factor Brachyury Is a Candidate Target for T-Cell–Mediated Cancer Immunotherapy
    Clin. Cancer Res., Apr 2007; 13: 2471 – 2478.
    … …Commercially available tumor tissue-derived cDNAs, prepared from different individuals with different tumor types, were obtained from BioChain Institute Inc. (Hayward, CA). Total RNA from human cancer cell lines and normal CD19+ isolated B cells were prepared by using… …
  • Jaime Kim, Karla A. Temple, Sara A. Jones, Kimberly N. Meredith, Juliana L. Basko, and Matthew J. Brady
    Differential Modulation of 3T3-L1 Adipogenesis Mediated by 11-Hydroxysteroid Dehydrogenase-1 Levels
    J. Biol. Chem., Apr 2007; 282: 11038 – 11046.
    … …ACT TAC AAA CAT. Replicate PCRs (final volume, 50 mul) were run using 2.5 ng of murine hepatic or adipocytic cDNA library (Biochain Institute Inc., Hayward, CA), 100 pmol of each primer, and 400 mum dNTPs in 60 mm Tris, pH 9.0, 15 mm ammonium sulfate, 2 mm…
  • Nattachet Plengvidhya, Suwattnee Kooptiwut, Napat Songtawee, Asako Doi, Hiroto Furata, Masahiro Nishi, Kishio Nanjo, Wiwit Tantibhedhyangkul, Watip Boonyasrisawat, Pa-thai Yenchitsomanus, Alessandro Doria, and Napatawn Banchuin
    PAX4 Mutations in Thais with Maturity-Onset Diabetes of the Young
    J. Clin. Endocrinol. Metab., Apr 2007; 10.1210/jc.2006-1927.
    … …Pax4 variant Full-length human wild-type PAX4 cDNA was amplified from PCR Ready First Strand cDNA of normal human placenta (BioChain Institute, Inc., Singapore) by PCR using platinum Pfx DNA polymerase (Invitrogen, Leek, Netherlands) and subcloned into a pcDNA… …
  • Craig S. McLachlan, Melissa L. Chen, Clare N. Lynex, Denise L. M. Goh, Sydney Brenner, and Stacey K. H. Tay
    Changes in PDE4D Isoforms in the Hippocampus of a Patient With Advanced Alzheimer Disease
    Arch Neurol, Mar 2007; 64: 456 – 457.
    … …hippocampus by profiling PDE4D expression in the healthy adult and AD hippocampus. Methods Commercial complementary DNA (cDNA) (BioChain Institute, Hayward, Calif) was obtained for 3 normal adult human hippocampal samples and from a patient diagnosed with advanced… …
  • Jaime Kim, Karla A. Temple, Sara A. Jones, Kimberly N. Meredith, Juliana L. Basko, and Matthew J. Brady
    Differential modulation of 3T3-L1 adipogenesis mediated by 11-hydroxysteroid dehydrogenase-1 levels
    J. Biol. Chem., Feb 2007; 10.1074/jbc.M606197200.
    … …TAC AAA CAT. Replicate PCR reactions (50 l final volume) were run using 2.5 ng of murine hepatic or adipocytic cDNA library (Biochain Institute Inc, Hayward, CA), 100 pmol of each primer and 400 M dNTPs in 60 mM Tris (pH 9.0)/15 mM ammonium sulfate/2 mM MgCl2… …
  • Glenn D. Rosen, Jilin Bai, Yu Wang, Christopher G. Fiondella, Steven W. Threlkeld, Joseph J. LoTurco, and Albert M. Galaburda
    Disruption of Neuronal Migration by RNAi of Dyx1c1 Results in Neocortical and Hippocampal Malformations
    Cereb Cortex, Jan 2007; 10.1093/cercor/bhl162.
    … …Dyx1c1 as described below. The cDNA prepared from frontal, parietal, and occipital lobes of human embryonic brain (20 weeks, Biochain Institute, Hayward, CA) was amplified with respective forward and reverse primers (GGG AGA AAT TCA GAA AAT ATA TTT AC and TTA… …
  • Vincent Castronovo, David Waltregny, Philippe Kischel, Christoph Roesli, Giuliano Elia, Jascha-N. Rybak, and Dario Neri
    A Chemical Proteomics Approach for the Identification of Accessible Antigens Expressed in Human Kidney Cancer
    Mol. Cell. Proteomics, Nov 2006; 5: 2083 – 2091.
    … …clear cell carcinoma, granular cell carcinoma, transitional cell carcinoma, normal adult, and fetal kidney was purchased from BioChain (Hayward, CA). PCR was performed using the Hot Start Taq polymerase kit (Qiagen). PCR conditions were as follows: denaturation… …
  • Nawajes A. Mandal and Radha Ayyagari
    Complement Factor H: Spatial and Temporal Expression and Localization in the Eye
    Invest. Ophthalmol. Vis. Sci., Sep 2006; 47: 4091 – 4097.
    … …TRIzol. Human major organ cDNAs from brain, liver, lungs, heart, spleen, pancreas, kidney, muscle, and placenta were obtained (BioChain Institute Inc., Hayward, CA) and were used for expression studies. Human retina quick-clone cDNA (Clontech) was also used for…
  • Ryu Takeya, Masahiko Taura, Tomoko Yamasaki, Seiji Naito, and Hideki Sumimoto
    Expression and function of Noxo1, an alternative splicing form of the NADPH oxidase organizer 1
    FEBS J., Aug 2006; 273: 3663 – 3677.
    … …cDNA panels and Human Fetal Neural Tissue cDNA panels (Biochain Institute, Hayward, CA, USA), according to the manufacturer’s…analyzed by PCR using Human Fetal Neural Tissue cDNA panels (BiochainInstitute). The PCR products were subjected to 10 polyacrylamide… …
  • Silviu Locovei, Li Bao, and Gerhard Dahl
    Pannexin 1 in erythrocytes: Function without a gap
    PNAS, May 2006; 103: 7655 – 7659.
    … …Data were normalized to the control condition (incubation in Krebs solution). Human bone marrow cDNA was obtained from BioChain Institute (Hayward, CA). For PCR amplification, the primers gaggtatctgaaagcaccacttcaagtaccc and gaccactgctcttaatattctccagtacc… …
  • Ya Xu, Li Lu, Clifford Greyson, Mona Rizeq, Karin Nunley, Beata Wyatt, Michael R. Bristow, Carlin S. Long, and Gregory G. Schwartz
    The PPAR- activator fenofibrate fails to provide myocardial protection in ischemia and reperfusion in pigs
    Am J Physiol Heart Circ Physiol, May 2006; 290: H1798 – H1807.
    … …the porcine liver (CPT-Ia) and muscle (CPT-Ib) genes were amplified from normal pig heart and liver with PCR-ready cDNAs (BioChain, Hayward, CA) by using 20-mer primers complementary to bases 196-215 (forward) and 390-409 (reverse) for CPT-Ia and bases… …
  • Akira Kawata, Junko Iida, Mitsunobu Ikeda, Yuji Sato, Hiroki Mori, Ai Kansaku, Kazutaka Sumita, Naoyuki Fujiwara, Chiaki Rokukawa, Mamiko Hamano, Susumu Hirabayashi, and Yutaka Hata
    CIN85 Is Localized at Synapses and Forms a Complex with S-SCAM via Dendrin 
    J. Biochem. (Tokyo), May 2006; 139: 931 – 939.
    … …5-gcggccgcctctcactgc-ctcttcct-3 for dendrin; 5-gaattcgtggaggccatagtggagtt-3 and 5-gtcgactattttgattgtagagctttc-3 for CIN85) on human brain cDNA (BioChain Institute Inc.). pET32a vector was purchased from Takara Biotechnology. pClneoMyc, pBudCE2 and pBTM116KM vectors were described… …
  • Morgan D. Fullerton, Laura Wagner, Zongfei Yuan, and Marica Bakovic
    Impaired trafficking of choline transporter-like protein-1 at plasma membrane and inhibition of choline transport in THP-1 monocyte-derived macrophages
    Am J Physiol Cell Physiol, Apr 2006; 290: C1230 – C1238.
    … …30 s at 72C, and a final extension for 10 min at 72C. The CHT1 mRNA in THP-1 cells was compared with human brain cDNA (BioChain) as a positive control using PCR conditions of 94C for 10 min, 40 cycles of 45 s at 94C, 45 s at 50C, and 45 s at 72C… …
  • M. Petroziello, Maureen C. Ryan, Leia Smith, Ronald Simon, Guido Sauter, Ezogelin Oflazoglu, Svetlana O. Doronina, Damon L. Meyer, Joseph A. Francisco, Paul Carter, Peter D. Senter, John A. Copland, Christopher G. Wood, and Alan F. Wahl
    Lymphocyte Activation Antigen CD70 Expressed by Renal Cell Carcinoma Is a Potential Therapeutic Target for Anti-CD70 Antibody-Drug Conjugates
    Che-Leung Law, Kristine A. Gordon, Brian E. Toki, Andrew K. Yamane, Michelle A. Hering, Charles G. Cerveny, Joseph
    Cancer Res., Feb 2006; 66: 2328 – 2337.
    … …hamster ovary cells and purified by protein A chromatography. Human RCC tumor and normal kidney cDNA were purchased from BioChain Institute (Hayward, CA). Fresh frozen RCC tumors were obtained from Bio RESEARCH Support (Boca Raton, FL). Staged frozen… …
  • Geoffrey W. Stone, Suzanne Barzee, Victoria Snarsky, Kristin Kee, Celsa A. Spina, Xiao-Fang Yu, and Richard S. Kornbluth
    Multimeric Soluble CD40 Ligand and GITR Ligand as Adjuvants for Human Immunodeficiency Virus DNA Vaccines 
    J. Virol., Feb 2006; 80: 1762 – 1772.
    … …To construct the plasmid for a 2-trimer soluble form of murine CD40L (pAcrp30-CD40L), cDNA from mouse adipose tissue (BioChain Institute, Inc., Hayward, CA) was used to obtain a PCR product for the 5 untranslated region and 5 coding sequence of Acrp30… …
  • Tapan K. Bera, Ashley Saint Fleur, Yoomi Lee, Andre Kydd, Yoonsoo Hahn, Nicholas C. Popescu, Drazen B. Zimonjic, Byungkook Lee, and Ira Pastan
    POTE Paralogs Are Induced and Differentially Expressed in Many Cancers
    Cancer Res., Jan 2006; 66: 52 – 56.
    … …PCR-ready cDNAs from breast and colon cancers were purchased from OriGene (Gaithersburg, MD) and BioChain Institute, Inc. (Hayward, CA), respectively. PCR was done on cDNA from different normal and cancer tissues following the… …
  • Jutamas Ngampasutadol, Sanjay Ram, Anna M. Blom, Hanna Jarva, Ann E. Jerse, Egil Lien, Jon Goguen, Sunita Gulati, and Peter A. Rice
    From The Cover: Human C4b-binding protein selectively interacts with Neisseria gonorrhoeae and results in species-specific infection
    PNAS, Nov 2005; 102: 17142 – 17147.
    … …in ref. 18. Sequencing of Rhesus Macaque C4bp CCP1 and Sequence Alignment. Rhesus macaque liver cDNA was purchased from BioChain (Hayward, CA). CCP1 of rhesus C4bp was amplified by using primer pair 5-TCTTCCAAATGACCTTGATCGCTG-3 and 5-GGCTTGGTCTCCAAACGCCTATT-3… …
  • Chi-Liang Eric Yen, Charles H. Brown, IV, Mara Monetti, and Robert V. Farese, Jr.
    A human skin multifunctional O-acyltransferase that catalyzes the synthesis of acylglycerols, waxes, and retinyl esters
    J. Lipid Res., Nov 2005; 46: 2388 – 2397.
    … …were selected with Primer Express software (Applied Biosystems, Foster City, CA). Human cDNAs of various tissues were from BioChain (Hayward, CA). Insect cell expression studies MFAT cDNAs [with and without an N-terminal FLAG epitope: MGDYKDDDDG… …
  • Jonathan D Turner and Claude P Muller
    Structure of the glucocorticoid receptor (NR3C1) gene 5′ untranslated region: identification, and tissue distribution of multiple new human exon 1
    J. Mol. Endocrinol., Oct 2005; 35: 283 – 292.
    … …CD19+ B cells and CD11c CD123+ (BDCA-4+) plasmacytoid dendritic cells. Hippocampal cDNA (dT16 primed) was obtained from BioChain (Gentaur, Brussels, Belgium). Isolation of mRNA, and reverse transcription Briefly, 106 purified cells or 10 mg of… …
  • Maria E Mycielska, Christopher P Palmer, William J Brackenbury, and Mustafa B. A Djamgoz
    Expression of Na+-dependent citrate transport in a strongly metastatic human prostate cancer PC-3M cell line: regulation by voltage-gated Na+ channel activity
    J. Physiol., Mar 2005; 563: 393 – 408.
    … Human liver and kidney cDNAs were obtained from Biochain (USA). …
    … The quality of cDNAs was verified using primers to {beta}-actin (Biochain). …
  • Kohsuke Kanekura, Yuichi Hashimoto, Yoshiko Kita, Jumpei Sasabe, Sadakazu Aiso, Ikuo Nishimoto, and Masaaki Matsuoka
    A Rac1/Phosphatidylinositol 3-Kinase/Akt3 Anti-apoptotic Pathway, Triggered by AlsinLF, the Product of the ALS2 Gene, Antagonizes Cu/Zn-superoxide Dismutase (SOD1) Mutant-induced Motoneuronal Cell Death
    Biol. Chem., Feb 2005; 280: 4532 – 4543.
    … cDNA was PCR-amplified from cDNAs isolated from the frontal lobe of a human brain cerebrum (BioChain, Hayward, CA) with a sense primer (CGGGATCCATGGCTGCAATCCGAAAGAAGC) and an antisense primer (GGAATTCTCAGAGAATGGGACAGCCCC). …
    … A human RhoG cDNA was obtained from a human frontal lobe cDNA library (BioChain) by PCR with a sense primer (CGGGATCCATGCAGAGCATCAAGTGCGTG) and an antisense primer (GGAATTCTCACAAGAGGATGCAGGACC). cDNAs for RhoB, …
  • Toshihiro Uchida, Hideo Wada, Minoru Mizutani, Miho Iwashita, Hiroaki Ishihara, Toshiro Shibano, Misako Suzuki, Yumiko Matsubara, Kenji Soejima, Masanori Matsumoto, Yoshihiro Fujimura, Yasuo Ikeda, and Mitsuru Murata
    Identification of novel mutations in ADAMTS13 in an adult patient with congenital thrombotic thrombocytopenic purpura
    Blood, May 2004; 10.1182/blood-2004-02-0715
    … ADAMTS13 cDNA (GenBank accession number NM139025) was PCR-amplified from a human fetal liver cDNA library (BioChain Institute Inc.), and cloned into 6 pcDNA3.1/myc-His. …
  • Kohsuke Kanekura, Yuichi Hashimoto, Takako Niikura, Sadakazu Aiso, Masaaki Matsuoka, and Ikuo Nishimoto
    Alsin, the Product of ALS2 Gene, Suppresses SOD1 Mutant Neurotoxicity through RhoGEF Domain by Interacting with SOD1 Mutants
    Biol. Chem., Apr 2004; 279: 19247 – 19256
    … DNA Construction —Full-length alsin SF cDNA was obtained from human heart cDNA (BioChain) by PCR using a sense primer (ACTAGTACCATGGACCAAAGAAGAGAAGCTC) and an antisense primer (GCGGCCGCGCTACCAAGCCTTACCCCTTTTAAAG). …
    … EcoRI site to the NheI site of alsin LF, was obtained from human thalamus cDNA (BioChain) by PCR using a sense primer (GCTTCCATAGTGGAGCAGTGACAGAC) and an antisense primer (GCGGCCGCCTCAATGAGGCTCCATGCTGACC). …
  • Kou Miyazaki, Tomoyuki Fujita, Toshinori Ozaki, Chiaki Kato, Yuka Kurose, Maya Sakamoto, Shinsuke Kato, Takeshi Goto, Yasuto Itoyama, Masashi Aoki, and Akira Nakagawara
    NEDL1, a Novel Ubiquitin-protein Isopeptide Ligase for Dishevelled-1, Targets Mutant Superoxide Dismutase-1
    J. Biol. Chem., Mar 2004; 279: 11327 – 11335.
    … For reverse transcription (RT)-PCR analysis, cDNA derived from adult human neural system (BioChainInstitute, Hayward, CA) was subjected to PCR amplification using the following primers: NEDL1 , 5′-CCGATTTGAGATCACTTCCTCC-3′ …
  • Susumu Hirabayashi, Makiko Tajima, Ikuko Yao, Wataru Nishimura, Hiroki Mori, and Yutaka Hata
    JAM4, a Junctional Cell Adhesion Molecule Interacting with a Tight Junction Protein, MAGI-1
    Mol. Cell. Biol., Jun 2003; 23: 4267 – 4282. … of mouse JAM1 and mouse JAM4, respectively, were obtained by PCR on mouse lung cDNA (BioChain, Inc.) and kidney cDNA (Clontech). pGex4T-1 and pFLAG-CMV-1 were purchased from Amersham Pharmacia Biotech and …
  • Maurice Phil DeYoung, Matthew Tress, and Ramaswamy Narayanan
    Identification of Down’s syndrome critical locus gene SIM2-s as a drug therapy target for solid tumors
    PNAS, Apr 2003; 100: 4760 – 4765.
    … Normal and fetal-tissue cDNAs were from CLONTECH and the Biochain Institute (San Leandro, CA).
  • Thanh H. Vu, Nguyen V. Chuyen, Tao Li, and Andrew R. Hoffman
    Loss of Imprinting of IGF2 Sense and Antisense Transcripts in Wilms’ Tumor
    Cancer Res., Apr 2003; 63: 1900 – 1905.
    … cDNAs from poly(A + ) RNA were also obtained from Clontech (Palo Alto, CA) and Biochain (San Leandro, CA). …
  • Hideto Jinno, Toshiko Tanaka-Kagawa, Nobumitsu Hanioka, Mayumi Saeki, Seiichi Ishida, Tetsuji Nishimura, Masanori Ando, Yoshiro Saito, Shogo Ozawa, and Jun-ichi Sawada
    Glucuronidation of 7-Ethyl-10-hydroxycamptothecin (SN-38), an Active Metabolite of Irinotecan (CPT-11), by Human UGT1A1 Variants, G71R, P229Q, and Y486D
    Drug Metab. Dispos., Jan 2003; 31: 108 – 113.
    …Human adult normal liver cDNA was purchased from BioChain Institute Inc. …
  • Tatsuya Sawasaki, Tomio Ogasawara, Ryo Morishita, and Yaeta Endo
    A cell-free protein synthesis system for high-throughput proteomics
    PNAS, Nov 2002; 99: 14652 – 14657.
    … These genes were cloned from tissue (heart, brain, kidney, liver, placenta) cDNAs (BioChain Institute, #0516001).
  • Minori Kono, Hidetaka Nagata, Sinobu Umemura, Seiji Kawana, and R. Yoshiyuki Osamura
    In situ expression of corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) genes in human skin
    FASEB J, Aug 2001; 102541.
    … (pituitary gland and thalamus cDNA from BioChain…)

mRNAx

  • MicroRNA expression profiling of carcinoma in situ cells of the testis
    Guy Wayne Novotny, Kirstine C Belling, Jesper Bertram Bramsen, John E Nielsen, Jette Bork-Jensen, Kristian Almstrup, Si Brask Sonne, Jørgen Kjems, Ewa Rajpert-De Meyts, Henrik Leffers
    Endocr. Relat. Cancer (4.4), 2012-06-25, 19, 365-79
    … Normal samples were obtained from areas with preserved complete spermatogenesis, where no tumour or CIS cells were present, or purchased commercially Applied Biosystems/Ambion, Foster City, CA, USA and BioChain Institute, Newark, CA, USA). …
  • Thomas Veitinger, Jeffrey R. Riffell, Sophie Veitinger, Jaclyn M. Nascimento, Annika Triller, Charlie Chandsawangbhuwana, Katlen Schwane, Andreas Geerts, Frank Wunder, Michael W. Berns, Eva M. Neuhaus, Richard K. Zimmer, Marc Spehr, and Hanns Hatt
    Chemosensory Ca2+ Dynamics Correlate with Diverse Behavioral Phenotypes in Human Sperm
    J. Biol. Chem., May 2011; 286: 17311 – 17325.
    … …Applied Biosystems PRISM 7900 sequence detection system. Human tissue mRNA probes were obtained from Ambion, Inc. (Austin, TX), BioChain Institute, Inc. (Hayward, CA), Clontech Laboratories (Mountain View, CA), and Stratagene (La Jolla, CA). DNase I digestion… …
  • Henning Kessler, Angelika Herm-Götz, Stephan Hegge, Manuel Rauch, Dominique Soldati-Favre, Friedrich Frischknecht, and Markus Meissner
    Microneme protein 8 ¨C a new essential invasion factor in Toxoplasma gondii
    J. Cell Sci., Apr 2008; 121: 947 – 956.
    … …of MIC8, MIC8-like1 and MIC8-like2 was confirmed by RT-PCR (Titan one tube RT-PCR; Roche) on mRNA (isolated with mRNAeasy; Biochain) using oligonucleotide pairs MIC8-s (5-GCGGCAATTGCATTGGTGGTTGTGG-3), MIC8as (5-GCCTTAATTAAGACGCGATACCGCCCGAAGG-3), MIC8/2-s… …
  • Tayebeh Rezaie, David M. Waitzman, Jennifer L. Seeman, Paul L. Kaufman, and Mansoor Sarfarazi
    Molecular Cloning and Expression Profiling of Optineurin in the Rhesus Monkey 
    Invest. Ophthalmol. Vis. Sci., Jul 2005; 46: 2404 – 2410.
    … …normalized by amount of mRNA) blot from Biochain Institute (Hayward, CA) was used…prehybridized (FastHyb solution; Biochain) for 3 hours at 65C and subsequently…of an mRNA multiple tissue blot (BioChain). As shown in Figure 3 , two different… …
  • Xiaomin Zhang, Gohar Azhar, Ying Zhong, and Jeanne Y. Wei
    Identification of a Novel Serum Response Factor Cofactor in Cardiac Gene Regulation
    J. Biol. Chem., Dec 2004; 279: 55626 – 55632.
    … The human heart mRNA samples were obtained from Biochain Institute (Hayward, CA). …
  • Soji Kakiuchi, Yataro Daigo, Nobuhisa Ishikawa, Chiyuki Furukawa, Tatsuhiko Tsunoda, Seiji Yano, Kazuhiko Nakagawa, Takashi Tsuruo, Nobuoki Kohno, Masahiro Fukuoka, Saburo Sone, and Yusuke Nakamura
    Prediction of sensitivity of advanced non-small cell lung cancers to gefitinib (Iressa, ZD1839)
    Hum. Mol. Genet., Dec 2004; 13: 3029 – 3043.
    … probe, normal human lung poly(A) + RNA (BD Biosciences Clontech, Palo Alto, CA, USA andBIOCHAIN, Hayward, CA, USA) was amplified in the same way. …
  • Vidya Subramanian, Alexis Rothenberg, Carlos Gomez, Alex W. Cohen, Anne Garcia, Sucharita Bhattacharyya, Lawrence Shapiro, Rong Wang, Michael P. Lisanti, and Dawn L. Brasaemle
    Perilipin A mediates the reversible binding of CGI-58 to lipid droplets in 3T3-L1 adipocytes
    J. Biol. Chem., Aug 2004; 10.1074/jbc.M407462200.
    … (Rockville, MD) and BioChain Institute, Inc. …
    … Nitrocellulose membranes containing poly A mRNA from mouse tissues (OriGene Technologies, Inc., Rockville, MD and BioChain Institute, Inc., Hayward, CA) were probed with 32 P-labeled cDNA probes for murine CGI-58. …
  • Hideto Jinno, Toshiko Tanaka-Kagawa, Akiko Ohno, Yuko Makino, Erika Matsushima, Nobumitsu Hanioka, and Masanori Ando
    Functional Characterization of Cytochrome P450 2B6 Allelic Variants
    Drug Metab. Dispos., Apr 2003; 31: 398 – 403.
    …Human adult normal liver mRNA was purchased from BioChain Institute Hayward, CA. …
  • Abe S, Katagiri T, Saito-Hisaminato A, Usami SI, Inoue Y, Tsunoda T, Nakamura Y.
    Identification of CRYM as a Candidate Responsible for Nonsyndromic Deafness, through cDNA Microarray Analysis of Human Cochlear and Vestibular Tissues
    Am J Hum Genet. 2003 Jan; 72(1): 73-82. published online before print December 6, 2002
    … …We obtained 70?0 µg of each amplified RNA (aRNA) sample. As a control, we mixed PolyA(+) RNAs derived from 29 normal human tissues (bone marrow, brain, heart, kidney, liver, lung, lymph node, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, uterus, fetal brain, fetal kidney, fetal liver, fetal lung [Clontech], colon, ovary [Biochain], and mesenteric adipose tissue). … …
  • Ramesh Ramakrishnan, David Dorris, Anna Lublinsky, Allen Nguyen, Marc Domanus, Anna Prokhorova, Linn Gieser, Edward Touma, Randall Lockner, Murthy Tata, Xiaomei Zhu, Marcus Patterson, Richard Shippy, Timothy J. Sendera, and Abhijit Mazumder
    An assessment of Motorola CodeLinkTM microarray performance for gene expression profiling applications
    Nucleic Acids Res., Apr 2002; 30: 30.
    … MATERIALS AND METHODS Target preparation Five micrograms of total RNA (BioChain, Hayward, CA) were added to a reaction mix in a final volume of 12 µl, …
    … compared within three human poly(A)+ RNA samples (heart lot#A403084, brain lot#A311144 and kidney lot#A404013 from BioChain) using the Motorola CodeLink(TM) UniSet Human 1 expression bioarrays and the ABI TaqMan (R) products. …
  • Jian Jin, Xuehui Chen, Yan Zhou, Mark Bartlam, Qing Guo, Yiwei Liu, Yixin Sun, Yu Gao, Sheng Ye, Guangtao Li, Zihe Rao, Boqin Qiang, and Jiangang Yuan
    Crystal structure of the catalytic domain of a human thioredoxin-like protein: Implications for substrate specificity and a novel regulation mechanism
    Eur. J. Biochem., Apr 2002; 269: 2060 – 2068.
    … DDRT-PCR and full-length cDNA isolation Total RNA (2.5 µg) from 13- and 33-week-old human fetal cerebrum (Biochain) was reverse transcribed by Superscript II (Gibco-BRL) using a single-base anchored 3′ primer (5′-AAGCTTTTTTTTTTTN-3′, N=C, G, …
    … Northern blot analysis Total Poly(A) + RNA from 13- and 33-week-old human fetal cerebrum (Biochain) was electrophoresed in a 1% agarose gel containing 0.66 M formaldehyde and was blotted onto a …
  • Byung-Taek Kim, Hiroshi Kitagawa, Jun-ichi Tamura, Toshiyuki Saito, Marion Kusche-Gullberg, Ulf Lindahl, and Kazuyuki Sugahara
    Human tumor suppressor EXT gene family members EXTL1 and EXTL3 encode  1,4- N-acetylglucosaminyltransferases that likely are involved in heparan sulfate/ heparin biosynthesis
    PNAS, Jun 2001; 98: 7176 – 7181.
    … was amplified with the first-strand cDNA transcribed from human adult brain poly (A) + RNA (BiochainInstitute, San Leandro, CA) as a template by PCR by using a 5′ primer (5′-ATTGATCACATGGTGGCAGCTGCAACTG-3′).
  • Huibin Yue, P. Scott Eastman, Bruce B. Wang, James Minor, Michael H. Doctolero, Rachel L. Nuttall, Robert Stack, John W. Becker, Julie R. Montgomery, Marina Vainer, and Rick Johnston
    An evaluation of the performance of cDNA microarrays for detecting changes in global mRNA expression
    Nucleic Acids Res., Apr 2001; 29: 41.
    … Oligotex resin (Qiagen, Valencia, CA) from commercially available human placenta, brain and heart total RNA (Biochain, San Leandro, CA). …
    … done in the presence of 200 ng poly(A) mRNA, from either human brain or heart (Biochain, Hayward, CA). …
  • Chang Bai, Brett Connolly, Michael L. Metzker, Catherine A. Hilliard, Xiaomei Liu, Volker Sandig, Avery Soderman, Sheila M. Galloway, Qingyun Liu, Christopher P. Austin, and C. Thomas Caskey
    Overexpression of M68/DcR3 in human gastrointestinal tract tumors independent of gene amplification and its location in a four-gene cluster
    PNAS, Feb 2000; 97: 1230 – 1235.
    … Northern Analysis. mRNA isolated from human tumor samples was obtained from BioChain Institute, San Leandro, CA. …
  • Adrienne E. Dubin, Rene Huvar, Michael R. D’Andrea, Jayashree Pyati, Jessica Y. Zhu, K. C. Joy, Sandy J. Wilson, Jose E. Galindo, Charles A. Glass, Lin Luo, Michael R. Jackson, Timothy W. Lovenberg, and Mark G. Erlander
    The Pharmacological and Functional Characteristics of the Serotonin 5-HT3A Receptor Are Specifically Modified by a 5-HT3B Receptor Subunit
    J. Biol. Chem., Oct 1999; 274: 30799 – 30810.
    … Total RNA from normal human ascending and descending colon (CDP-061068; lot 8906066; CDP-061069; lot 8906067; BioChain Institute, Inc.) and 5 µg of each poly(A) RNA from normal human small intestine and …
  • Henry M. Sarau, Robert S. Ames, Jon Chambers, Catherine Ellis, Nabil Elshourbagy, James J. Foley, Dulcie B. Schmidt, Roseanna M. Muccitelli, Owen Jenkins, Paul R. Murdock, Nicole C. Herrity, Wendy Halsey, Ganesh Sathe, Alison I. Muir, Parvathi Nuthulaganti, George M. Dytko, Peter T. Buckley, Shelagh Wilson, Derk J. Bergsma, and Douglas W.P. Hay
    ACCELERATED COMMUNICATION: Identification, Molecular Cloning, Expression, and Characterization of a Cysteinyl Leukotriene Receptor
     Mol. Pharmacol., Sep 1999; 56: 657 – 663.
    …poly A+ RNA from multiple tissues of four different individuals (two males, two females, except prostate) was prepared, (Biochain, San Leandro, CA; Clontech, Palo Alto, CA; Invitrogen, Leek, the Netherlands; Analytical Biological Services, Wilmington, …

Total RNAx

  • Activation of human telomerase reverse transcriptase through gene fusion in clear cell sarcoma of the kidney
    J Karlsson, H Lilljebjörn, LH Mengelbier, A Valind, M Rissler, I Øra, T Fioretos, D Gisselsson
    Cancer Letters, February 28, 2015,  Volume 357, Issue 2, Pages 498-501
     at Lund University (Ethics Approval L2012-405) and the total RNA from 4 normal fetal kidneys
    was acquired from BioChain, Hayward, CA  mRNA libraries were created with the Truseq RNA
    sample preparation kit v2 (Illumina) according to the manufacturer’s instructions.
  • MiR-383 is Downregulated in Medulloblastoma and Targets Peroxiredoxin 3 (PRDX3)
    Kay Ka-Wai Li, Jesse Chung-Sean Pang, Kin-Mang Lau, Liangfu Zhou, Ying Mao, Yin Wang, Wai-Sang Poon, Ho-Keung Ng
    Brain Pathol. (4.7), 2013-07-18, 23, 413-25
    … RNAs of three normal cerebella served as controls, and they were obtained from Ambion, Clontech Laboratories Inc. (Palo Alto, CA, USA) and BioChain Institute, Inc. (Hayward, CA, USA). Quantitative RT-PCR. Real time RT-PCR was done to measure the expression of PRDX3. …
  • Characterization of recombinantly expressed rat and monkey intestinal alkaline phosphatases: in vitro studies and in vivo correlations
    Murali Subramanian, Sundeep Paruchury, Shashyendra Singh Gautam, Sheelendra Pratap Singh, Rambabu Arla, Sonia Pahwa, Snehasis Jana, Prasannakumar Katnapally, Vadari Yoganand, Basanth Lakshmaiah, Debarati Mazumder Tagore, Kaushik Ghosh, Punit Marathe, Sandhya Mandlekar
    Drug Metab. Dispos. (3.7), 2013-07-14, 41, 1425-32
    … The cloning, expression, purification, and biochemical characterization of rat and cynomolgus rIALPs are described in brief. The IALP genes were cloned from intestinal RNA (BioChain, Newark, CA) using standard molecular biology techniques. …
  • Distinct roles of CSF family cytokines in macrophage infiltration and activation in glioma progression and injury response
    Malgorzata Sielska, Piotr Przanowski, Bartosz Wylot, Konrad Gabrusiewicz, Marta Maleszewska, Magdalena Kijewska, Malgorzata Zawadzka, Joanna Kucharska, Katyayni Vinnakota, Helmut Kettenmann, Katarzyna Kotulska, Wieslawa Grajkowska, Bozena Kaminska
    J. Pathol. (7.3), 2013-07-10, 230, 310-21
    … The reference brain RNA was a mixture obtained from 23 normal brains (FirstChoice® Human Brain Reference RNA; Ambion, Austin, TX, USA); three samples were from single donors (Agilent Technologies, Palo Alto, CA, USA and BioChain, Heidelberg, Germany). …
  • Characterization of novel CD55 isoforms expression in normal and neoplastic tissues
    E D Vainer, K Meir, M Furman, I Semenenko, F Konikoff, G W Vainer
    Tissue Antigens (3), 2013-07-10, 82, 26-34
    … Total RNA isolation and cDNA synthesis. RNA was obtained from Ambion (Austin, TX), Asterand (Detroit, MI), AllCells (Emeryville, CA), Genomics Collaborative (Seracare; Cambridge, MA), BioChain (Newark, CA) and Ichilov medical center (Tel-aviv, Israel). …
  • Vascularized and functional human liver from an iPSC-derived organ bud transplant
    Takanori Takebe, Keisuke Sekine, Masahiro Enomura, Hiroyuki Koike, Masaki Kimura, Takunori Ogaeri, Ran-Ran Zhang, Yasuharu Ueno, Yun-Wen Zheng, Naoto Koike, Shinsuke Aoyama, Yasuhisa Adachi, Hideki Taniguchi
    Nature (36.1), 2013-07-03, ,
    … Gene-expression analysis. Quantitative PCR analyses were conducted as described previously 23 . Total RNA of human fetal liver (lot no. A601605) and human adult liver (lot no. B308121) were obtained from BioChain Institute (Hayward). Microarray and data analysis. …
  • miR-124 Inhibits STAT3 Signaling to Enhance T Cell-Mediated Immune Clearance of Glioma
    Jun Wei, Fei Wang, Ling-Yuan Kong, Shuo Xu, Tiffany Doucette, Sherise D Ferguson, Yuhui Yang, Kayla McEnery, Krishan Jethwa, Olsi Gjyshi, Wei Qiao, Nicholas B Levine, Frederick F Lang, Ganesh Rao, Gregory N Fuller, George A Calin, Amy B Heimberger
    Cancer Res. (8.2), 2013-07-01, 73, 3913-26
    … 260, and 280 nm. Total RNA extracted from patients was sent to Phalanx Biotech Group for miR and mRNA-gene expression analyses. Total RNA from normal brain tissues was obtained from BioChain. The results of the GBM …
  • MIR-137 Suppresses Growth and Invasion, is Downregulated in Oligodendroglial Tumors and Targets CSE1L
    Kay Ka-Wai Li, Ling Yang, Jesse Chung-Sean Pang, Aden Ka-Yin Chan, Liangfu Zhou, Ying Mao, Yin Wang, Kin-Mang Lau, Wai Sang Poon, Zhifeng Shi, Ho-Keung Ng
    Brain Pathol. (4.7), 2013-06-18, 23, 426-39
    … 2 −ΔΔCT ) method. RNAs of five normal adult brain tissues served as control and they were obtained from BD Biosciences Clontech (Palo Alto, CA, USA), BioChain (Hayward, CA, USA) and Ambion (Austin, TX, USA). Three of …
  • Opposing Mcl-1, the GALIG proapoptotic gene is upregulated as neutrophils die and underexpressed in Acute Myeloid Leukemia cells
    Lucile Mollet, Pauline Robinet, Martine Dubois, Axel Aurouet, Thierry Normand, Stéphane Charpentier, Adelin Sureau, Camille Grandclement, Francine Garnache-Ottou, Eric Deconinck, Fabienne Brulé, Pierre Simon Rohrlich, Alain Legrand
    Mol. Immunol. (2.9), 2013-06-17, 56, 123-8
    … The cDNA encoding the isoform 1 of human MCL-1 was synthesized from total heart RNA (BioChain, Newark, CA), amplified by PCR and subsequently inserted into a cytomegalovirus immediate early promoter-containing vector (pcDNA3, Invitrogen). …
  • Molecular cloning and tumour suppressor function analysis of canine REIC/Dkk-3 in mammary gland tumours
    Kazuhiko Ochiai, Masami Watanabe, Daigo Azakami, Masaki Michishita, Yasunaga Yoshikawa, Chihiro Udagawa, Pornphimon Metheenukul, Thippayarat Chahomchuen, Hiroshi Aoki, Hiromi Kumon, Masami Morimatsu, Toshinori Omi
    Vet. J. (2.8), 2013-05-31, ,
    … RNA was obtained from canine total brain RNA (BioChain) and reverse transcribed using SuperScript III (Life Technologies). PCR amplification was performed using PrimeSTAR (Takara) and dATP was added to the PCR products using a 10× A-attachment kit (Toyobo). …
  • Genistein downregulates onco-miR-1260b and inhibits Wnt-signalling in renal cancer cells
    H Hirata, K Ueno, K Nakajima, Z L Tabatabai, Y Hinoda, N Ishii, R Dahiya
    Br. J. Cancer (4.8), 2013-05-28, 108, 2070-8
    … In order to construct other target gene (sFRP1 and Smad4)-overexpressing plasmids, the gene was amplified with total RNA from human adult normal kidney tissues (catalogue number: R1234142-50, BioChain Institute, Newark, CA, USA) by reverse transcription–PCR (RT-PCR …
  • Expression analysis of tumor-related genes involved in critical regulatory pathways in schwannomas
    Miguel Torres-Martín, Victor Martinez-Glez, Carolina Peña-Granero, Luis Lassaletta, Alberto Isla, Jose M de Campos, Giovanny R Pinto, Rommel R Burbano, Bárbara Meléndez, Javier S Castresana, Juan A Rey
    Clin Transl Oncol (1.3), 2013-05-26, 15, 409-11
    … sabiosciences.com. Three commercial (US Biological BioChain, Hayward, CA, USA) human adult normal (non-tumoral) RNA were used as controls. The manufacturer’s protocol was used with small variations, as described [11]. All …
  • Detection of E2A-PBX1 fusion transcripts in human non-small-cell lung cancer
    Min-Li Mo, Zhao Chen, Hai-Meng Zhou, Hui Li, Tomomi Hirata, David M Jablons, Biao He
    J. Exp. Clin. Cancer Res. 0, 2013-05-23, 32, 29
    … RNA extraction and polymerase chain reaction (PCR) Total RNA from cell lines and tissues were extracted using TRIzol reagent (Invitrogen) according to manu- facture’s handbook. Adult normal lung total RNA was purchased at BioChain (CA). …
  • Effect of UDP-glucuronosyltransferase 1A8 polymorphism on raloxifene glucuronidation
    Yuki Kokawa, Naoki Kishi, Hideto Jinno, Toshiko Tanaka-Kagawa, Shizuo Narimatsu, Nobumitsu Hanioka
    Eur J Pharm Sci (3.3), 2013-05-13, 49, 199-205
    … Human small intestinal total RNA was purchased from BioChain Institute (Newark, CA, USA); pFastBac1 vector, Bac-to-Bac Baculovirus Expression System, Sf9 cells were from Invitrogen (Carlsbad, CA, USA); pGEM-T vector was from Promega (Madison, WI, USA); QuikChange …
  • DACT1, an antagonist to Wnt/β-catenin signaling, suppresses tumor cell growth and is frequently silenced in breast cancer
    X Yin, T Xiang, L Li, X Su, X Shu, X Luo, J Huang, Y Yuan, W Peng, M Oberst, K Kelly, G Ren, Q Tao.
    Breast Cancer Res. (5.8), 2013-03-12, 15, R23
    …Total RNA, including the total RNA from 4 normal pituitary tissues (BioChain Institute, Hayward, CA, USA) as a positive control, was reverse-transcribed using M-MLV transcriptase (Invitrogen, Carlsbad, CA, USA) with oligo(dT)12-18 primers (Invitrogen). … penicillin, and streptomycin. Normal human breast tissue RNA samples were purchased commercially (Stratagene, La Jolla, CA, USA; Millipore Chemicon, Billerica, MA, USA; BioChain Institute, Hayward, CA, USA). Primary breast …
  • Highly specific mRNA biomarkers for the identification of vaginal secretions in sexual assault investigations
    Erin K Hanson, Jack Ballantyne
    Sci. Justice (1), 2013-03-05, 53, 14-22
    … Whole transcriptome sequencing (RNA-Seq). Total RNA was isolated from two vaginal swabs (26 yr old female; 30 yr old female) as described above. Two human skin total RNA samples were obtained from commercial sources (BioChain, Hayward, CA; Zyagen, San Diego, CA). …
  • Cerebrospinal fluid fetuin-A is a biomarker of active multiple sclerosis
    Violaine K Harris, Nicola Donelan, Qi Jiang Yan, Kristi Clark, Amir Touray, Mustapha Rammal, Saud A Sadiq
    Mult. Scler. (4.2), 2013-02-25, ,
    … RNA analysis. RNA was extracted from 10 µm frozen sections from 10 distinct plaques present in eight different MS brains. Control RNA was from cerebellum and from frontal, temporal, parietal, and occipital lobes of 10 healthy brain donors (BioChainInstitute and Stratagene). …
  • Mutations in the hedgehog pathway genes SMO and PTCH1 in human gastric tumors
    Xi-De Wang, Hector Inzunza, Han Chang, Zhenhao Qi, Beihong Hu, Daniel Malone, John Cogswell
    PLoS ONE (4.4), 2013-01-25, 8, e54415
    … well module) (Applied Biosystems, Foster City, CA). Two normal gastric tissue total RNA samples were obtained commercially (BioChain, Newark, CA and Clontech, Mountain View, CA). Total RNA was quality checked with Agilent …
  • Silencing of the ARP2/3 complex disturbs pancreatic cancer cell migration
    Hanna E Rauhala, Susanna Teppo, Sanna Niemelä, Anne Kallioniemi
    Anticancer Res. (1.7), 2013-01-25, 33, 45-52
    … provider. Four normal human pancreatic total RNAs were obtained from Ambion (Life Technologies, Grand Island, NY, USA), Clontech Laboratories, Inc. (Mountain View, CA, USA) and BioChain Institute, Inc. (Newark, CA, USA). …
  • Exome RNA sequencing reveals rare and novel alternative transcripts
    Jonatan Halvardson, Ammar Zaghlool, Lars Feuk
    Nucleic Acids Res. (7.8), 2013-01-07, 41, e6
    … MATERIALS AND METHODS. Preparation of cDNA. Total RNA for all samples was purchased from BioChain. Starting with 1 µg of total RNA, cDNA was synthesized with the SMARTer Pico PCR cDNA Synthesis kit (Clontech) according to manufacturer’s recommendations.
  • Reduced expression of NLRP3 and MEFV in human ischemic heart tissue
    Cecilia Hermansson, Annika Lundqvist, Carina Wasslavik, Lars Palmqvist, Anders Jeppsson, Lillemor Mattsson Hultén
    Biochem. Biophys. Res. Commun. (2.6), 2013-01-04, 430, 425-8
    … written informed consent. For control samples, we purchased total RNA from right atrium from normal tissue from three human adults (Invitrogen and BioChain, CA, USA). 2.2. Quantitative PCR (Q-PCR). RNA was isolated from …
  • MiR-383 is Downregulated in Medulloblastoma and Targets Peroxiredoxin 3 (PRDX3)
    Kay Ka-Wai Li, Jesse Chung-Sean Pang, Kin-Mang Lau, Liangfu Zhou, Ying Mao, Yin Wang, Wai-Sang Poon, Ho-Keung Ng
    Brain Pathol. (4.7), 2013-07-18, 23, 413-25
    … RNAs of three normal cerebella served as controls, and they were obtained from Ambion, Clontech Laboratories Inc. (Palo Alto, CA, USA) and BioChain Institute, Inc. (Hayward, CA, USA). Quantitative RT-PCR. Real time RT-PCR was done to measure the expression of PRDX3. …
  • Gene expression analysis of aberrant signaling pathways in meningiomas
    Torres‑Martín, Martinez‑Glez
    Oncology … 0, , ,
    … com. A control comprising three commercial human adult normal (non-tumoral) RNA from cerebral meninges (US BiologicalBioChain, Hayward, CA, USA) was used. The manufacturer’s instructions were used with small variations, as described (18). …
  • Automating Directional Small RNA Library Preparation for Illumina GA Sequencing
    Berger, Butler, Olenic, Yeung
    Journal of … 0, , ,
    … For comparison, a manual bench control was performed with 5 µg of Total Human RNA (BioChain Inc.), following the NEB instruction manual (NEB# E7300S/L). As with samples prepared on the Apollo 324 system, amplified product was purified using AMPure XP beads and …
  • Improved RNA-seq of blood-derived RNA increases gene discovery and coverage
    Pease, Kinross
    Nature Methods 0, , ,
    … Globin-Zero[trade] depletes >99% of rRNA and globin mRNA from all samples. (a,b) Five micrograms of (a) fragmented or (b) intact RNA purified from human erythroid cells (BioChain) was treated with either Globin-Zero ™ (blue) or Method L (red), an older depletion method. …
  • Oncogenic miRNA-182-5p targets Smad4 and RECK in human bladder cancer
    Hiroshi Hirata, Koji Ueno, Varahram Shahryari, Yuichiro Tanaka, Z Laura Tabatabai, Yuji Hinoda, Rajvir Dahiya
    PLoS ONE (4.4), 2012-12-11, 7, e51056
    … In order to construct target gene (RECK, Smad4) over expressing plasmids, the genes were amplified with total RNA from human adult normal kidney tissues (catalog#: R1234142-50, BioChain Institute, Newark, CA) and RWPE-1 by transcription–polymerase chain reaction (RT …
  • Perivascular mesenchymal progenitors in human fetal and adult liver
    Jörg C Gerlach, Patrick Over, Morris E Turner, Robert L Thompson, Hubert G Foka, William C W Chen, Bruno Péault, Bruno Gridelli, Eva Schmelzer
    Stem Cells Dev. (4.8), 2012-12-10, 21, 3258-69
    … Sections incubated with isotype-matched immunoglobulins served as negative controls. Human fetal muscle tissue was used as a positive control (BioChain, Hayward, CA). … Total human fetal liver and muscle RNA (BioChain) served as a relative quantitative normalizer.
  • Enhanced mineralization potential of vascular cells from SM22α-Rankl (tg) mice
    S Morony, A P Sage, T Corbin, J Lu, Y Tintut, L L Demer
    Calcif. Tissue Int. (2.8), 2012-12-08, 91, 379-86
    … Gene Expression Total RNA was isolated from cells using TRIzol reagent (Invitrogen Carlsbad, CA). Real-time RT-qPCR was per- formed using a one-step method (BioChain Institute, Hay- ward, CA) in the Mx3005P (Stratagene, La Jolla, CA). b-Actin was used for normalization. …
  • Different binding property of STIM1 and its novel splice variant STIM1L to Orai1, TRPC3, and TRPC6 channels
    Takahiro Horinouchi, Tsunehito Higashi, Tsunaki Higa, Koji Terada, Yosuke Mai, Hiroyuki Aoyagi, Chizuru Hatate, Prabha Nepal, Mika Horiguchi, Takuya Harada, Soichi Miwa
    Biochem. Biophys. Res. Commun. (2.6), 2012-11-16, 428, 252-8
    … reaction (RT-PCR). Total RNAs prepared from human skeletal muscle, brain, placentae, leukocyte were obtained from Clontech Laboratories. Total RNA from human left ventricle was from BioChain Institute (Newark, CA, USA). …
  • Induction of motor neuron differentiation by transduction of Olig2 protein
    Masayasu Mie, Mami Kaneko, Fumiaki Henmi, Eiry Kobatake
    Biochem. Biophys. Res. Commun. (2.6), 2012-10-26, 427, 531-6
    … The mouse Olig2 gene (GenBank NM_016967) was cloned from Mouse Fetal Normal Tissue 17-day embryo Total RNA (BioChain) by reveres transcription-PCR using primer sets containing restriction enzyme sites and the His-tag sequences …
  • Genome-wide analysis of DNA methylation identifies novel cancer-related genes in hepatocellular carcinoma
    Masahiro Shitani, Shigeru Sasaki, Noriyuki Akutsu, Hideyasu Takagi, Hiromu Suzuki, Masanori Nojima, Hiroyuki Yamamoto, Takashi Tokino, Koichi Hirata, Kohzoh Imai, Minoru Toyota, Yasuhisa Shinomura
    Tumour Biol. (2), 2012-10-11, 33, 1307-17
    … Total RNA was extracted using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) and then treated with a DNA-free kit (Ambion, Austin, TX, USA). Genomic DNA and total RNA from normal liver tissue from a healthy individual were purchased fromBioChain (Hayward, CA, USA). …
  • Adenoviral delivery of the EMX2 gene suppresses growth in human gastric cancer
    Jie Li, Minli Mo, Zhao Chen, Zhe Chen, Qing Sheng, Hang Mu, Fang Zhang, Yi Zhang, Xiu-Yi Zhi, Hui Li, Biao He, Hai-Meng Zhou
    PLoS ONE (4.4), 2012-10-02, 7, e45970
    … Medical University in Beijing. Total RNA and genomic DNA extracted from human adult normal gastric tissues were purchased from BioChain (Hayward, CA, USA). DNA Constructs. Topflash/Fopflash reporters containing wild …
  • Synergistic effects of hypoxia and extracellular matrix cues in cardiomyogenesis
    Renita E Horton, Debra T Auguste
    Biomaterials (7.9), 2012-09-09, 33, 6313-9
    … Additional primer information can be found in supplementary information (Table S1). Total RNA extracted from human fetal heart (BioChain, Hayward, CA) or undifferentiated stem cells were used as a calibrator. Each sample was tested in triplicate for each experiment. 2.7.
  • An in-depth map of polyadenylation sites in cancer
    Yuefeng Lin, Zhihua Li, Fatih Ozsolak, Sang Woo Kim, Gustavo Arango-Argoty, Teresa T Liu, Scott A Tenenbaum, Timothy Bailey, A Paula Monaghan, Patrice M Milos, Bino John
    Nucleic Acids Res. (7.8), 2012-09-01, 40, 8460-71
    … MATERIALS AND METHODS. DRS sequencing and genome mapping. Matched pair (normal/tumor) total RNA from tissues was used for DRS (8,12); all paired RNA samples for sequencing were purchased from BioChain (Hayward, CA), except for Breast (Asterand, MI). …
  • Nuclear exclusion of TET1 is associated with loss of 5-hydroxymethylcytosine in IDH1 wild-type gliomas
    Tim Müller, Marco Gessi, Anke Waha, Lukas Jan Isselstein, Daniel Luxen, Dorothee Freihoff, Johannes Freihoff, Albert Becker, Matthias Simon, Jennifer Hammes, Dorota Denkhaus, Anja zur Mühlen, Torsten Pietsch, Andreas Waha
    Am. J. Pathol. (5.2), 2012-08-23, 181, 675-83
    … of 111 bp. Human brain RNA samples, from corpus callosum and temporal, occipital, frontal, and parietal lobes (BioChainInstitute Inc., Hayward, CA), were used as references. Statistical Analysis. All statistical analyses, including …
  • MicroRNA changes in rat mesentery and serum associated with drug-induced vascular injury
    Roberta A Thomas, Marshall S Scicchitano, Rosanna C Mirabile, Nancy T Chau, Kendall S Frazier, Heath C Thomas
    Toxicol. Appl. Pharmacol. (4), 2012-08-01, 262, 310-20
    … OR). In order to obtain a limited tissue distribution of selected miRNAs, total RNA containing miRNA (obtained from multiple individual tissues in Sprague–Dawley rats) was purchased from BioChain Institute, Inc. (Hayward, CA). …
  • Frequent epigenetic inactivation of the chaperone SGNE1/7B2 in human gliomas
    Anke Waha, Jörg Felsberg, Wolfgang Hartmann, Jennifer Hammes, Anna von dem Knesebeck, Elmar Endl, Torsten Pietsch, Andreas Waha
    Int. J. Cancer (4.9), 2012-08-01, 131, 612-22
    … respectively. Human brain RNA samples, from corpus callosum, temporal, occipital, frontal and parietal lobes (BioChainInstitute, Hayward, CA) were used as references. SGNE1/7B2 cloning and transfection of glioblastoma cells. The …
  • High expression of arachidonate 15-lipoxygenase and proinflammatory markers in human ischemic heart tissue
    Lisa U Magnusson, Annika Lundqvist, Julia Asp, Jane Synnergren, Cecilia Thalén Johansson, Lars Palmqvist, Anders Jeppsson, Lillemor Mattsson Hultén
    Biochem. Biophys. Res. Commun. (2.6), 2012-07-27, 424, 327-30
    … gave written informed consent. For control samples, we purchased total RNA from right atrium from normal tissue from 3 human adults (Invitrogen and BioChain, CA, USA). 2.2. Quantitative PCR (Q-PCR). RNA was isolated from …
  • Role of MXD3 in proliferation of DAOY human medulloblastoma cells
    Gustavo A Barisone, Tin Ngo, Martin Tran, Daniel Cortes, Mehdi H Shahi, Tuong-Vi Nguyen, Daniel Perez-Lanza, Wanna Matayasuwan, Elva Díaz
    PLoS ONE (4.4), 2012-07-18, 7, e38508
    … RNA from tumors and stable cell lines was obtained as described above. Frozen tumor specimens were obtained from the Human Cooperative Tissue Network. Normal human developing and mature cerebellum RNA was purchased from BioChain. …
  • Homologous recombination mediates functional recovery of dysferlin deficiency following AAV5 gene transfer
    William E Grose, K Reed Clark, Danielle Griffin, Vinod Malik, Kimberly M Shontz, Chrystal L Montgomery, Sarah Lewis, Robert H Brown, Paul M L Janssen, Jerry R Mendell, Louise R Rodino-Klapac
    PLoS ONE (4.4), 2012-06-21, 7, e39233
    … TTGAGCTCATCCAGAGAGAGAAGC3′) – Dysf 6243R (5′TCAGCTGAAGGGCTTCA CCAG3′). Human skeletal muscle total RNA (BioChain) and the pAAV.MHCK7.Dysf plasmid (50 ng) were used as positive controls. PCR products were gel …
  • MRGD, a MAS-related G-protein coupled receptor, promotes tumorigenisis and is highly expressed in lung cancer
    Satoko Nishimura, Makiko Uno, Yasuyuki Kaneta, Keisuke Fukuchi, Haruyuki Nishigohri, Jun Hasegawa, Hironobu Komori, Shigeki Takeda, Katsuhiko Enomoto, Futoshi Nara, Toshinori Agatsuma
    PLoS ONE (4.4), 2012-06-20, 7, e38618
    … with the ABC method. Measurement of MRGD gene expression in clinical tissue. Total RNA of tumor or non-tumor clinical tissues from the same donor were purchased from BioChain (Hayward, CA). These RNA pair samples …
  • RANK (TNFRSF11A) is epigenetically inactivated and induces apoptosis in gliomas
    Anna von dem Knesebeck, Jörg Felsberg, Anke Waha, Wolfgang Hartmann, Björn Scheffler, Martin Glas, Jennifer Hammes, Thomas Mikeska, Pearlly S Yan, Elmar Endl, Matthias Simon, Guido Reifenberger, Torsten Pietsch, Andreas Waha
    Neoplasia 0, 2012-06-12, 14, 526-34
    … RNA of normal white matter tissue and commercially available adult humanbrain RNA of corpus callosum, temporal lobe, parietal lobe, frontal lobe, and occipital lobe (BioChain Institute, Inc, Hayward, CA) was used as controls. …
  • RB1 methylation by SMYD2 enhances cell cycle progression through an increase of RB1 phosphorylation
    Hyun-Soo Cho, Shinya Hayami, Gouji Toyokawa, Kazuhiro Maejima, Yuka Yamane, Takehiro Suzuki, Naoshi Dohmae, Masaharu Kogure, Daechun Kang, David E Neal, Bruce A J Ponder, Hiroki Yamaue, Yusuke Nakamura, Ryuji Hamamoto
    Neoplasia 0, 2012-06-12, 14, 476-86
    … RNA samples of normal tissues (brain, breast, colon, esophagus, eye, heart, liver, lung, pancreas, placenta, kidney, rectum, spleen, stomach and testis) were purchased from BioChain (Newark, CA). Cell Lines. … Paraffin-embedded tissue slides were purchased from BioChain. …
  • Brain pericytes ABCA1 expression mediates cholesterol efflux but not cellular amyloid-β peptide accumulation
    Julien Saint-Pol, Elodie Vandenhaute, Marie-Christine Boucau, Pietra Candela, Lucie Dehouck, Roméo Cecchelli, Marie-Pierre Dehouck, Laurence Fenart, Fabien Gosselet
    J. Alzheimers Dis. (4.3), 2012-06-07, 30, 489-503
    … Three wells of pericytes were used for each condi- tion. Extraction of total RNA was performed using the RNeasy total RNA extraction kit (Qiagen) accord- ing to the manufacturer’s protocol. RNA bovine liver extract was obtained from BioChain(Hayward, CA, USA). …
  • A quantitative atlas of polyadenylation in five mammals
    Adnan Derti, Philip Garrett-Engele, Kenzie D Macisaac, Richard C Stevens, Shreedharan Sriram, Ronghua Chen, Carol A Rohl, Jason M Johnson, Tomas Babak
    Genome Res. (13.6), 2012-06-04, 22, 1173-83
    … UHR RNA was purchased from Stratagene Corp. Mouse and dog tissue total RNAs were purchased from BioChain. Total RNA from rat tissues and remaining human tissues were purchased from Zyagen. Rhesus tissue RNAs were provided by Merck & Co., Inc. …
  • Identification of IGPR-1 as a novel adhesion molecule involved in angiogenesis
    Nader Rahimi, Kobra Rezazadeh, John E Mahoney, Edward Hartsough, Rosana D Meyer
    Mol. Biol. Cell (5.9), 2012-05-30, 23, 1646-56
    … The proliferation kit was purchased from Promega (Madison, WI). PNGase F was purchased from New England BioLabs (Ipswich, MA). Total human RNA was purchased from BioChain (Newark, CA). Plasmids, primers, siRNAs, and antibodies. …
  • miR-127-5p targets the 3’UTR of human β-F1-ATPase mRNA and inhibits its translation
    Imke M Willers, Inmaculada Martínez-Reyes, Marta Martínez-Diez, José M Cuezva
    Biochim. Biophys. Acta 0, 2012-05-09, 1817, 838-48
    … Human fetal (20–44 weeks, #636540 from Clontech and A601605 and A604419 from BioChain) and adult (51–64 year-old men, #636531 from Clontech and B510061 and B510092 from BioChain) total liver RNA were purchased. …
  • Functional impairment of human resident cardiac stem cells by the cardiotoxic antineoplastic agent trastuzumab
    Andreas S Barth, Yiqiang Zhang, Taosheng Li, Rachel R Smith, Isotta Chimenti, Ioannis Terrovitis, Darryl R Davis, Eddy Kizana, Alice S Ho, Brian O’Rourke, Antonio C Wolff, Gary Gerstenblith, Eduardo Marbán
    Stem Cells Transl Med 0, 2012-04-30, 1, 289-97
    … previously described [13]. Human control RNA was purchased from BioChain (BioChain Institute, Inc., Hayward, CA, http://www.BioChain.com). Myocardial Infarction, Cell Injection, and Echocardiography. Myocardial infarction was …
  • Exploiting the glioblastoma peptidome to discover novel tumour-associated antigens for immunotherapy
    Valérie Dutoit, Christel Herold-Mende, Norbert Hilf, Oliver Schoor, Philipp Beckhove, Judith Bucher, Katharina Dorsch, Sylvia Flohr, Jens Fritsche, Peter Lewandrowski, Jennifer Lohr, Hans-Georg Rammensee, Stefan Stevanovic, Claudia Trautwein, Verona Vass, Steffen Walter, Paul R Walker, Toni Weinschenk, Harpreet Singh-Jasuja, Pierre-Yves Dietrich
    Brain (9.2), 2012-04-16, 135, 1042-54
    … manufacturer’s protocol. Total RNA from healthy human tissues (‘bulk’ RNA isolations = mixture of all cell types contained in the respective tissue) was obtained commercially (Ambion, Clontech, Stratagene and BioChain). Peripheral …
  • Muscleblind-like 1 knockout mice reveal novel splicing defects in the myotonic dystrophy brain
    Koichi Suenaga, Kuang-Yung Lee, Masayuki Nakamori, Yoshiki Tatsumi, Masanori P Takahashi, Harutoshi Fujimura, Kenji Jinnai, Hiroo Yoshikawa, Hongqing Du, Manuel Ares, Maurice S Swanson, Takashi Kimura
    PLoS ONE (4.4), 2012-03-19, 7, e33218
    … The RNAs used as normal controls were purchased commercially as follows: human adult temporal cortex (3 male, 1female, 3 samples from BioChain, 1 sample from Ambion) and 1 sample of human fetal whole brain (Stratagene) (Table 1). The quality of RNA and the PCR …
  • A genome-wide association study of nephrolithiasis in the Japanese population identifies novel susceptible Loci at 5q35.3, 7p14.3, and 13q14.1
    Yuji Urabe, Chizu Tanikawa, Atsushi Takahashi, Yukinori Okada, Takashi Morizono, Tatsuhiko Tsunoda, Naoyuki Kamatani, Kenjiro Kohri, Kazuaki Chayama, Michiaki Kubo, Yusuke Nakamura, Koichi Matsuda
    PLoS Genet. (9.5), 2012-03-07, 8, e1002541
    … covariates. Quantitative real-time PCR. mRNA or total RNA from normal tissues were purchased from Calbiochem andBioChain. cDNAs were synthesized with the SuperScript Preamplification System (Invitrogen). Quantitative …
  • Downregulation of KIF23 suppresses glioma proliferation
    Satoshi Takahashi, Noemi Fusaki, Shigeki Ohta, Yoshihiro Iwahori, Yukihiko Iizuka, Kohei Inagawa, Yutaka Kawakami, Kazunari Yoshida, Masahiro Toda
    J. Neurooncol. (2.9), 2012-02-18, 106, 519-29
    … of Keio University (no. 12-21-2). Human adult brain tissue samples were obtained from BioChain (Hayward, CA). Normal human RNA samples were obtained from BioChain and Clontech (Palo Alto, CA). The human GBM cell …
  • Deletion or epigenetic silencing of AJAP1 on 1p36 in glioblastoma
    Ningjing Lin, Chunhui Di, Kathy Bortoff, Jinrong Fu, Peter Truszkowski, Patrick Killela, Chris Duncan, Roger McLendon, Darell Bigner, Simon Gregory, David Cory Adamson
    Mol. Cancer Res. (4.4), 2012-02-16, 10, 208-17
    … Biosystems). The transcript level of AJAP1 gene was normalized to that of GAPDH. As a reference, we used adult human brain RNA (BioChain Institute). Bisulfite treatment of DNA and methylation-specific quantitative PCR. Genomic …
  • Expression profile of frizzled receptors in human medulloblastomas
    Ettore Salsano, Rosina Paterra, Miriam Figus, Francesca Menghi, Emanuela Maderna, Bianca Pollo, Carlo Lazzaro Solero, Luca Massimi, Gaetano Finocchiaro
    J. Neurooncol. (2.9), 2012-01-06, 106, 271-80
    … RNA from human normal fetal cerebellum was purchased from BioChain Institute (http://www.BioChain.com, #R1244040-50), while RNA from human normal adult cerebellum pooled from ten male/female Caucasians was purchased from Clontech (http://www.clontech. …
  • Prostate stem cell antigen, a presumable organ-dependent tumor suppressor gene, is down-regulated in gallbladder carcinogenesis
    Hiroe Ono, Nobuyoshi Hiraoka, Yeon-Su Lee, Sang Myung Woo, Woo Jin Lee, Il Ju Choi, Akira Saito, Kazuyoshi Yanagihara, Yae Kanai, Sumiko Ohnami, Fumiko Chiwaki, Hiroki Sasaki, Hiromi Sakamoto, Teruhiko Yoshida, Norihisa Saeki
    Genes Chromosomes Cancer (4), 2012-01-04, 51, 30-41
    … Total RNAs of human normal organs were purchased from BioChain (Esophagus; 1234106-50, Stomach; R1234248-50, Gallbladder; R1234118-10, Pancreas; R1234188-50, Small Intestine; R1234227-50, Colon; R1234090-50 and Urinary Bladder; R1234010-50, Hayward …
  • Comparison of the function and expression of CYP26A1 and CYP26B1, the two retinoic acid hydroxylases
    Ariel R Topletz, Jayne E Thatcher, Alex Zelter, Justin D Lutz, Suzanne Tay, Wendel L Nelson, Nina Isoherranen
    Biochem. Pharmacol. (4.9), 2012-01-01, 83, 149-63
    … Single donor tissue total RNA was obtained from BioChain (Hayward, CA). Skin total RNA was a gift from Dr. Ed Kelly (University of Washington, Seattle, WA) and was also obtained from BioChain but was a pooled sample of 5 donors. …
  • Pieter Mestdagh, Steve Lefever, Filip Pattyn, Dana Ridzon, Erik Fredlund, Annelies Fieuw, Maté Ongenaert, Joëlle Vermeulen, Anne De Paepe, Linda Wong, Frank Speleman, Caifu Chen, and Jo Vandesompele
    The microRNA body map: dissecting microRNA function through integrative genomics
    Nucleic Acids Res., Nov 2011; 39: e136.
    … …MATERIALS AND METHODS miRNA and mRNA expression data RNA samples from 39 normal human tissues were obtained from Ambion and Biochain. Reverse transcription for 704 miRNAs, 18 small RNA controls and U6 was performed using stem-loop primers (Applied Biosystems… …
  • Haya H. Al-Balool, David Weber, Yilei Liu, Mark Wade, Kamlesh Guleria, Pitsien Lang Ping Nam, Jake Clayton, William Rowe, Jonathan Coxhead, Julie Irving, David J. Elliott, Andrew G. Hall, Mauro Santibanez-Koref, and Michael S. Jackson
    Post-transcriptional exon shuffling events in humans can be evolutionarily conserved and abundant
    Genome Res., Nov 2011; 21: 1788 – 1799.
    … …Wellcome Trust Human Developmental Biology tissue bank ( http://www.hdbr.org/ ). RNAs from adult tissues were obtained from BioChain Institute Inc. All cDNA and DNA samples for RT-PCR validation experiments were generated using the random priming TransPlex…
  • Ann DeLaForest, Masato Nagaoka, Karim Si-Tayeb, Fallon K. Noto, Genevieve Konopka, Michele A. Battle, and Stephen A. Duncan
    HNF4A is essential for specification of hepatic progenitors from human pluripotent stem cells
    Development, Oct 2011; 138: 4143 – 4153.
    … …adult cadaveric livers using the RNeasy mini kit (QIAgen, Valencia, CA), and human fetal RNA was purchased from BioChain (BioChain, Hayward, CA). Real-time quantitative polymerase chain reaction (RT-PCR) was performed on an Applied Biosystems… …
  • Judith C. Sporn, Torsten Hothorn, and Barbara Jung
    BARD1 Expression Predicts Outcome in Colon Cancer
    Clin. Cancer Res., Aug 2011; 17: 5451 – 5462.
    … …Reverse transcription and PCR RNA from 15 human colorectal cancer samples and 15 matched normal colon samples was acquired from Biochain. RNA quality was assessed with the Agilent Bio-Chip (RIN 6.5). One microgram of RNA of each sample was reverse-transcribed… …
  • Theodore L. Tollner, Scott A. Venners, Edward J. Hollox, Ashley I. Yudin, Xue Liu, Genfu Tang, Houxun Xing, Robert J. Kays, Tsang Lau, James W. Overstreet, Xiping Xu, Charles L. Bevins, and Gary N. Cherr
    A Common Mutation in the Defensin DEFB126 Causes Impaired Sperm Function and Subfertility
    Science Translational Medicine, Jul 2011; 3: 92ra65.
    … …transcription-polymerase chain reaction analysis Total RNA from epididymal tissue (lots A703139 and A703144) was obtained from Biochain Institute Inc. For cDNA synthesis, 5 mug of total RNA was reverse-transcribed with SuperScript II reverse transcriptase (50… …
  • Aiping Zhang, David A. Skaar, Yue Li, Dale Huang, Thomas M. Price, Susan K. Murphy, and Randy L. Jirtle
    Novel retrotransposed imprinted locus identified at human 6p25
    Nucleic Acids Res., Jul 2011; 39: 5388 – 5400.
    … …tumors. Normal adult human tissues were provided by NDRI and BioChain Institute (Hayward, CA, USA). All human tissue specimens were…Friendswood, TX, USA). Adult human total RNA was provided byBioChain Institute. 5- and 3-rapid amplifications of cDNA ends…
  • Olivier Le Bacquer, Luan Shu, Marion Marchand, Bernadette Neve, Federico Paroni, Julie Kerr Conte, Francois Pattou, Philippe Froguel, and Kathrin Maedler
    TCF7L2 splice variants have distinct effects on β-cell turnover and function
    Hum. Mol. Genet., May 2011; 20: 1906 – 1915.
    … …Biosciences Clontech) and RNAs that were reverse transcribed from the pancreas and adipose tissue (Human Adult Normal 5 Donor Pool, BioChain Institute). TCF7L2 exon-specific primers were used in the PCR (see Supplementary Material ). RNA interference and plasmid… …
  • Shaomin Peng, Veena S. Rao, Ron A. Adelman, and Lawrence J. Rizzolo
    Claudin-19 and the Barrier Properties of the Human Retinal Pigment Epithelium
    Invest. Ophthalmol. Vis. Sci., Mar 2011; 52: 1392 – 1403.
    … …using 35 cycles of PCR and the primers listed in Table 1. For a positive control human kidney total RNA was obtained from the Biochain Institute (Hayward, CA). Claudins detected by this technique were further examined by quantitative, real-time RT-PCR as follows… …
    Ref. link 
  • Mike Althaus, Alexandra Pichl, Wolfgang G. Clauss, Werner Seeger, Martin Fronius, and Rory E. Morty
    Nitric Oxide Inhibits Highly Selective Sodium Channels and the Na+/K+-ATPase in H441 Cells
    Am. J. Respir. Cell Mol. Biol., Jan 2011; 44: 53 – 65.
    … …using a RNeasy kit (Qiagen, Hilden, Germany), followed by DNase treatment to remove contaminating genomic DNA. Human total RNA (BioChain Institute, Hayward, CA) served as a positive control. One microgram of RNA was reverse-transcribed using the MuLV Reverse Transcription… …
  • Hiromu Suzuki, Eiichiro Yamamoto, Masanori Nojima, Masahiro Kai, Hiro-o Yamano, Kenjiro Yoshikawa, Tomoaki Kimura, Toyoki Kudo, Eiji Harada, Tamotsu Sugai, Hiroyuki Takamaru, Takeshi Niinuma, Reo Maruyama, Hiroyuki Yamamoto, Takashi Tokino, Kohzoh Imai, Minoru Toyota, and Yasuhisa Shinomura
    Methylation-associated silencing of microRNA-34b/c in gastric cancer and its involvement in an epigenetic field defect
    Carcinogenesis, Dec 2010; 31: 2066 – 2073.
    … …kit (Ambion, Austin, TX). Genomic DNA and total RNA from normal gastric mucosa from a healthy individual were purchased from BioChain (Hayward, CA). miRNA microarray analysis miRNA expression was analyzed using a color microarray according to the manufacturers… …
  • Ulrike Riehle, Andreas Mader, Thomas Brandstetter, Jürgen Rühe, Axel zur Hausen, and Elmar Stickeler
    Nucleic acid sequence-based amplification in formalin-fixed and paraffin-embedded breast-cancer tissues
    J. Clin. Pathol., Dec 2010; 63: 1071 – 1076.
    … …Roche Applied Science, Mannheim, Germany). For reference experiments, universal human RNA (total RNA) was purchased from the BioChain Institute (Hayward, California). RNA quantity and intactness were assessed by the Agilent Bioanalyzer 2100 and the RIN (RNA… …
  • Natalia Teider, Deborah K. Scott, Adrianne Neiss, S. Dilhan Weeraratne, Vladimir M. Amani, Yifei Wang, Victor E. Marquez, Yoon-Jae Cho, and Scott L. Pomeroy
    Neuralized1 causes apoptosis and downregulates Notch target genes in medulloblastoma
    Neuro Oncology, Dec 2010; 12: 1244 – 1256.
    … …obtained from BD Biosciences, Ambion, Biochain, Clontech, and Stratagene; normal…33-week fetal cerebellum RNA was from Biochain. Matched samples of normal cerebellar RNA and genomic DNA were fromBiochain. Cell Culture MB cell lines UW228… …
  • David M. Kristensen, John E. Nielsen, Mark Kalisz, Marlene D. Dalgaard, Karine Audouze, Malene E. Larsen, Grete K. Jacobsen, Thomas Horn, Søren Brunak, Niels E. Skakkebaek, and Henrik Leffers
    OCT4 and downstream factors are expressed in human somatic urogenital epithelia and in culture of epididymal spheres
    Mol. Hum. Reprod., Nov 2010; 16: 835 – 845.
    … …purchased: human testes total RNA (Ambion, Austin, TX, USA), human total Ductus Deferens (BioChain, Hayward, CA, USA), human total Epididymis (BioChain), human prostate total RNA (Ambion, Austin) and human ovary total RNA (Ambion, Austin). One… …
  • Qiuming Gong, Matthew R. Stump, A. Russell Dunn, Vivianne Deng, and Zhengfeng Zhou
    Alternative Splicing and Polyadenylation Contribute to the Generation of hERG1 C-terminal Isoforms
    J. Biol. Chem., Oct 2010; 285: 32233 – 32241.
    … …hERG1 Transcripts in Human Tissues by Real Time PCR The human tissue total RNAs were purchased from Ambion (Austin, TX) and Biochain (Hayward, CA). cDNAs were synthesized with the SuperScript III First Strand Synthesis System for RT-PCR with random hexamers… …
  • Nabila Bouatia-Naji, Amélie Bonnefond, Devin A. Baerenwald, Marion Marchand, Marco Bugliani, Piero Marchetti, François Pattou, Richard L. Printz, Brian P. Flemming, Obi C. Umunakwe, Nicholas L. Conley, Martine Vaxillaire, Olivier Lantieri, Beverley Balkau, Michel Marre, Claire Lévy-Marchal, Paul Elliott, Marjo-Riitta Jarvelin, David Meyre, Christian Dina, James K. Oeser, Philippe Froguel, and Richard M. O’Brien
    Genetic and Functional Assessment of the Role of the rs13431652-A and rs573225-A Alleles in the G6PC2Promoter That Are Strongly Associated With Elevated Fasting Glucose Levels
    Diabetes, Oct 2010; 59: 2662 – 2671.
    … …and RNAs that were reverse-transcribed from the brain, small intestine, and adipose tissue (Human Adult Normal 5 Donor Pool, BioChain Institute). Pancreatic islets and sorted beta-cells were obtained from human adult brain-dead donors in accordance with French… …
  • Ulrike Riehle, Andreas Mader, Thomas Brandstetter, Jürgen Rühe, Axel zur Hausen, and Elmar Stickeler
    Nucleic acid sequence-based amplification in formalin-fixed and paraffin-embedded breast-cancer tissues
    J. Clin. Pathol., Oct 2010; 10.1136/jcp.2010.078766.
    … …Roche Applied Science, Mannheim, Germany). For reference experiments, universal human RNA (total RNA) was purchased from the BioChain Institute (Hayward, California). RNA quantity and intactness were assessed by the Agilent Bioanalyzer 2100 and the RIN (RNA… …
  • Lan Lin, Shihao Shen, Peng Jiang, Seiko Sato, Beverly L. Davidson, and Yi Xing
    Evolution of alternative splicing in primate brain transcriptomes
    Hum. Mol. Genet., Aug 2010; 19: 2958 – 2973.
    … …donors, respectively. Two single-donor human cerebellum total RNA samples were purchased from Ambion (Austin, TX, USA) and BioChain (Hayward, CA, USA). For a detailed description of RNA samples, see Supplementary Material, Table S1 . We used the HJAY array… …
  • Indu Kohaar, Alexander Ploss, Evgenia Korol, Kathy Mu, John W. Schoggins, Thomas R. O’Brien, Charles M. Rice, and Ludmila Prokunina-Olsson
    Splicing Diversity of the Human OCLN Gene and Its Biological Significance for Hepatitis C Virus Entry
    J. Virol., Jul 2010; 84: 6987 – 6994.
    … …Subjects Research (OHSR) of the NIH (exempt 4539). Samples of total RNA from human tissues were purchased from Clontech and BioChain. Samples of total RNA from the NCI-60 panel of human cell lines from nine main types of cancers were provided by the Molecular… …
  • Courtney C. Babbitt, Olivier Fedrigo, Adam D. Pfefferle, Alan P. Boyle, Julie E. Horvath, Terrence S. Furey, and Gregory A. Wray
    Both Noncoding and Protein-Coding RNAs Contribute to Gene Expression Evolution in the Primate Brain
    Genome Biol Evol, Jun 2010; 2: 67 – 79.
    … …opportunistic sampling; thus, no primates were sacrificed for the purposes of this research. Human samples were obtained from BioChain. The nonhuman primate samples are from the Southwest Foundation for Biomedical Research and the New England Primate Center… …
  • Lan Lin, Shihao Shen, Peng Jiang, Seiko Sato, Beverly L. Davidson, and Yi Xing
    Evolution of alternative splicing in primate brain transcriptomes
    Hum. Mol. Genet., May 2010; 10.1093/hmg/ddq201.
    … …donors, respectively. Two single-donor human cerebellum total RNA samples were purchased from Ambion (Austin, TX, USA) and BioChain (Hayward, CA, USA). For a detailed description of RNA samples, see Supplementary Material, Table S1 . We used the HJAY array… …
  • Pierre de la Grange, Lise Gratadou, Marc Delord, Martin Dutertre, and Didier Auboeuf
    Splicing factor and exon profiling across human tissues
    Nucleic Acids Res., May 2010; 38: 2825 – 2838.
    … …Validation by RT-PCR One microgram of total RNAs from human breast, cerebellum, heart, liver, muscle, spleen or testis (BioChain) was reverse-transcribed using random primers and the Superscript II reverse transcriptase (Invitrogen). cDNAs were diluted… …
  • Ashis K. Mondal, Swapan K. Das, Giulia Baldini, Winston S. Chu, Neeraj K. Sharma, Oksana G. Hackney, Jianhua Zhao, Struan F. A. Grant, and Steven C. Elbein
    Genotype and Tissue-Specific Effects on Alternative Splicing of the Transcription Factor 7-Like 2 Gene in Humans
    J. Clin. Endocrinol. Metab., Mar 2010; 95: 1450 – 1457.
    … …human pancreas (catalog no. R1234188-50, lot A603358) and liver (catalog no. R1234149-50, lot A607171) RNA was obtained from BioChain Institute, Inc. (Hayward, CA). 5 and 3 rapid amplification of cDNA ends (RACE) Both 5 and 3 alternative start sites were… …
  • Hiromu Suzuki, Shinichi Igarashi, Masanori Nojima, Reo Maruyama, Eiichiro Yamamoto, Masahiro Kai, Hirofumi Akashi, Yoshiyuki Watanabe, Hiroyuki Yamamoto, Yasushi Sasaki, Fumio Itoh, Kohzoh Imai, Tamotsu Sugai, Lanlan Shen, Jean-Pierre J. Issa, Yasuhisa Shinomura, Takashi Tokino, and Minoru Toyota
    IGFBP7 is a p53-responsive gene specifically silenced in colorectal cancer with CpG island methylator phenotype
    Carcinogenesis, Mar 2010; 31: 342 – 349.
    … …kit (Ambion, Austin, TX). Genomic DNA and total RNA from normal colon tissue from a healthy individual were purchased from BioChain (Hayward, CA). Drug treatment To analyze restoration of IGFBP7 gene expression, CRC cells were treated with 2 muM 5-aza-2-deoxycytidine… …
  • Courtney C. Babbitt, Olivier Fedrigo, Adam D. Pfefferle, Alan P. Boyle, Julie E. Horvath, Terrence S. Furey, and Gregory A. Wray
    Both Noncoding and Protein-Coding RNAs Contribute to Gene Expression Evolution in the Primate Brain
    Genome Biol Evol, Mar 2010; 2010: 67 – 79.
    … …opportunistic sampling; thus, no primates were sacrificed for the purposes of this research. Human samples were obtained from BioChain. The nonhuman primate samples are from the Southwest Foundation for Biomedical Research and the New England Primate Center… …
  • Michael Grzendowski, Marietta Wolter, Markus J. Riemenschneider, Christiane B. Knobbe, Uwe Schlegel, Helmut E. Meyer, Guido Reifenberger, and Kai Stühler
    Differential proteome analysis of human gliomas stratified for loss of heterozygosity on chromosomal arms 1p and 19q
    Neuro Oncology, Mar 2010; 12: 243 – 256.
    … …elsewhere. 26 As reference tissues, we used commercially available fetal and adult human brain RNA (BD Biosciences, St. Jose; BioChain, Hayward; Stratagene, Amsterdam, The Netherlands). Universal Human Reference RNA (Stratagene) was used as a calibrator to compare… …
  • Mike Althaus, Alexandra Pichl, Wolfgang G Clauss, Werner Seeger, Martin Fronius, and Rory E Morty
    Nitric Oxide Inhibits Highly Selective Sodium Channels and the Na+/K+-ATPase in H441 Cells
    Am. J. Respir. Cell Mol. Biol., Feb 2010; 10.1165/2009-0335OC.
    … …RNeasy kit (Qiagen, Hilden, Germany), followed by DNase treatment to remove any contaminating genomic DNA. Human total RNA (BioChain Institute) served as a positive control. One microgram of RNA was reverse-transcribed using the MuLV Reverse Transcription…
  • Courtney C. Babbitt, Olivier Fedrigo, Adam D. Pfefferle, Alan P. Boyle, Julie E. Horvath, Terrence S. Furey, and Gregory A. Wray
    Both Noncoding and Protein-Coding RNAs Contribute to Gene Expression Evolution in the Primate Brain
    Gen Biol Evol, Feb 2010; 2010: 67 – 79.
    … …opportunistic sampling; thus, no primates were sacrificed for the purposes of this research. Human samples were obtained from BioChain. The nonhuman primate samples are from the Southwest Foundation for Biomedical Research and the New England Primate Center… …
  • Anke Waha, Jörg Felsberg, Wolfgang Hartmann, Anna von dem Knesebeck, Thomas Mikeska, Stefan Joos, Marietta Wolter, Arend Koch, Pearlly S. Yan, Elmar Endl, Otmar D. Wiestler, Guido Reifenberger, Torsten Pietsch, and Andreas Waha
    Epigenetic Downregulation of Mitogen-Activated Protein Kinase Phosphatase MKP-2 Relieves Its Growth Suppressive Activity in Glioma Cells
    Cancer Res., Feb 2010; 70: 1689 – 1699.
    … …resulting in a 111-bp fragment. Human brain RNA samples from corpus callosum, temporal, occipital, frontal, and parietal lobe (BioChain Institute, Inc.) as well as two additional human brain RNA samples (Stratagene; BD Biosciences) were used as references. A… …
  • Aurélie Ernst, Stefanie Hofmann, Rezvan Ahmadi, Natalia Becker, Andrey Korshunov, Felix Engel, Christian Hartmann, Jörg Felsberg, Michael Sabel, Heike Peterziel, Moritz Durchdewald, Jochen Hess, Sebastian Barbus, Benito Campos, Anna Starzinski-Powitz, Andreas Unterberg, Guido Reifenberger, Peter Lichter, Christel Herold-Mende, and Bernhard Radlwimmer
    Genomic and Expression Profiling of Glioblastoma Stem Cell–Like Spheroid Cultures Identifies Novel Tumor-Relevant Genes Associated with Survival
    Clin. Cancer Res., Nov 2009; 15: 6541 – 6550.
    … …candidate genes in tumors, a reference of total RNA obtained from nonneoplastic human brain tissue samples of five individuals (BioChain) was used. Total RNA was treated with DNaseI (Invitrogen) and reverse-transcribed with SuperscriptII (Invitrogen). Each cDNA… …
  • Dilini Ranatunga, Christian M. Hedrich, Fengying Wang, Daniel W. McVicar, Nathan Nowak, Trupti Joshi, Lionel Feigenbaum, Lindsay R. Grant, Simona Stäger, and Jay H. Bream
    A human IL10 BAC transgene reveals tissue-specific control of IL-10 expression and alters disease outcome
    PNAS, Oct 2009; 106: 17123 – 17128.
    … …a first strand cDNA synthesis kit (Invitrogen). Total human RNA isolated from tissues of healthy donors was purchased from BioChain Institute, Inc. Quantitative PCR was performed using Taqman site-specific primers and probes (Applied Biosystems) on an ABI… …
  • Dimitrios Iliopoulos, Christos Polytarchou, Maria Hatziapostolou, Filippos Kottakis, Ioanna G. Maroulakou, Kevin Struhl, and Philip N. Tsichlis
    MicroRNAs Differentially Regulated by Akt Isoforms Control EMT and Stem Cell Renewal in Cancer Cells
    Sci. Signal., Oct 2009; 2: ra62.
    … …Human breast cancer samples RNAs from eight primary tumors and their corresponding metastatic tumors were purchased from Biochain Inc. These samples were used for real-time RT-PCR for E-cadherin, miR-200a, miR-200b, Akt1, and Akt2. Glyceraldehyde-3-phosphate… …
  • Sivan Osenberg, Dan Dominissini, Gideon Rechavi, and Eli Eisenberg
    Widespread cleavage of A-to-I hyperediting substrates
    RNA, Sep 2009; 15: 1632 – 1639.
    … …Experimental materials and methods Human adult hippocampus total RNA and genomic DNA from the same subject were purchased from Biochain. For RT-PCR, each RNA sample was treated with DNase I (Invitrogen) and reverse transcribed using M-MLV RT and random hexamers… …
  • Jin Billy Li, Erez Y. Levanon, Jung-Ki Yoon, John Aach, Bin Xie, Emily LeProust, Kun Zhang, Yuan Gao, and George M. Church
    Genome-Wide Identification of Human RNA Editing Sites by Parallel DNA Capturing and Sequencing
    Science, May 2009; 324: 1210 – 1213.
    … …References 30 We thank R. Emeson, M. P. Ball, and F. Isaacs for critical reading of the manuscript; P. Wang and Z. Liu (BioChain Institute) for helping collect human samples; M. Higuchi and P. Seeburg for providing ADAR2 / mouse brain cDNA; Harvard Biopolymers… …
  • Willemijn M. Gommans, Nicholas E. Tatalias, Christina P. Sie, Dylan Dupuis, Nicholas Vendetti, Lauren Smith, Rikhi Kaushal, and Stefan Maas
    Screening of human SNP database identifies recoding sites of A-to-I RNA editing
    RNA, Oct 2008; 14: 2074 – 2085.
    … …RNA editing analysis For experimental validation, human brain total RNA and gDNA isolated from the same specimen (Biochain) were used and processed using standard protocols for reverse transcription and PCR (see Supplemental Table S1 for primer sequences… …
  • Barbara Rosati, Min Dong, Lan Cheng, Shian-Ren Liou, Qinghong Yan, Ji Young Park, Elaine Shiang, Michael Sanguinetti, Hong-Sheng Wang, and David McKinnon
    Evolution of Ventricular Myocyte Electrophysiology
    Physiol Genomics, Sep 2008; 10.1152/physiolgenomics.00159.2007.
    … …was prepared using Qiagen RNeasy columns. Human RNA samples were obtained from independent commercial suppliers (Ambion or BioChain). Complementary DNAs were prepared as previously described (32). Three independent primer pairs for each gene were used for… …
  • Yoganand Balagurunathan, David L. Morse, Galen Hostetter, Vijayalakshmi Shanmugam, Phillip Stafford, Sonsoles Shack, John Pearson, Maria Trissal, Michael J. Demeure, Daniel D. Von Hoff, Victor J. Hruby, Robert J. Gillies, and Haiyong Han
    Gene expression profiling-based identification of cell-surface targets for developing multimeric ligands in pancreatic cancer
    Mol. Cancer Ther., Sep 2008; 7: 3071 – 3080.
    … …the Molecular Profiling Institute. RNA samples for normal tissues representing 28 different organ sites were purchased from Biochain and Stratagene. Paraffin-embedded pancreatic tissues were obtained from the Biospecimen Repository Core of the Pancreatic Cancer…
  • Thomas Landemaine, Amanda Jackson, Akeila Bellahc¨¨ne, Nadia Rucci, Soraya Sin, Berta Martin Abad, Angels Sierra, Alain Boudinet, Jean-Marc Guinebreti¨¨re, Enrico Ricevuto, Catherine Nogu¨¨s, Marianne Briffod, Ivan Bi¨¨che, Pascal Cherel, Teresa Garcia, Vincent Castronovo, Anna Teti, Rosette Lidereau, and Keltouma Driouch
    A Six-Gene Signature Predicting Breast Cancer Lung Metastasis
    Cancer Res., Aug 2008; 68: 6092 – 6099.
    … …IDIBELL), respectively. RNA pools from normal lung and normal liver (at least five samples in each cases) were purchased from Biochain and Invitrogen. A series of 72 primary breast tumors (CRH cohort) was specifically selected from patients with node-negative…
  • Masayo Aoki, Tomohiro Terada, Moto Kajiwara, Ken Ogasawara, Iwao Ikai, Osamu Ogawa, Toshiya Katsura, and Ken-ichi Inui
    Kidney-specific expression of human organic cation transporter 2 (OCT2/SLC22A2) is regulated by DNA methylation
    Am J Physiol Renal Physiol, Jul 2008; 295: F165 – F170.
    … …consent. Quantification of OCT1, OCT2, and USF1 mRNA expression. Total RNA from various human tissues was purchased from BioChain (Hayward, CA). Reverse transcription of the total RNA (500 ng/20 ul reaction) and real-time PCR were carried out as described… …
  • Elizabeth Y. Rula, Andre H. Lagrange, Michelle M. Jacobs, NingNing Hu, Robert L. Macdonald, and Ronald B. Emeson
    Developmental Modulation of GABAA Receptor Function by RNA Editing
    J. Neurosci., Jun 2008; 28: 6196 – 6201.
    … …RNA (Sprague Dawley) was isolated as previously described (Burns et al., 1997), and human whole-brain RNA was purchased from BioChain Institute. As described in supplemental Methods (available at www.jneurosci.org as supplemental material ), first-strand… …
  • Amara C. Siva, Martha A. Wild, Richard E. Kirkland, Mary Jean Nolan, Bing Lin, Toshiaki Maruyama, Ferda Yantiri-Wernimont, Shana Frederickson, Katherine S. Bowdish, and Hong Xin
    Targeting CUB Domain-Containing Protein 1 with a Monoclonal Antibody Inhibits Metastasis in a Prostate Cancer Model
    Cancer Res., May 2008; 68: 3759 – 3766.
    … …pyrimidine] was purchased from Calbiochem. RNA samples. Total RNA for the normal tissue panel was purchased from BD Biosciences and BioChain Institute, Inc. Total RNA from frozen sections of prostate cell lines and severe combined immunodeficient (SCID) xenografts… …
  • Christopher Wright, Donald Bergstrom, Hongyue Dai, Matthew Marton, Mark Morris, George Tokiwa, Yanqun Wang, and Thomas Fare
    Characterization of Globin RNA Interference in Gene Expression Profiling of Whole-Blood Samples
    Clin. Chem., Feb 2008; 54: 396 – 405.
    … …the abundance of the b-globin message. supplementation with human brain total rna We obtained human brain total RNA from BioChain (catalog no. R1234035-50, lot no. A703158) and added it to aliquots of peripheral blood total RNA at the following concentrations… …
  • Germán Gastón Leparc and Robi David Mitra
    A sensitive procedure to detect alternatively spliced mRNA in pooled-tissue samples
    Nucleic Acids Res., Dec 2007; 35: e146.
    … …11-day, 15-day and 17-day mouse embryo, were obtained from Biochain (Cat No. R4334566, R1334XI-10, R1334XV-10 and R1334XVII-10…pancreas, uterus and prostate total RNA samples were obtained from BioChain (Cat No. R1234218-50, R1234086-50, R1234086-50, R1234188-50… …
  • Hironobu Sato, Hiromu Suzuki, Minoru Toyota, Masanori Nojima, Reo Maruyama, Shigeru Sasaki, Hideyasu Takagi, Yohei Sogabe, Yasushi Sasaki, Masashi Idogawa, Tomoko Sonoda, Mitsuru Mori, Kohzoh Imai, Takashi Tokino, and Yasuhisa Shinomura
    Frequent epigenetic inactivation of DICKKOPF family genes in human gastrointestinal tumors
    Carcinogenesis, Dec 2007; 28: 2459 – 2466.
    … …treated with a DNA-free kit (Ambion, Austin, TX). Total RNA from normal colon mucosa from a healthy individual was purchased from BioChain (Hayward, CA). Reverse transcriptase-polymerase chain reaction Single-stranded cDNA was prepared using SuperScript III… …
  • Nurit Paz, Erez Y. Levanon, Ninette Amariglio, Amy B. Heimberger, Zvi Ram, Shlomi Constantini, Zohar S. Barbash, Konstantin Adamsky, Michal Safran, Avi Hirschberg, Meir Krupsky, Issachar Ben-Dov, Simona Cazacu, Tom Mikkelsen, Chaya Brodie, Eli Eisenberg, and Gideon Rechavi
    Altered adenosine-to-inosine RNA editing in human cancer
    Genome Res., Nov 2007; 17: 1586 – 1595.
    … …Center, Tel Aviv Sourasky Medical Center, or Henry Ford Hospital (Detroit, MI), or were purchased (Stratagene, Clontech, and Biochain). Malignant and normal samples from oral cavity (six subjects) or lung (five subjects) were collected at the Chaim Sheba Medical… …
  • Osamu Seguchi, Seiji Takashima, Satoru Yamazaki, Masanori Asakura, Yoshihiro Asano, Yasunori Shintani, Masakatsu Wakeno, Tetsuo Minamino, Hiroya Kondo, Hidehiko Furukawa, Kenji Nakamaru, Asuka Naito, Tomoko Takahashi, Toshiaki Ohtsuka, Koichi Kawakami, Tadashi Isomura, Soichiro Kitamura, Hitonobu Tomoike, Naoki Mochizuki, and Masafumi Kitakaze
    A cardiac myosin light chain kinase regulates sarcomere assembly in the vertebrate heart
    J. Clin. Invest., Oct 2007; 117: 2812 – 2824.
    … …and ejection fraction (EF) was measured by echocardiography the day before the operation. Normal samples were purchased from Biochain Inc. Cardiac gene expression was determined using the HG-U95 Affymetrix GeneChip. All expression data were normalized by global… …
  • Noa Matarasso, Anat Bar-Shira, Uri Rozovski, Serena Rosner, and Avi Orr-Urtreger
    Functional Analysis of the Aurora Kinase A Ile31 Allelic Variant in Human Prostate
    Neoplasia. 2007 September; 9(9): 707?15.
    … …Twenty-eight RNA samples from donor prostate tissues classified as normal prostate were purchased: 27 samples from donors of Asian descent (BioChain Institute, Inc., Hayward, CA) and 1 sample from a donor of Caucasian descent (Ambion, Inc., Austin, TX)…. …
  • Damian G Romero, Ming Yi Zhou, Licy L Yanes, Maria W Plonczynski, Tanganika R Washington, Celso E Gomez-Sanchez, and Elise P Gomez-Sanchez
    Regulators of G-protein signaling 4 in adrenal gland: localization, regulation, and role in aldosterone secretion
    J. Endocrinol., Aug 2007; 194: 429 – 440.
    … …generously provided Losartan. Human adrenal total RNA was obtained from several sources: hAd1 (59-year-old male donor) from BioChain Institute Inc. (Hayward, CA, USA), hAd2 (pooled from 61 male/female Caucasian donors, ages 15-61) from BD Biosciences (Mountain… …
  • Debopriya Das, Tyson A. Clark, Anthony Schweitzer, Miki Yamamoto, Henry Marr, Josh Arribere, Simon Minovitsky, Alexander Poliakov, Inna Dubchak, John E. Blume, and John G. Conboy
    A correlation with exon expression approach to identify cis-regulatory elements for tissue-specific alternative splicing
    Nucleic Acids Res., Jul 2007; 35: 4845 – 4857.
    … …Total RNA from three biological replicates (three separate individuals) of 16 normal adult human tissues was purchased from BioChain (Hayward, CA, USA). Labeled target was generated from 200ng of total RNA and hybridized to a prototype version of the Affymetrix… …
  • Glenn S. Belinsky, Ann L. Parke, Qihong Huang, Kerry Blanchard, Supriya Jayadev, Raymond Stoll, Marti Rothe, Luke E. K. Achenie, Rishi R. Gupta, George Y. Wu, and Daniel W. Rosenberg
    The Contribution of Methotrexate Exposure and Host Factors on Transcriptional Variance in Human Liver
    Toxicol. Sci., Jun 2007; 97: 582 – 594.
    … …pathologists at JDH. Total RNA from normal human livers was obtained from Ambion (Austin, TX), Clontech (Mountain View, CA), and Biochain (Hayward, CA). The normal group of livers consisted of one female and nine males ranging in age from 24 to 70 years. Pathologic… …
  • Ayush Dagvadorj, Sean Collins, Jean-Baptiste Jomain, Junaid Abdulghani, James Karras, Tobias Zellweger, Hongzhen Li, Martti Nurmi, Kalle Alanen, Tuomas Mirtti, Tapio Visakorpi, Lukas Bubendorf, Vincent Goffin, and Marja T. Nevalainen
    Autocrine Prolactin Promotes Prostate Cancer Cell Growth via Jak2-Stat5a/b Signaling Pathway
    Endocrinology, Apr 2007; 10.1210/en.2006-1761.
    … …000306). The size of the PCR product yielded by this primer pair is 440 bp. Human brain pituitary total RNA was purchased from BioChain Institute, Inc. (Hayward, CA) and was used as positive control. Luciferase Reporter Gene Assay CWR22Rv cells were transfected…
  • Damian G. Romero, Maria W. Plonczynski, Elise P. Gomez-Sanchez, Licy L. Yanes, and Celso E. Gomez-Sanchez
    RGS2 Is Regulated by Angiotensin II and Functions as a Negative Feedback of Aldosterone Production in H295R Human Adrenocortical Cells 
    Endocrinology, Aug 2006; 147: 3889 – 3897.
    … …from Tocris (Ellisville, MO). Human adrenal total RNA was obtained from several sources: hAd1 (59-yr-old male donor) from BioChain Institute, Inc. (Hayward, CA)… …
  • Tae-You Kim, Sheng Zhong, C. Robert Fields, Jeong Hoon Kim, and Keith D. Robertson
    Epigenomic Profiling Reveals Novel and Frequent Targets of Aberrant DNA Methylation-Mediated Silencing in Malignant Glioma 
    Cancer Res., Aug 2006; 66: 7490 – 7501.
    … …chloroform extraction method (17). Two normal brain DNA and RNA samples from cancer-free individuals were purchased from BioChain (Hayward, CA)… …
  • Satohiro Masuda, Tomohiro Terada, Atsushi Yonezawa, Yuko Tanihara, Koshiro Kishimoto, Toshiya Katsura, Osamu Ogawa, and Ken-ichi Inui
    Identification and Functional Characterization of a New Human Kidney–Specific H+/Organic Cation Antiporter, Kidney-Specific Multidrug and Toxin Extrusion 2 
    J. Am. Soc. Nephrol., Aug 2006; 17: 2127 – 2135
    … …AB250364 and AB250701 , respectively. Real-Time PCR and RT-PCR Total RNA from various human tissues was purchased from BioChain (Hayward, CA). RT of the total RNA (500 ng/20 Ml reaction) and real-time PCR were carried out as described previously… …
  • Vincent Castronovo, David Waltregny, Philippe Kischel, Christoph Roesli, Giuliano Elia, Jascha N. Rybak, and Dario Neri
    A chemical proteomic approach for the identification of accessible antigens expressed in human kidney cancer
    Mol. Cell. Proteomics, Jul 2006; 10.1074/mcp.M600164-MCP200.
    … …cell carcinoma, granular cell carcinoma, transitional cell carcinoma, normal adult and fetal kidney were purchased from BioChain (Hayward, CA, USA)…
  • Jae-Hyun Park, Meng-Lay Lin, Toshihiko Nishidate, Yusuke Nakamura, and Toyomasa Katagiri
    PDZ-Binding Kinase/T-LAK Cell-Originated Protein Kinase, a Putative Cancer/Testis Antigen with an Oncogenic Activity in Breast Cancer
    Cancer Res., Sep 2006; 66: 9186 – 9195.
    … …of mRNA isolated from normal adult human mammary gland (Biochain, Hayward, CA), lung, heart, liver, kidney, and bone marrow…tissue sections of heart, lung, liver, kidney, and testis (Biochain). Briefly, paraffin-embedded specimens were treated with… … Ref. link
  • Døsen G, Tenstad E, Nygren MK, Stubberud H, Funderud S, Rian E.
    Wnt expression and canonical Wnt signaling in human bone marrow B lymphopoiesis
    BMC Immunol. 2006; 7: 13. published online before print June 29, 2006
    … …Total RNA from freshly isolated and sorted BM CD45+CD10+IgM- cells was isolated using Absolutely RNA?RT-PCR Mini-prep kit (Stratagene Europe, Amsterdam, Netherland) according to the manufacturer’s instructions. RNA from human fetal brain was purchased from BioChain Institute, Inc., USA. … …
  • Blow MJ, Grocock RJ, van Dongen S, Enright AJ, Dicks E, Futreal PA, Wooster R, Stratton MR.
    RNA editing of human microRNAs
    Genome Biol. 2006; 7(4): R27.
    … …For the initial screen of RNA editing in ten human tissues, total RNA and matching genomic DNA from the same tissue sample was obtained for human brain, heart, liver, lung, ovary, placenta, skeletal muscle, small intestine, spleen and testis from Biochain (Hayward, USA). … …
  • Human Umbilical Cord Matrix Stem Cells: Preliminary Characterization and Effect of Transplantation in a Rodent Model of Parkinson’s Disease
    Mark L. Weiss, Satish Medicetty, Amber R. Bledsoe, Raja Shekar Rachakatla, Michael Choi, Shosh Merchav, Yongquan Luo, Mahendra S. Rao, Gopalrao Velagaleti, and Deryl Troyer
    Stem Cells, Mar 2006; 24: 781 – 792.
    … …positive human control RNA (liver, placenta, and muscle; BioChain, Hayward, CA, http://www.biochain2011.com ) was evaluated using RT-PCR to confirm or expand… …
  • Wei Zhou, Zhilin Liu, Jianbo Wu, Jing-hua Liu, Salman M. Hyder, Eric Antoniou, and Dennis B. Lubahn
    Identification and Characterization of Two Novel Splicing Isoforms of Human Estrogen-Related Receptor ß
    J. Clin. Endocrinol. Metab., Feb 2006; 91: 569 – 579.
    … …A third placenta total RNA was purchased from BioChain Institute, Inc. (Hayward, CA). .. …
  • Damian G. Romero, Gaston R. Vergara, Zheng Zhu, Gina S. Covington, Maria W. Plonczynski, Licy L. Yanes, Elise P. Gomez-Sanchez, and Celso E. Gomez-Sanchez
    Interleukin-8 Synthesis, Regulation, and Steroidogenic Role in H295R Human Adrenocortical Cells
    Endocrinology, Feb 2006; 147: 891 – 898.
    … …cortisol. Real time RT-PCR Human adrenal total RNA was obtained from several sources: hAd1 (59 yr old male donor) from BioChain Institute, Inc. (Hayward, CA),… …
  • Helene Baribault, Jean Danao, Jamila Gupte, Li Yang, Banghua Sun, William Richards, and Hui Tian
    The G-Protein-Coupled Receptor GPR103 Regulates Bone Formation
    Mol. Cell. Biol., Jan 2006; 26: 709 – 717.
    … …visualized by autoradiography and light microscopy. Quantitative RT-PCR was performed on human total RNA from various tissues (BioChain or Clontech) using the Taqman Gold kit (Applied Biosystems) and primer and probe set 5-GGGCTTTCACAATGCTAG-3, 5-GGAAGTCATATTTGATCTC-3… …
  • Stephen J. Elliman, Isaac Wu, and Daniel M. Kemp
    Adult Tissue-specific Expression of a Dppa3-derived Retrogene Represents a Postnatal Transcript of Pluripotent Cell Origin
    J. Biol. Chem., Jan 2006; 281: 16 – 19.
    … …integrity of each sample. Pancreas cDNA was obtained from BioChain, and RACE (rapid amplification of cDNA ends) cDNA was…thyroid gland, heart and adrenal gland were obtained from BioChain. Each reaction well contained 5 mul of forward primer… …
  • Renate Parry, Doug Schneider, Debra Hudson, Debbie Parkes, Jian-Ai Xuan, Alicia Newton, Pam Toy, Rick Lin, Rick Harkins, Bruno Alicke, Sandra Biroc, Peter J. Kretschmer, Meredith Halks-Miller, Helmut Klocker, Ying Zhu, Brent Larsen, Ronald R. Cobb, Peter Bringmann, Georg Roth, Jason S. Lewis, Harald Dinter, and Gordon Parry
    Identification of a Novel Prostate Tumor Target, Mindin/RG-1, for Antibody-Based Radiotherapy of Prostate Cancer
    Cancer Res., Sep 2005; 65: 8397 – 8405.
    … …Tumor tissue total RNA was purchased from BioChain (Hayward, CA). A real-time quantitative reverse transcription-PCR assay was developed to measure mindin/RG-1 using specific… …
  • John Backus, Todd Laughlin, Yixin Wang, Robert Belly, Robert White, Jon Baden, C. Justus Min, Ann Mannie, Lorraine Tafra, David Atkins, and Kathryn M. Verbanac
    Identification and Characterization of Optimal Gene Expression Markers for Detection of Breast Cancer Metastasis
    Mol. Diagn., Aug 2005; 7: 327 – 336.
    … …medullary). Twenty-four tissue RNA samples from lung, colon, rectum, and ovary (6 normal and 18 cancerous; procured from BioChain, Inc.) were used as tissue specificity samples, along with a white blood cell (WBC) total RNA pool derived from 24 female… …
  • Tatiana Ort, Anibal A. Arjona, John R. MacDougall, Pam J. Nelson, Mark E. Rothenberg, Frank Wu, Andrew Eisen, and Yuan-Di C. Halvorsen
    Recombinant Human FIZZ3/Resistin Stimulates Lipolysis in Cultured Human Adipocytes, Mouse Adipose Explants, and Normal Mice
    Endocrinology, May 2005; 146: 2200 – 2209.
    … …real-time quantitative PCR (RTQ-PCR). Total RNA from various human tissues was acquired from Stratagene (La Jolla, CA) and BioChain Institute (Hayward, CA). All tissue samples were received from certified hospitals with informed consent from donors or… …
  • Xiao-Yan Zhao, Doug Schneider, Sandra L. Biroc, Renate Parry, Bruno Alicke, Pamela Toy, Jian-Ai Xuan, Choitsu Sakamoto, Ken Wada, Michael Schulze, Beate Müller-Tiemann, Gordon Parry, and Harald Dinter
    Targeting Tomoregulin for Radioimmunotherapy of Prostate Cancer
    Cancer Res., Apr 2005; 65: 2846 – 2853.
    … …tumor tissues were purified from clinical samples, and normal human tissue RNA was purchased from a commercial vendor (BioChain, Hayward, CA). Solid bars, normal prostate (N. prostate), benign prostatic hyperplasia (BPH Prostate), and prostate tumor… …
  • Thomas A. Hughes and Hugh J. M. Brady
    Expression of axin2 Is Regulated by the Alternative 5′-Untranslated Regions of Its mRNA
    J. Biol. Chem., Mar 2005; 280: 8581 – 8588.
    …. RNA and protein that had been purified simultaneously from single tissue samples was purchased from BioChain (AMS Biotechnology). cDNA samples were subjected to semi-quantitative PCR using RedTaq (Sigma) and the following …
  • Guenther Boden, Carol Homko, Maria Mozzoli, Louise C. Showe, Calen Nichols, and Peter Cheung
    Thiazolidinediones Upregulate Fatty Acid Uptake and Oxidation in Adipose Tissue of Diabetic Patients
    Diabetes, Mar 2005; 54: 880 – 885.
    … Control RNAs were human adult adipose tissue RNA and skeletal muscle RNA (purchased fromBioChain, Haywood, CA). …
  • Erez Y. Levanon, Martina Hallegger, Yaron Kinar, Ronen Shemesh, Kristina Djinovic-Carugo, Gideon Rechavi, Michael F. Jantsch, and Eli Eisenberg
    Evolutionarily conserved human targets of adenosine to inosine RNA editing
    Nucleic Acids Res., Feb 2005; 33: 1162 – 1168.
    … RNA and genomic DNA (gDNA) isolated simultaneously from the same tissue sample were purchased from Biochain Institute (Hayward, CA). …
  • Mingjun Liu, Yubin Ge, Diane C. Cabelof, Amro Aboukameel, Ahmad R. Heydari, Ramzi Mohammad, and Larry H. Matherly
    Structure and Regulation of the Murine Reduced Folate Carrier Gene: IDENTIFICATION OF FOUR NONCODING EXONS AND PROMOTERS AND REGULATION BY DIETARY FOLATES
    Biol. Chem., Feb 2005; 280: 5588 – 5597.
    … Total RNA from mouse small intestine was purchased from BioChain Institute, Inc. …
  • Tatiana Ort, Anibal A. Arjona, John R. MacDougall, Pam J. Nelson, Mark E. Rothenberg, Frank Wu, Andrew Eisen, and Yuan-Di C. Halvorsen
    Recombinant Human FIZZ3/Resistin Stimulates Lipolysis in Cultured Human Adipocytes, Mouse Adipose Explants and in Normal Mice
    Endocrinology, Feb 2005; 10.1210/en.2004-1421.
    … Total RNA from various human tissues was acquired from Stratagene (La Jolla, CA) and BioChainInstitute (Hayward, CA). …
  • Vladimir P. Grinevich, Sharon R. Letchworth, Kari A. Lindenberger, Jean Menager, Veronique Mary, Khalima A. Sadieva, Lori M. Buhlman, Georg Andrees Bohme, Laurent Pradier, Jesus Benavides, Ronald J. Lukas, and Merouane Bencherif
    Heterologous Expression of Human  6 4 3 5 Nicotinic Acetylcholine Receptors: Binding Properties Consistent with Their Natural Expression Require Quaternary Subunit Assembly Including the  5 Subunit
    Pharmacol. Exp. Ther., Feb 2005; 312: 619 – 626.
    … for total brain and cortex was obtained from BD Biosciences Clontech (Palo Alto, CA) and Biochain(Hayward, CA), respectively. …
  • Omer Barad, Eti Meiri, Amir Avniel, Ranit Aharonov, Adi Barzilai, Isaac Bentwich, Uri Einav, Shlomit Gilad, Patrick Hurban, Yael Karov, Edward K. Lobenhofer, Eilon Sharon, Yoel M. Shiboleth, Marat Shtutman, Zvi Bentwich, and Paz Einat
    MicroRNA expression detected by oligonucleotide microarrays: System establishment and expression profiling in human tissues
    Genome Res., Dec 2004; 14: 2486 – 2494.
    … brain RNA from Ambion, whereas Sempere et al. ( 2004 ) obtained it from the Biochain Institute. …
  • Ken-ichiro Okada, Tetsuo Minamino, Yoshitane Tsukamoto, Yulin Liao, Osamu Tsukamoto, Seiji Takashima, Akio Hirata, Masashi Fujita, Yoko Nagamachi, Takeshi Nakatani, Chikao Yutani, Kentaro Ozawa, Satoshi Ogawa, Hitonobu Tomoike, Masatsugu Hori, and Masafumi Kitakaze
    Prolonged Endoplasmic Reticulum Stress in Hypertrophic and Failing Heart After Aortic Constriction: Possible Contribution of Endoplasmic Reticulum Stress to Cardiac Myocyte Apoptosis
    Circulation, Aug 2004; 110: 705 – 712.
    … As the normal controls, we used total human heart RNA purchased from BD Bioscience and BioChain. … … Lanes 1 and 2 show normal human heart specimens obtained from Clontech and BioChain, respectively. …
  • Begovich AB, Carlton VE, Honigberg LA, Schrodi SJ, Chokkalingam AP, Alexander HC, Ardlie KG, Huang Q, Smith AM, Spoerke JM, Conn MT, Chang M, Chang SY, Saiki RK, Catanese JJ, Leong DU, Garcia VE, McAllister LB, Jeffery DA, Lee AT, Batliwalla F, Remmers E, Criswell LA, Seldin MF, Kastner DL, Amos CI, Sninsky JJ, Gregersen PK.
    A Missense Single-Nucleotide Polymorphism in a Gene Encoding a Protein Tyrosine Phosphatase (PTPN22) Is Associated with Rheumatoid Arthritis
    Am J Hum Genet. 2004 Aug; 75(2): 330-337.
    … …Tissues: Adipose BioChain -2.21 … …
    … …Tissues: Esophagus BioChain -3.61 … …
    … …Tissues: Breast BioChain -1.98 … …
    … …Tissues: Heart (pericardium) BioChain -1.56 … …
    … …Tissues: Pancreas BioChain -3.34 … …
    … …Tissues: Stomach BioChain -2.16 … …
    … …Tissues: Umbilical cord (fetal) BioChain -1.37 … …
  • Rotem Sorek, Ronen Shemesh, Yuval Cohen, Ortal Basechess, Gil Ast, and Ron Shamir
    A Non-EST-Based Method for Exon-Skipping Prediction
    Genome Res., Aug 2004; 14: 1617 – 1623.
    … from the following human tissue samples: (1) Brain pool, a pool of brain-derived RNA samples (Biochain ?Normal); (2) Prostate pool, a pool of prostate-derived RNA samples (Biochain ?Normal); (3) …
    … Testis pool, a pool of testis-derived RNA samples (Biochain ?Normal); (4) Kidney pool, a pool of kidney-derived RNA samples (Biochain ? Normal); (5) …
  • Sherif F. Nagueh, Gopi Shah, Yiming Wu, Guillermo Torre-Amione, Nicholas M.P. King, Sunshine Lahmers, Christian C. Witt, Katy Becker, Siegfried Labeit, and Henk L. Granzier
    Altered Titin Expression, Myocardial Stiffness, and Left Ventricular Function in Patients With Dilated Cardiomyopathy
     Circulation, Jul 2004; 110: 155 – 162.
     … myocardium (obtained from 6 males, aged 21 to 74 years, mean 37+-9 years; Ambion and BiochainInstitute Inc). …
  • Hideto Jinno, Toshiko Tanaka-Kagawa, Nobumitsu Hanioka, Seiich Ishida, Mayumi Saeki, Akiko Soyama, Masaya Itoda, Tetsuji Nishimura, Yoshiro Saito, Shogo Ozawa, Masanori Ando, and Jun-ichi Sawada
    Identification of Novel Alternative Splice Variants of Human Constitutive Androstane Receptor and Characterization of Their Expression in the Liver
    Mol. Pharmacol., Mar 2004; 65: 496 – 502.
    … Human liver total RNA (of male subjects aged 24?4) was obtained from Biochain (Hayward, CA). …
  • Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, Ambros V.
    Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation
    Genome Biol. 2004; 5(3): R13. published online before print February 16, 2004
    … …Frozen dissected organs from six-week-old C57BL/6 mice were a gift from Nathan Watson (Norris Cotton Cancer Center at Dartmouth-Hitchcock Medical Center). Total RNA was extracted from pooled organs of two to four mice or from cell lines with Trizol Reagent following the vendor’s recommendations. Total RNA, 5 or 10 µg, was routinely loaded onto 12% urea-polyacrylamide gels as described in [50]. Total RNA from human organs was acquired from the Biochain Institute. Membranes were stripped by boiling in 0.1% SDS and re-hybridized up to five times without observing decreases in quality … …
  • Winkler DG, Sutherland MK, Geoghegan JC, Yu C, Hayes T, Skonier JE, Shpektor D, Jonas M, Kovacevich BR, Staehling-Hampton K, Appleby M, Brunkow ME, Latham JA.
    Osteocyte control of bone formation via sclerostin, a novel BMP antagonist
    EMBO J. 2003 Dec 1; 22(23): 6267-6276.
    … …hMSCs cultured in growth (undifferentiated hMSCs) or osteogenic (hMSCs to osteoblasts) medium were harvested 21 days after plating and RNA isolated for RT–PCR analyses of SOST, COL1A1, PPAR?2, PTHR1, COLIXA1 and COLXA1. SOST expression was also determined in RNA prepared from abdominal adipose tissue (Biochain Institute, Hayward, CA), cartilage tissue from femoral growth plates (BiochainInstitute), primary cultures of human osteoblasts . … …
  • Bijay S. Jaiswal and Marco Conti
    Calcium regulation of the soluble adenylyl cyclase expressed in mammalian spermatozoa
     PNAS, Sep 2003; 100: 10676 – 10681.
    … Human total testis RNA was obtained from Clontech and Biochain Institute (Hayward, CA). …
  • Dirk Usener, Dirk Schadendorf, Joachim Koch, Stefan Dübel, and Stefan Eichmüller
    cTAGE: A Cutaneous T Cell Lymphoma Associated Antigen Family with Tumor-Specific Splicing
     J. Invest. Dermatol., Jul 2003; 121: 198 – 206.
    … tissues: bone marrow, brain, colon, placenta, prostate, spleen, skeletal muscle, small intestine, trachea, stomach, testis; BioChain Institute, Hayward, CA, and Becton Dickinson Clontech). …
  • Noriko Okazaki, Naomi Takahashi, Shin-ichi Kojima, Yasuhiko Masuho, and Hisashi Koga
    Protocadherin LKC, a new candidate for a tumor suppressor of colon and liver cancers, its association with contact inhibition of cell proliferation
    Carcinogenesis, Jul 2002; 23: 1139 – 1148.
    … The total RNA-Human Normal Colon was purchased from BioChain Institute (Hayward, CA). …
  • David R. Dorris, Ramesh Ramakrishnan, Dionisios Trakas, Frank Dudzik, Richard Belval, Connie Zhao, Allen Nguyen, Marc Domanus, and Abhijit Mazumder
    A Highly Reproducible, Linear, and Automated Sample Preparation Method for DNA Microarrays
    Genome Res., Jun 2002; 12: 976 – 984.
    … Preparation Total RNA was purchased for all tissues and the Burkitt’s lymphoma cell lines (Ambion;BioChain; Clontech), or prepared from the hepatocarcinoma cell line HepG2 using the TriZOL method (Invitrogen). …
  • Zhi-Bin Tong, Carolyn A. Bondy, Jian Zhou, and Lawrence M. Nelson
    A human homologue of mouse Mater, a maternal effect gene essential for early embryonic development
    Hum. Reprod., Apr 2002; 17: 903 – 911.
    … Ovarian RNA from a 26 year old woman was purchased from BioChain Inc. …
  • Jian Jin, Xuehui Chen, Yan Zhou, Mark Bartlam, Qing Guo, Yiwei Liu, Yixin Sun, Yu Gao, Sheng Ye, Guangtao Li, Zihe Rao, Boqin Qiang, and Jiangang Yuan
    Crystal structure of the catalytic domain of a human thioredoxin-like protein: Implications for substrate specificity and a novel regulation mechanism
    Eur. J. Biochem., Apr 2002; 269: 2060 – 2068.
    … DDRT-PCR and full-length cDNA isolation Total RNA (2.5 µg) from 13- and 33-week-old human fetal cerebrum (Biochain) was reverse transcribed by Superscript II (Gibco-BRL) using a single-base anchored 3′ primer (5′-AAGCTTTTTTTTTTTN-3′, N=C, G, …
    … Northern blot analysis Total Poly(A) + RNA from 13- and 33-week-old human fetal cerebrum (Biochain) was electrophoresed in a 1% agarose gel containing 0.66 M formaldehyde and was blotted onto a …
  • Ramesh Ramakrishnan, David Dorris, Anna Lublinsky, Allen Nguyen, Marc Domanus, Anna Prokhorova, Linn Gieser, Edward Touma, Randall Lockner, Murthy Tata, Xiaomei Zhu, Marcus Patterson, Richard Shippy, Timothy J. Sendera, and Abhijit Mazumder
    An assessment of Motorola CodeLinkTM microarray performance for gene expression profiling applications
    Nucleic Acids Res., Apr 2002; 30: 30.
    … MATERIALS AND METHODS Target preparation Five micrograms of total RNA (BioChain, Hayward, CA) were added to a reaction mix in a final volume of 12 µl, …
    … compared within three human poly(A)+ RNA samples (heart lot#A403084, brain lot#A311144 and kidney lot#A404013 from BioChain) using the Motorola CodeLink(TM) UniSet Human 1 expression bioarrays and the ABI TaqMan (R) products. …
  • Antonio Riccio, Cesar Mattei, Rosemary E. Kelsell, Andrew D. Medhurst, Andrew R. Calver, Andrew D. Randall, John B. Davis, Christopher D. Benham, and Menelas N. Pangalos
    Cloning and Functional Expression of Human Short TRP7, a Candidate Protein for Store-operated Ca2+Influx
    J. Biol. Chem., Mar 2002; 277: 12302 – 12309.
    … David Netherland’s Brain Bank, Amsterdam) or purchased as prepared RNA from Biochain (San Leandro, CA) and CLONTECH.
  • Sridhar Ramaswamy, Pablo Tamayo, Ryan Rifkin, Sayan Mukherjee, Chen-Hsiang Yeang, Michael Angelo, Christine Ladd, Michael Reich, Eva Latulippe, Jill P. Mesirov, Tomaso Poggio, William Gerald, Massimo Loda, Eric S. Lander, and Todd R. Golub
    Multiclass cancer diagnosis using tumor gene expression signatures
    PNAS, Dec 2001; 98: 15149 – 15154.
    … Normal tissue RNA (Biochain, Hayward, CA) was from snap-frozen autopsy specimens collected through the International Tissue Collection Network.
  • Mariana Nacht, Tatiana Dracheva, Yuhong Gao, Takeshi Fujii, Yidong Chen, Audrey Player, Viatcheslav Akmaev, Brian Cook, Michael Dufault, Mindy Zhang, Wen Zhang, MingZhou Guo, John Curran, Sean Han, David Sidransky, Kenneth Buetow, Stephen L. Madden, and Jin Jen
    Molecular characteristics of non-small cell lung cancer
    PNAS, Dec 2001; 98: 15203 – 15208.
    … Tumor RNA samples used for quantitative PCR and GeneChip analyses were either purchased fromBioChain (Hayward, CA) or obtained in the same manner as samples used for SAGE ( ). …
  • Makiko Iguchi, Setsuya Aiba, Yumiko Yoshino, and Hachiro Tagami
    Human Follicular Papilla Cells Carry Out Nonadipose Tissue Production of Leptin
    J. Invest. Dermatol., Dec 2001; 117: 1349 – 1356.
    … We also used RNA from human cutaneous adipose tissue (BioChain Institute, Hayward, CA) as a control
  • John E. DeHaven, Katherine A. Robinson, Bryce A. Nelson, and Maria G. Buse
    A Novel Variant of Glutamine: Fructose-6-Phosphate Amidotransferase-1 (GFAT1) mRNA Is Selectively Expressed in Striated Muscle
    Diabetes, Nov 2001; 50: 2419 – 2424. (cat. no. 061015) and human whole brain total RNA (cat. no. 061002) was obtained from Biochain Institute (Hayward, CA). …
  • Feng Wang-Johanning, Andra R. Frost, Gary L. Johanning, M. B. Khazaeli, Albert F. LoBuglio, Denise R. Shaw, and Theresa V. Strong
    Expression of Human Endogenous Retrovirus K Envelope Transcripts in Human Breast Cancer
    Clin. Cancer Res., Jun 2001; 7: 1553 – 1560.
    … and RNA from breast cancer tissues (invasive ductal carcinoma) was purchased from BioChainInstitute, Inc. …
  • Huibin Yue, P. Scott Eastman, Bruce B. Wang, James Minor, Michael H. Doctolero, Rachel L. Nuttall, Robert Stack, John W. Becker, Julie R. Montgomery, Marina Vainer, and Rick Johnston
    An evaluation of the performance of cDNA microarrays for detecting changes in global mRNA expression
    Nucleic Acids Res., Apr 2001; 29: 41.
    … Oligotex resin (Qiagen, Valencia, CA) from commercially available human placenta, brain and heart total RNA (Biochain, San Leandro, CA). …
    … done in the presence of 200 ng poly(A) mRNA, from either human brain or heart (Biochain, Hayward, CA). …
  • Yuan Zhu, David Michalovich, Hsiao-Ling Wu, K. B. Tan, George M. Dytko, Ishrat J. Mannan, Rogely Boyce, James Alston, Lauren A Tierney, Xiaotong Li, Nicole C. Herrity, Lisa Vawter, Henry M. Sarau, Robert S. Ames, Colleen M. Davenport, J. Paul Hieble, Shelagh Wilson, Derk J. Bergsma, and Laura R. Fitzgerald
    Cloning, Expression, and Pharmacological Characterization of a Novel Human Histamine Receptor
    Mol. Pharmacol., Mar 2001; 59: 434 – 441.
    … Ravid in Netherland’s Brain Bank (Amsterdam, the Netherlands), or purchased as preprepared RNA from Biochain (San Leandro, CA), CLONTECH (Palo Alto, CA). …
  • John B. Welsh, Patrick P. Zarrinkar, Lisa M. Sapinoso, Suzanne G. Kern, Cynthia A. Behling, Bradley J. Monk, David J. Lockhart, Robert A. Burger, and Garret M. Hampton
    Analysis of gene expression profiles in normal and neoplastic ovarian tissue samples identifies candidate molecular markers of epithelial ovarian cancer
    PNAS, Jan 2001; 98: 1176 – 1181.
    … RNA from normal human ovarian tissue was purchased from BioChain Institute (Hayward, CA). …
    … Normal human ovary purchased from BioChain was not enriched for any specific cell type before RNA preparation, and, accordingly, we observed…
  • Kenneth R. Luehrsen, Scott Davidson, Yun Ji Lee, Riaz Rouhani, Ali Soleimani, Teresa Raich, Carol A. Cain, Ellen J. Collarini, Douglas T. Yamanishi, Jennifer Pearson, Kerry Magee, Mary Rose Madlansacay, Veeraiah Bodepudi, David Davoudzadeh, Paula A. Schueler, and Walt Mahoney
    High-density Hapten Labeling and HRP Conjugation of Oligonucleotides for Use as In Situ Hybridization Probes to Detect mRNA Targets in Cells and Tissues
    J. Histochem. Cytochem., Jan 2000; 48: 133 – 146.
    … Total RNA from human adult peripheral blood was purchased from Biochain Institute (San Leandro, CA). …
  • Adrienne E. Dubin, Rene Huvar, Michael R. D’Andrea, Jayashree Pyati, Jessica Y. Zhu, K. C. Joy, Sandy J. Wilson, Jose E. Galindo, Charles A. Glass, Lin Luo, Michael R. Jackson, Timothy W. Lovenberg, and Mark G. Erlander
    The Pharmacological and Functional Characteristics of the Serotonin 5-HT3A Receptor Are Specifically Modified by a 5-HT3B Receptor Subunit
    J. Biol. Chem., Oct 1999; 274: 30799 – 30810.
    … Total RNA from normal human ascending and descending colon (CDP-061068; lot 8906066; CDP-061069; lot 8906067; BioChain Institute, Inc.) and 5 µg of each poly(A) RNA from normal human small intestine and …
  • Bo Hu, Kien Trinh, William F. Figueira, and Paul A. Price
    Isolation and Sequence of a Novel Human Chondrocyte Protein Related to Mammalian Members of the Chitinase Protein Family
    J. Biol. Chem., Aug 1996; 271: 19415 – 19420.
    … total RNA from human heart, brain, kidney, liver, lung, pancreas, and spleen was purchased fromBioChain Institute, Inc. …
  • Ilgar Abbaszade, Rui-Qin Liu, Fude Yang, Stuart A. Rosenfeld, O. Harold Ross, John R. Link, Dawn M. Ellis, Micky D. Tortorella, Michael A. Pratta, Jeannine M. Hollis, Richard Wynn, Jodie L. Duke, Henry J. George, Milton C. Hillman, Jr., Kathleen Murphy, Barbara H. Wiswall, Robert A. Copeland, Carl P. Decicco, Robert Bruckner, Hideaki Nagase, Yoshifumi Itoh, Robert C. Newton, Ronald L. Magolda, James M. Trzaskos, Gregory F. Hollis, Elizabeth C. Arner, and Timothy C. Burn
    Cloning and Characterization of ADAMTS11, an Aggrecanase from the ADAMTS Family
    J. Biol. Chem., Aug 1999; 274: 23443 – 23450.
    … RNAs from normal and diseased tissues were obtained from a commercial vendor (Biochain Institute Inc., San Leandro, CA) with quality being assessed in ethidium bromide-stained agarose gels prior …

Tissue Sectionx

  • Glycan Receptor Binding of the Influenza A Virus H7N9 Hemagglutinin
    Kannan Tharakaraman, Akila Jayaraman, Rahul Raman, Karthik Viswanathan, Nathan W Stebbins, David Johnson, Zachary Shriver, V Sasisekharan, Ram Sasisekharan
    Cell (32.4), 2013-06-20, 153, 1486-93
    … Riel et al., 2007). Paraffinized human tracheal and alveolar (US BioChain) tissue sections were deparaffinized, rehydrated, and incubated with 1% BSA in PBS for 30 min to prevent nonspecific binding. HA was precomplexed …
  • Vimentin is an endogenous ligand for the pattern recognition receptor Dectin-1
    Praveena S Thiagarajan, Valentin P Yakubenko, Deena H Elsori, Satya P Yadav, Belinda Willard, Carmela D Tan, E René Rodriguez, Maria Febbraio, Martha K Cathcart
    Cardiovasc. Res. (6.1), 2013-06-13, , 
    … 2. Methods. 2.1 Materials. Human atherosclerotic tissue samples were obtained from the Co-operative Human Tissue Network (NIH), the Department of Vascular Surgery at the Cleveland Clinic and BioChain (Hayward, CA, USA). …
  • Increased IL-6 detection in adult and pediatric lymphoid tissue harboring parvovirus B19
    Monica E Polcz, Laura A Adamson, Xiaomin Lu, Myron N Chang, Larry J Fowler, Jacqueline A Hobbs
    J. Clin. Virol. (4), 2013-05-28, 57, 233-8
    … 3. Study design. 3.1. Samples. Seventy-five duplicated sections of 0.5 μm thick formalin-fixed, paraffin-embedded (FFPE) tissues of various types of lymphoma and benign lymphoid tissues were examined (BioChain, Z7020070). …
  • Autoimmunity and cystatin SA1 deficiency behind chronic mucocutaneous candidiasis in autoimmune polyendocrine syndrome type 1
    Emma Lindh, Johan Brännström, Petra Jones, Fredrik Wermeling, Signe Hässler, Corrado Betterle, Ben Zion Garty, Mats Stridsberg, Björn Herrmann, Mikael C I Karlsson, Ola Winqvist
    J. Autoimmun. (8.1), 2013-05-06, 42, 1-6
    … Five μm cryosections from oral pig mucosa or normal human submandibular gland (BioChain) were incubated with saliva (1:10 dilution) from 3 APSI patients or 3 healthy controls overnight at 4 °C. Immunoreactivity was detected with a rabbit α-human-IgA-FITC antibody (Dako …
  • Quantitative characterization of glycan-receptor binding of H9N2 influenza A virus hemagglutinin
    Karunya Srinivasan, Rahul Raman, Akila Jayaraman, Karthik Viswanathan, Ram Sasisekharan
    PLoS ONE (4.4), 2013-04-29, 8, e59550
    … Binding of recombinant WF10, Qa88 and mutant HAs to human tracheal and alveolar tissue sections. Paraffinized human tracheal (US BioChain) tissue sections were deparaffinized, rehydrated and incubated with 1% BSA in PBS for 30 minutes to prevent non-specific binding. …
  • A novel human endogenous retroviral protein inhibits cell-cell fusion
    Jun Sugimoto, Makiko Sugimoto, Helene Bernstein, Yoshihiro Jinno, Danny Schust
    Sci Rep 0, 2013-03-15, 3, 1462
    … Normal paraffin-embedded human pancreas (T2234188) and testis (T2234260) tissue sections were purchased fromBioChain. All human tissue specimens were obtained under University of Missouri or University of the Ryukyus IRB-approved protocols. …
  • Functional cooperation of URAT1 (SLC22A12) and URATv1 (SLC2A9) in renal reabsorption of urate
    Takeo Nakanishi, Kouhei Ohya, Sho Shimada, Naohiko Anzai, Ikumi Tamai
    Nephrol. Dial. Transplant. (3.6), 2013-03-06, 28, 603-11
    … The slides were counterstained with Hoechst 33342 and then mounted with Vectashield® (Vector Laboratories). For immunohistochemistry of human tissue, paraffin-embedded human kidney sections were purchased from BioChain (Newark, CA, USA). …
  • Quantitative description of glycan-receptor binding of influenza a virus h7 hemagglutinin
    Karunya Srinivasan, Rahul Raman, Akila Jayaraman, Karthik Viswanathan, Ram Sasisekharan
    PLoS ONE (4.4), 2013-02-25, 8, e49597
    … Binding of recombinant FC and mFC: LS HAs to human tracheal and alveolar tissue sections. Paraffinized human tracheal (USBioChain) tissue sections were deparaffinized, rehydrated and incubated with 1% BSA in PBS for 30 minutes to prevent non-specific binding. …
  • The histone methyltransferase Wolf-Hirschhorn syndrome candidate 1-like 1 (WHSC1L1) is involved in human carcinogenesis
    Daechun Kang, Hyun-Soo Cho, Gouji Toyokawa, Masaharu Kogure, Yuka Yamane, Yukiko Iwai, Shinya Hayami, Tatsuhiko Tsunoda, Helen I Field, Koichi Matsuda, David E Neal, Bruce A J Ponder, Yoshihiko Maehara, Yusuke Nakamura, Ryuji Hamamoto
    Genes Chromosomes Cancer (4), 2013-02-17, 52, 126-39
    … Clinical information for each section is represented above histological pictures. All tissue samples were purchased fromBioChain. Original magnification, 200×. Download figure to PowerPoint. thumbnail image. Table 1. Statistical …
  • A DR6/p75NTR complex is responsible for β-amyloid-induced cortical neuron death
    Hu, Lee, Shao, Apicco, Huang, Gong
    Cell death & … 0, , , 
    … For immunoprecipitation from human fetal spinal cord tissue, 0.5 mg of spinal cord lysate (BioChain, Newark, CA, USA) was incubated with 4 μg/ml of anti-DR6 antibody (Santa Cruz Biotechnology, Inc.) and analyzed by western blot as described above. AP-binding assay. …
  • Perivascular mesenchymal progenitors in human fetal and adult liver
    Jörg C Gerlach, Patrick Over, Morris E Turner, Robert L Thompson, Hubert G Foka, William C W Chen, Bruno Péault, Bruno Gridelli, Eva Schmelzer
    Stem Cells Dev. (4.8), 2012-12-10, 21, 3258-69
    … Sections incubated with isotype-matched immunoglobulins served as negative controls. Human fetal muscle tissue was used as a positive control (BioChain, Hayward, CA). … Total human fetal liver and muscle RNA (BioChain) served as a relative quantitative normalizer. … 
  • MiR-182 overexpression in tumourigenesis of high-grade serous o varian carcinoma
    Zhaojian Liu, Jinsong Liu, Miguel F Segura, Changshun Shao, Peng Lee, Yaoqin Gong, Eva Hernando, Jian-Jun Wei
    J. Pathol. (7.3), 2012-10-11, 228, 204-15
    … recommended protocol. Briefly, 4 µm sections of FFPE tissues were hybridized with 40 nm miR-182 and U6 (Exiqon) overnight at 54 °C, diluted in 1× hybridization solution (BioChain Institute Inc, Hayward, CA, USA). After washing … 
  • Expression of proto-oncogene KIT is up-regulated in subset of human meningiomas
    Masum Saini, Ajaya Nand Jha, Andleeb Abrari, Sher Ali
    BMC Cancer (3.2), 2012-09-17, 12, 212
    … To ensure specificity of the antibody, appropriate controls, such as uterine tissue (negative control), GIST (characterized KIT positive case) from the clinical collaborators and commercially purchased normal meningeal tissue sections (BioChain, Hayward, CA, USA) were …
  • Expression of TMPRSS4 in non-small cell lung cancer and its modulation by hypoxia
    Tri-Hung Nguyen, William Weber, Evis Havari, Timothy Connors, Rebecca G Bagley, Rajashree McLaren, Prashant R Nambiar, Stephen L Madden, Beverly A Teicher, Bruce Roberts, Johanne Kaplan, Srinivas Shankara
    Int. J. Oncol. (2.6), 2012-09-16, 41, 829-38
    … tumor microenvironment. Materials and methods Cell lines and materials. Normal and tumor lung tissues were obtained fromBioChain (Hayward, CA). Cell lines were obtained from ATCC (Manassa, VA) unless specified. All cells … 
  • Expression of aspartoacylase (ASPA) and Canavan disease
    Anke Sommer, Jörn Oliver Sass
    Gene (2.3), 2012-09-01, 505, 206-10
    … Inc.) and 3 μg total RNA from human brain (Clontech order number: 636530; Lot: 0006033655), human kidney (Clontech order number: 636529; Lot: 8030501A), human liver (Clontech order number: 636531; Lot: 9100089A) and human lung tissue (BioChain order number …
  • Insulin-like growth factor I receptor involvement in proliferation of NOR-P1 cells in serum-free media
    Minoru Tomizawa, Fuminobu Shinozaki, Takao Sugiyama, Shigenori Yamamoto, Makoto Sueishi, Takanobu Yoshida
    J. Cell. Biochem. (3.1), 2012-08-19, 113, 2714-20
    … Serial sections of human pancreatic cancer tissue from an adenocarcinoma of a 62-year-old man (BioChain, Hayward, CA) were deparaffinized, autoclaved, and incubated with hydrogen peroxide, followed by a 30-min incubation with 2% normal goat serum in phosphate …
  • A subset of human gliomas shows over-expression of KIT without its amplification
    Masum Saini, Ajaya Nand Jha, Andleeb Abrari, Sher Ali
    Gene (2.3), 2012-04-15, 497, 155-63
    … Appropriate controls, such as uterine tissue (negative control), GIST (characterized KIT positive case) from the clinical collaborators and commercially purchased non-neoplastic brain cerebellar tissue sections (BioChain, USA) were included for processing in each batch, to …
  • Identification of GABRA1 and LAMA2 as new DNA methylation markers in colorectal cancer
    Sunwoo Lee, Taejeong Oh, Hyuncheol Chung, Sunyoung Rha, Changjin Kim, Youngho Moon, Benjamin D Hoehn, Dongjun Jeong, Seunghoon Lee, Namkyu Kim, Chanhee Park, Miae Yoo, Sungwhan An
    Int. J. Oncol. (2.6), 2012-03-09, 40, 889-98
    … Each tumor specimen was histologically verified by board-certified pathologists. Five colorectal tissue samples from cancer-free individuals were purchased from BioChain (Hayward, CA, USA). 5-aza-2′-deoxycytidine (DAC) treatment to cell lines. … 
  • Han Han, Connie C. Cortez, Xiaojing Yang, Peter W. Nichols, Peter A. Jones, and Gangning Liang
    DNA methylation directly silences genes with non-CpG island promoters and establishes a nucleosome occupied promoter
     Hum. Mol. Genet., Nov 2011; 20: 4299 – 4310.  
     … …were extracted 8 days after the treatment. Tissue collection and DNA isolation DNA from healthy tissue was purchased from BioChain Institute Inc. (Hayward, CA, USA). DNA from matched sets of adjacent normal bladder and tumor specimens was obtained from bladder… … 
    Ref. link
  • Juhi Ojha, Gunasingh Masilamoni, David Dunlap, Ross A. Udoff, and Anil G. Cashikar
    Sequestration of Toxic Oligomers by HspB1 as a Cytoprotective Mechanism
     Mol. Cell. Biol., Aug 2011; 31: 3146 – 3157.   
     … …an AD (73-year-old male) and a normal (54-year-old male) deidentified (anonymous) human hippocampus were purchased from the Biochain Institute. Mice were euthanized using carbon dioxide and transcardially perfused with saline followed by 4% paraformaldehyde… … 
    Ref. link
  • Takashi Ueda, Michiko Shikano, Takeshi Kamiya, Takashi Joh, and Shinya Ugawa
    The TRPV4 channel is a novel regulator of intracellular Ca2+ in human esophageal epithelial cells
     Am J Physiol Gastrointest Liver Physiol, Jul 2011; 301: G138 – G147.    
     … …Immunohistochemistry. Frozen sections of human normal adult esophagus (from a 66-yr-old male, T1234106, lot. A804297) were obtained from BioChain Institute (Hayward, CA). After being air-dried, the HET-1A cells and human frozen sections were fixed in 4% paraformaldehyde… … 
    Ref. link
  • Dimitrios Iliopoulos, Heather A. Hirsch, and Kevin Struhl
    Metformin Decreases the Dose of Chemotherapy for Prolonging Tumor Remission in Mouse Xenografts Involving Multiple Cancer Cell Types
     Cancer Res., May 2011; 71: 3196 – 3201. 
     … …after treatment. Human breast tissues Three snap-frozen ductal carcinoma tissues were purchased from AMS Biotechnology and Biochain Inc. The purification process of CD44high and CD24high derived from human breast tumors has been previously described (17-19… … 
    Ref. link
  • Andrew P. Landstrom, Cherisse A. Kellen, Sayali S. Dixit, Ralph J. van Oort, Alejandro Garbino, Noah Weisleder, Jianjie Ma, Xander H.T. Wehrens, and Michael J. Ackerman
    Junctophilin-2 Expression Silencing Causes Cardiocyte Hypertrophy and Abnormal Intracellular Calcium-Handling
     Circ Heart Fail, Mar 2011; 4: 214 – 223.
     … …Tissue Human cardiac tissue was obtained from the left ventricle of traumatic death victims with no structural heart disease (BioChain Institute, CA; P1234139, Lot A506041; P1234138, Lot A710149; and CP-R01-T1234130, Lot B201244). Left ventricular myectomy tissue… … 
    Ref. link
  • V. Medina Villaamil, S. Vazquez-Estevez, B. Campos, L. Leon Mateos, J. L. Fírvida, M. Ramos, F. J. Afonso, O. Fernández Calvo, M. Valladares Ayerbes, and L. M. Antón Aparicio
    GAPDH, YWHAZ, and RRN18S as control reference genes for gene expression studies on renal cell carcinoma (RCC) formaldehyde-fixed paraffin-embedded (FFPE) tissue samples.
     ASCO Meeting Abstracts, Mar 2011; 29: 389. 
     … …cell carcinoma (ccRCC), papillary renal cell carcinoma (pRCC) and cromophobe renal cell carcinoma (cRCC). A commercial pool (Biochain) of 5 cases of normal kidney was analyzed too. All samples were measured in triplicate. Expression levels of RGs: GAPDH, TUBB… … 
    Ref. link
  • Yoshifumi Takei, Misato Takigahira, Keichiro Mihara, Yuzo Tarumi, and Kazuyoshi Yanagihara
    The Metastasis-Associated microRNA miR-516a-3p Is a Novel Therapeutic Target for Inhibiting Peritoneal Dissemination of Human Scirrhous Gastric Cancer
     Cancer Res., Feb 2011; 71: 1442 – 1453. 
     … …harvested. Details of the patients’ background was summarized in Supplementary Table S1. Normal stomach tissues were purchased from BioChain Institute, Inc. Each total RNA was extracted from the tissues, and quantitative real-time RT-PCR for miR-516a-3p was performed… … 
    Ref. link
  • Tomoko Ichiki, Brenda K. Huntley, Denise M. Heublein, Sharon M. Sandberg, Paul M. McKie, Fernando L. Martin, Michihisa Jougasaki, and John C. Burnett, Jr.
    Corin Is Present in the Normal Human Heart, Kidney, and Blood, with Pro–B-Type Natriuretic Peptide Processing in the Circulation
     Clin. Chem., Jan 2011; 57: 40 – 47. 
     … …Immunohistochemistry was performed on normal human heart and kidney of commercially available tissue sections (US Biomax, Inc.; BioChain Institute, Inc.). Tissue slides were fixed with 4% formaldehyde. A commercially available indirect immunoperoxidase kit (Vector… … 
    Ref. link
  • Chia Lin Chang, James J. Cai, Chiening Lo, Jorge Amigo, Jae-Il Park, and Sheau Yu Teddy Hsu
    Adaptive selection of an incretin gene in Eurasian populations
     Genome Res., Jan 2011; 21: 21 – 32. 
     … …CREARALELASQAN peptide (Covance Research Products and Genescript). For immunohistochemical analyses, human duodenum sections (BioChain Institute) were dewaxed with xylene and maintained for 10 min at 95C in 10 mM sodium citrate buffer (pH 6.0), followed by cooling… … 
    Ref. link
  • Dimitrios Iliopoulos, Heather A. Hirsch, Guannan Wang, and Kevin Struhl
    Inducible formation of breast cancer stem cells and their dynamic equilibrium with non-stem cancer cells via IL6 secretion
     PNAS, Jan 2011; 108: 1397 – 1402. 
     … …from Human Breast Tissues. Five human invasive ductal carcinoma tissues (stage III) were purchased from AMS Biotechnology and Biochain Inc. All these tissues were negative for ER, PR, and HER2 expression (triple negative). Immunomagnetic purification of CSCs… … 
    Ref. link
  • Steven D. Zumbrun, Leanne Hanson, James F. Sinclair, James Freedy, Angela R. Melton-Celsa, Jaime Rodriguez-Canales, Jeffrey C. Hanson, and Alison D. O’Brien
    Human Intestinal Tissue and Cultured Colonic Cells Contain Globotriaosylceramide Synthase mRNA and the Alternate Shiga Toxin Receptor, Globotetraosylceramide
     Infect. Immun., Nov 2010; 78: 4488 – 4499.  
     … …tissue190 specimens obtained from an 18-year-old male donor (Biochain, Inc., Hayward, CA) and191 a 74 yr old male donor (Bioserve…either 1)serially sectioned and acetone-fixed onto glass slides (Biochain), or 2)194 sectioned (6 mum) from fresh tissue (Bioserve) and… … 
    Ref. link
  • Promsuk Jutabha, Naohiko Anzai, Kenichiro Kitamura, Atsuo Taniguchi, Shuji Kaneko, Kunimasa Yan, Hideomi Yamada, Hidetaka Shimada, Toru Kimura, Tomohisa Katada, Toshiyuki Fukutomi, Kimio Tomita, Wako Urano, Hisashi Yamanaka, George Seki, Toshiro Fujita, Yoshinori Moriyama, Akira Yamada, Shunya Uchida, Michael F. Wempe, Hitoshi Endou, and Hiroyuki Sakurai
    Human Sodium Phosphate Transporter 4 (hNPT4/SLC17A3) as a Common Renal Secretory Pathway for Drugs and Urate
     J. Biol. Chem., Nov 2010; 285: 35123 – 35132. 
     … …Alexa546 fluorescence was excited by green helium-neon laser light with a wavelength of 543 nm. Human single-tissue slides (Biochain) were used for light microscopic immunohistochemical analysis as described elsewhere ( 16 ). Antigen peptide corresponding… … 
    Ref. link
  • Binnur Eroglu, Demetrius Moskophidis, and Nahid F. Mivechi
    Loss of Hsp110 Leads to Age-Dependent Tau Hyperphosphorylation and Early Accumulation of Insoluble Amyloid β
     Mol. Cell. Biol., Oct 2010; 30: 4626 – 4643. 
     … …with Alzheimers disease. (A) Paraffin-embedded human tissue samples of brain sections from patients with Alzheimers disease (Biochain) (hippocampal region) were immunostained using primary antibodies to Hsp110 and Ab and fluorescent Cy3- or FITC-conjugated… … 
    Ref. link
  • Sonja M. Wiedemann, Silke N. Mildner, Clemens Bönisch, Lars Israel, Andreas Maiser, Sarah Matheisl, Tobias Straub, Rainer Merkl, Heinrich Leonhardt, Elisabeth Kremmer, Lothar Schermelleh, and Sandra B. Hake
    Identification and characterization of two novel primate-specific histone H3 variants, H3.X and H3.Y
     J. Cell Biol., Sep 2010; 190: 777 – 791.
     … …normal lung, breast and tumor breast, and lung and ovary) and BioChain (tumor lung, breast, thyroid and bone, normal testis, cerebellum…Commercially available frozen sections of human hippocampus (Biochain) were thawed and blocked with 0.5% BSA in 0.5% Triton X-100-PBS… … 
    Ref. link
  • Yasuna Kobayashi, Takahiro Umemoto, Masayuki Ohbayashi, Noriko Kohyama, Yutaka Sanada, and Toshinori Yamamoto
    Activation of Cyclosporin A Transport by a Novel   Light Chain of Human Ig Surface Antigen-Related Gene in Xenopus laevis Oocytes
     Drug Metab. Dispos., Sep 2010; 38: 1427 – 1435. 
     … …medium did not exceed 1%. Immunohistochemical Analysis. A 5-mum wax section of human small intestine was obtained from BioChain Institute, Inc. (San Leandro, CA) and light microscopic immunohistochemical analysis using the streptavidin-biotin-horseradish… … 
    Ref. link
  • Jae-Hyun Park, Toshihiko Nishidate, Kyoko Kijima, Takao Ohashi, Kaoru Takegawa, Tomoko Fujikane, Koichi Hirata, Yusuke Nakamura, and Toyomasa Katagiri
    Critical Roles of Mucin 1 Glycosylation by Transactivated Polypeptide N-Acetylgalactosaminyltransferase 6 in Mammary Carcinogenesis
     Cancer Res., Apr 2010; 70: 2759 – 2769. 
     … …Slides of paraffin-embedded breast cancer, normal specimens, and normal human tissues including heart, lung, liver, and kidney (BioChain) were stained with anti-GALNT6 polyclonal (diluted at 1:30), anti-GALNT6 monoclonal (3G7, diluted at 1:40), and anti-MUC1 monoclonal… … 
    Ref. link
  • Yun Zhang, Yoichi Yamada, Mingming Fan, Saroja D. Bangaru, Bochao Lin, and Jian Yang
    The β Subunit of Voltage-gated Ca2+ Channels Interacts with and Regulates the Activity of a Novel Isoform of Pax6
     J. Biol. Chem., Jan 2010; 285: 2527 – 2536. 
     … …reagent. Paraffin-embedded human retina and brain tissue slides (BioChain) were deparaffinized with xylene and then rehydrated through…heart, liver, skeletal muscle, and placenta) was obtained fromBioChain and then analyzed by hybridization with antibodies according… … 
    Ref. link
  • Mary Ellen Maddalena, Jaclyn Fox, Jianqing Chen, Weiwei Feng, Aldo Cagnolini, Karen E. Linder, Michael F. Tweedle, Adrian D. Nunn, and Laura E. Lantry
    177Lu-AMBA Biodistribution, Radiotherapeutic Efficacy, Imaging, and Autoradiography in Prostate Cancer Models with Low GRP-R Expression
     J. Nucl. Med., Dec 2009; 50: 2017 – 2024.
     … …controls were frozen sections of human prostate carcinoma (Biochain). To establish the growing fraction of the tumors, immunohistochemistry…Positive controls were human breast carcinoma frozen sections (Biochain). The immunohistochemistry slides were graded in a range from… … 
    Ref. link
  • Karen J. Meaburn, Prabhakar R. Gudla, Sameena Khan, Stephen J. Lockett, and Tom Misteli
    Disease-specific gene repositioning in breast cancer
     J. Cell Biol., Dec 2009; 187: 801 – 812. 
     … …Normal Absence of cancer; 56 y BioChain T2234086 5 microm N6 Normal NAT; 50 y BioChain TMA core A2 4 microm N7 Normal…C7 IDC TMN stage T4N3M1; 50 y BioChain TMA core C1 4 microm C8 IDC… … 
    Ref. link
  • Caterina Bianco, Catherine Cotten, Enza Lonardo, Luigi Strizzi, Christina Baraty, Mario Mancino, Monica Gonzales, Kazuhide Watanabe, Tadahiro Nagaoka, Colin Berry, Andrew E. Arai, Gabriella Minchiotti, and David S. Salomon
    Cripto-1 Is Required for Hypoxia to Induce Cardiac Differentiation of Mouse Embryonic Stem Cells
     Am. J. Pathol., Nov 2009; 175: 2146 – 2158. 
     … …Porcine Heart Tissue Sections Paraffin and frozen tissue sections from patients who suffered acute MI (AMI) were purchased from Biochain Institute (Hayward, CA): eight AMI serial human heart tissue sections and six non-AMI (congenital heart disease or hypertension… …  
    Ref. link
  • Tomomi Ueki, Jae-Hyun Park, Toshihiko Nishidate, Kyoko Kijima, Koichi Hirata, Yusuke Nakamura, and Toyomasa Katagiri
    Ubiquitination and Downregulation of BRCA1 by Ubiquitin-Conjugating Enzyme E2T Overexpression in Human Breast Cancer Cells
     Cancer Res., Nov 2009; 69: 8752 – 8760. 
     … …analysis Slides of paraffin-embedded breast cancer tissues and other normal human tissues (lung, heart, liver, and kidney; Biochain) were processed for antigen retrieval by the antigen retrieval solution pH9 (DAKO Cytomation), and treated with peroxidase… … 
    Ref. link
  • Sergey A. Shiryaev, Albert G. Remacle, Alexei Y. Savinov, Andrei V. Chernov, Piotr Cieplak, Ilian A. Radichev, Roy Williams, Tatiana N. Shiryaeva, Katarzyna Gawlik, Tatiana I. Postnova, Boris I. Ratnikov, Alexei M. Eroshkin, Khatereh Motamedchaboki, Jeffrey W. Smith, and Alex Y. Strongin
    Inflammatory Proprotein Convertase-Matrix Metalloproteinase Proteolytic Pathway in Antigen-presenting Cells as a Step to Autoimmune Multiple Sclerosis
     J. Biol. Chem., Oct 2009; 284: 30615 – 30626.
     … …oblongata of healthy and MS patients were purchased from the BioChain Institute (Hayward, CA). The frozen human brain tissue samples…blotting with the MBP antibody. The extracts were purchased fromBioChain Institute (Hayward, CA). The representative samples are shown… … 
    Ref. link
  • Stefan A. Kaden, Stefanie Kurig, Katrin Vasters, Kay Hofmann, Kurt S. Zaenker, Juergen Schmitz, and Gregor Winkels
    Enhanced Dendritic Cell-Induced Immune Responses Mediated by the Novel C-Type Lectin Receptor mDCAR1
     J. Immunol., Oct 2009; 183: 5069 – 5078. 
     … …R35-95), rIgG2b (A95-1), all from BD Biosciences. Immunofluorescence microscopy Frozen splenic tissue sections (5-10 um; BioChain) derived from BALB/c mice were incubated for 15 h at 4C with the following mAb conjugates diluted in PBS containing 1% BSA… … 
    Ref. link
  • Jeanne L. Theis, J. Martijn Bos, Jason D. Theis, Dylan V. Miller, Joseph A. Dearani, Hartzell V. Schaff, Bernard J. Gersh, Steve R. Ommen, Richard L. Moss, and Michael J. Ackerman
    Expression Patterns of Cardiac Myofilament Proteins: Genomic and Protein Analysis of Surgical Myectomy Tissue From Patients With Obstructive Hypertrophic Cardiomyopathy
    Circ Heart Fail, Jul 2009; 2: 325 – 333.
    … …Healthy flash-frozen heart tissue was obtained from the interventricular septum of a disease-free, accidental death victim (Biochain, Hayward, Calif). Healthy tissue was flash frozen in liquid nitrogen, to compare protein levels with the HCM myectomy tissue… … 
    Ref. link
  • TEODORA NIKOLOVA, MARKUS CHRISTMANN, and BERND KAINA
    FEN1 is Overexpressed in Testis, Lung and Brain Tumors
    Anticancer Res, Jul 2009; 29: 2453 – 2459. 
    … …glioblastoma multiforme (n=13) and astrocytoma (n=7)] were compared with commercially available extracts from normal human cerebellum (BioChain, Hayward, CA, USA). For preparation of total tumor tissue extracts, the frozen tissue was crushed in a mortar and transferred… … 
    Ref. link
  • Tadashi Matsumoto, Kazuhiro Minegishi, Hitoshi Ishimoto, Mamoru Tanaka, Jon D. Hennebold, Takahide Teranishi, Yoshihisa Hattori, Masataka Furuya, Takayuki Higuchi, Satoshi Asai, Seon Hye Kim, Kei Miyakoshi, and Yasunori Yoshimura
    Expression of Ovary-Specific Acidic Protein in Steroidogenic Tissues: A Possible Role in Steroidogenesis
    Endocrinology, Jul 2009; 150: 3353 – 3359. 
    … …derived from human and mouse tissues were purchased from CLONTECH Laboratories (Mountain View, CA), Zyagen (San Diego, CA), and BioChain (Hayward, CA). Reverse transcription reactions with random primers were carried out with Omniscript reverse transcriptase… … 
    Ref. link
  • Barry W. Larman, Michele J. Karolak, Derek C. Adams, and Leif Oxburgh
    Chordin-like 1 and Twisted Gastrulation 1 Regulate BMP Signaling following Kidney Injury
    J. Am. Soc. Nephrol., May 2009; 20: 1020 – 1031. 
    … …Technology and goat anti-rabbit Alexa Fluor 568 (Molecular Probes). Formalin-fixed human kidney sections were purchased from the Biochain Institute (Hayward, CA) and Zyagen Laboratories (San Diego, CA). Proximal tubules and nuclei were marked as described already… … 
    Ref. link
  • Ayuko A. Iverson, Cheryl Gillett, Paul Cane, Christopher D. Santini, Thomas M. Vess, Lauren Kam-Morgan, Alice Wang, Marcia Eisenberg, Charles M. Rowland, Janice J. Hessling, Samuel E. Broder, John J. Sninsky, Andrew Tutt, Steven Anderson, and Sheng-Yung P. Chang
    A Single-Tube Quantitative Assay for mRNA Levels of Hormonal and Growth Factor Receptors in Breast Cancer Specimens
    J. Mol. Diagn., Mar 2009; 11: 117 – 130. 
    … …determine FFPE section-to-section reproducibility, five sequential sections from each of 10 breast cancer tumor FFPE samples (BioChain Institute, Hayward, CA) were obtained. Before RNA was isolated, the slide was checked to ensure that all sections from each… …
    Ref. link
  • Ke Zen, Dan-Qing Liu, Li-Min Li, Celia X-J Chen, Ya-Lan Guo, Bihn Ha, Xi Chen, Zhen-Yu Zhang, and Yuan Liu
    The Heparan Sulfate Proteoglycan Form of Epithelial CD44v3 Serves as a CD11b/CD18 Counter-receptor during Polymorphonuclear Leukocyte Transepithelial Migration
    J. Biol. Chem., Feb 2009; 284: 3768 – 3776. 
    … …on coverslides followed by air drying before immunostaining was performed. Normal human colon sections were purchased from Biochain (Hayward, CA). Recombinant human TNF-alpha and interferon-gamma were purchased from Upstate Biotechnology and used at 20 and… … 
    Ref. link
  • Liliane Benkoël, Jean-Paul Bernard, Marie-José Payan-Defais, Lydie Crescence, Cécile Franceschi, Mireille Delmas, Mehdi Ouaissi, Bernard Sastre, José Sahel, Anne-Marie Benoliel, Pierre Bongrand, Françoise Silvy, Laurent Gauthier, François Romagné, Dominique Lombardo, and Eric Mas
    Monoclonal antibody 16D10 to the COOH-terminal domain of the feto-acinar pancreatic protein targets pancreatic neoplastic tissues
    Mol. Cancer Ther., Feb 2009; 8: 282 – 291. 
    … …Frozen tissue slides of a PDAC provided by BioChain were also studied. Adjacent nontumoral…paraffin-embedded sections. Tissue provided by BioChain. All controls and patients were Caucasians…studied as negative tissue controls (BioChain). Formalin-fixed, paraffin-embedded tissue… … 
    Ref. link
  • Adam Palermo, Regis Doyonnas, Nidhi Bhutani, Jason Pomerantz, Ozan Alkan, and Helen M. Blau
    Nuclear reprogramming in heterokaryons is rapid, extensive, and bidirectional
    FASEB J, Jan 2009; 10.1096/fj.08-122903. 
    … …Universal Total RNA (SuperArray, Frederick, MD, USA). Mouse reference RNA was a mixture of Universal RNA: Mouse Normal Tissues (BioChain, Hayward, CA, USA), Universal Mouse Reference RNA (Strat-agene, La Jolla, CA, USA), and RNA from whole mouse E17.5 embryos… … 
    Ref. link
  • Katherine Elena Varley and Robi David Mitra
    Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Genome Res., Nov 2008; 18: 1844 – 1850.
    … …tissue from an 81-yr-old male was obtained from Biochain ( www.biochain.com ), catalog no. D8235090-PP-10. Targets were…either the colon tumor or the adjacent normal tissue (Biochain, catalog no. D8235090-PP-10). This reaction was… … 
    Ref. link
  • Masashi Akiyama, Kaori Sakai, Chitoshi Takayama, Teruki Yanagi, Yasuko Yamanaka, James R. McMillan, and Hiroshi Shimizu
    CGI-58 Is an  /¦Â-Hydrolase within Lipid Transporting Lamellar Granules of Differentiated Keratinocytes
    Am. J. Pathol., Nov 2008; 173: 1349 – 1360. 
    … …tissue slides of human liver and brain were purchased from BioChain Institute Inc. (Hayward, CA). Normal human adult liver or brain…normal mouse and human tissue extracts were purchased fromBioChain Institute, Inc. (Hayward, CA). Cell lysates (100 ug of protein… … 
    Ref. link
  • Lori M. Roberts, Kathleen Woodford, Mei Zhou, Deborah S. Black, Jill E. Haggerty, Emily H. Tate, Kent K. Grindstaff, Wondwessen Mengesha, Chandrasekaran Raman, and Noa Zerangue
    Expression of the thyroid hormone transporters MCT8 (SLC16A2) and OATP14 (SLCO1C1) at the blood-brain barrier
    Endocrinology, Aug 2008; 10.1210/en.2008-0378.
    … …parietal lobe (female, 37 weeks), hippocampus (female, 82 years), and choroid plexus (female, 70 years) were purchased from BioChain Institute (Hayward, CA, USA). Quantitative PCR RNeasy RNA Isolation Kit and Qiashredder homogenizer columns (Qiagen, Valencia… …
    Ref. link
  • Jing Chen, Jean Lozach, Eliza Wickham Garcia, Bret Barnes, Shujun Luo, Ivan Mikoulitch, Lixin Zhou, Gary Schroth, and Jian-Bing Fan
    Highly sensitive and specific microRNA expression profiling using BeadArray technology
    Nucleic Acids Res., Aug 2008; 36: e87.
    … …experiments, small RNA molecules were enriched using Invitrogen’s PureLink miRNA Isolation Kit. FFPE samples were purchased from Biochain Institute, Inc., and RNA was extracted using Qiagen’s RNeasy FFPE Kit. miRNA profiling on universal BeadArray platform… … 
    Ref. link
  • Yasunaga Ono, Naohisa Oda, Shin Ishihara, Atsushi Shimomura, Nobuki Hayakawa, Atsushi Suzuki, Akihiko Horiguchi, Takao Senda, Shuichi Miyakawa, and Mitsuyasu Itoh
    Insulinoma cell calcium-sensing receptor influences insulin secretion in a case with concurrent familial hypocalciuric hypercalcemia and malignant metastatic insulinoma.
    Eur. J. Endocrinol., Jul 2008; 159: 81 – 86. 
    … …for both pancreatic and kidney tissues were purchased from BioChain Institute Inc. (Hayward, CA, USA). RT-PCR for the detection…thickness were prepared. Section of parathyroid purchased from BioChain Institute Inc. was used as a positive control. Immunohistochemistry… … 
    Ref. link
  • Kevin A. Glenn, Rick F. Nelson, Hsiang M. Wen, Adam J. Mallinger, and Henry L. Paulson
    Diversity in Tissue Expression, Substrate Binding, and SCF Complex Formation for a Lectin Family of Ubiquitin Ligases
    J. Biol. Chem., May 2008; 283: 12717 – 12729. 
    … …and pelleting debris by centrifugation at 16,000 g, 4 C for 15 min. Mouse tissue preparations from a commercial supplier (BioChain, Hayward, CA) produced similar results. Immunoprecipitation (IP) Nondenatured lysates from 10-cm plates were incubated… … 
    Ref. link
  • Eric Soupene, Vladimir Serikov, and Frans A. Kuypers
    Characterization of an acyl-coenzyme A binding protein predominantly expressed in human primitive progenitor cells
    J. Lipid Res., May 2008; 49: 1103 – 1112. 
    … …protein array (human adult normal tissues Biochain Institute, Inc.) was performed as follows…according to the manufacturers instructions (Biochain Institute, Inc.). Immunohistochemistry…antibody on a MegaWestern protein array (Biochain Institute, Inc.) representing 30 different… … 
    Ref. link
  • Kathryn B. Horwitz, Wendy W. Dye, Joshua Chuck Harrell, Peter Kabos, and Carol A. Sartorius
    Rare steroid receptor-negative basal-like tumorigenic cells in luminal subtype human breast cancer xenografts
    PNAS, Apr 2008; 105: 5774 – 5779.
    … …Cancerous Breast Tis- sue. Normal human breast tissue was obtained from US Biomax. Breast cancer tissue arrays were purchased from Biochain. These were stained using a DAB system for CK5 and PR as described. Were also stained fluorescently for CK5 and PR. For analyses… … 
    Ref. link
  • Melissa L. Palmer, Katherine R. Schiller, and Scott M. O’Grady
    Apical SK potassium channels and Ca2+-dependent anion secretion in endometrial epithelial cells
    J. Physiol., Feb 2008; 586: 717 – 726. 
    … …DNase-free RNA isolated from porcine brain was purchased from BioChain Institute Inc. (Hayward, CA, USA). Dulbeccos modified Eagles…DNase-free RNA isolated from porcine brain was purchased fromBioChain Institute Inc. (Hayward, CA, USA). Dulbecco’s modified Eagle’s… … 
    Ref. Link
  • David A. Taylor-Fishwick, Angela Bowman, MariCarmen Korngiebel-Rosique, and Aaron I. Vinik 
    Pancreatic Islet Immunoreactivity to the Reg Protein INGAP
    J. Histochem. Cytochem., Feb 2008; 56: 183 – 191.
    … …Committee, Eastern Virginia Medical School. Immunohistochemistry Monkey, human, and rat pancreas sections were supplied by Biochain (Hayward, CA). Harvested mouse pancreata were fixed in 10% formalin (Fisher Chemicals Fair Lawn, NJ) and paraffin embedded… … 
    Ref. link 
  • Jascha-N. Rybak, Christoph Roesli, Manuela Kaspar, Alessandra Villa, and Dario Neri 
    The Extra-domain A of Fibronectin Is a Vascular Marker of Solid Tumors and Metastases
    Cancer Res., Nov 2007; 67: 10948 – 10957.
    … …of freshly frozen tissue specimens. In many cases, freshly frozen tissue sections in microarray format were obtained from BioChain. To verify successful in vivo biotinylation, staining of biotinylated structures was done as described in ref. (15) using streptavidin… …
    Ref. link 
  • Mingyan Zhou, Li Xia, and Joanne Wang 
    Metformin Transport by a Newly Cloned Proton-Stimulated Organic Cation Transporter (Plasma Membrane Monoamine Transporter) Expressed in Human Intestine
    Drug Metab. Dispos., Oct 2007; 35: 1956 – 1962.
    … …localization of PMAT in human small intestine, commercial slides containing human small intestine tissue were purchased from BioChain Institute Inc. (Hayward, CA). Slides were rinsed twice with PBS and fixed for 30 min at room temperature with 4% (v/v) paraformaldehyde… … 
    Ref. link 
  • Yasuna Kobayashi, Ayumi Tsuchiya, Tomofumi Hayashi, Noriko Kohyama, Masayuki Ohbayashi, and Toshinori Yamamoto 
    Isolation and Characterization of Polyspecific Mouse Organic Solute Carrier Protein 1 (mOscp1)
    Drug Metab. Dispos., Jul 2007; 35: 1239 – 1245.
    … …2005). A 5-mum wax section of mouse testis was obtained from BioChain Institute, Inc. (Hayward, CA) and sectioning was carried out…2005). A 5- m wax section of mouse testis was obtained fromBioChain Institute, Inc. (Hayward, CA) and sectioning was carried out… … 
    Ref. link 
  • Masayo Hosokawa, Akio Takehara, Koichi Matsuda, Hidetoshi Eguchi, Hiroaki Ohigashi, Osamu Ishikawa, Yasuhisa Shinomura, Kohzoh Imai, Yusuke Nakamura, and Hidewaki Nakagawa
    Oncogenic Role of KIAA0101 Interacting with Proliferating Cell Nuclear Antigen in Pancreatic Cancer
    Cancer Res., Mar 2007; 67: 2568 – 2576.
    … …Cancer and Cardiovascular Diseases under the appropriate informed consent. Sections from normal pancreas were purchased from Biochain (Hayward, CA). The sections were deparaffinized and autoclaved at 108C in DakoCytomation Target Retrieval Solution High pH… … 
    Ref. link 
  • Ke Zen, Celia X.-J. Chen, Yi-Tien Chen, Rosemarie Wilton, and Yuan Liu 
    Receptor for Advanced Glycation Endproducts Mediates Neutrophil Migration across Intestinal Epithelium
    J. Immunol., Feb 2007; 178: 2483 – 2490.
    … …coverslides followed by air-drying before immunostaining was performed. Normal human colon sections were also purchased from Biochain. A mouse monoclonal (IgG2b) and a goat polyclonal Ab against human RAGE were obtained from RD Systems. A high-titer polyclonal… … 
    Ref. link 
  • Liang-Ru Zhu, Paul E. Thomas, Gang Lu, Kenneth R. Reuhl, Guang-Yu Yang, Li-Dong Wang, Shou-Lin Wang, Chung S. Yang, Xiao-Yang He, and Jun-Yan Hong
    CYP2A13 in Human Respiratory Tissues and Lung Cancers: An Immunohistochemical Study with A New Peptide-Specific Antibody
    Drug Metab. Dispos., Oct 2006; 34: 1672 – 1676.
    … …human trachea (T2234160), bronchus (HuFPT111), and lung (containing bronchiole areas, HuPFT131 and T2234152) were obtained from Biochain Institute, Inc. (Hayward, CA) and US Biomax, Inc. (Rockville, MD). Tissue microarrays containing normal lung alveolar tissues… … 
    Ref. link 
  • Sara J. Bowne, Qin Liu, Lori S. Sullivan, Jingya Zhu, Catherine J. Spellicy, Catherine Bowes Rickman, Eric A. Pierce, and Stephen P. Daiger
    Why Do Mutations in the Ubiquitously Expressed Housekeeping Gene IMPDH1 Cause Retina-Specific Photoreceptor Degeneration?
    Invest. Ophthalmol. Vis. Sci., Sep 2006; 47: 3754 – 3765.
    … …additional human tissues was purchased from BioChain (Hayward, CA). Total RNA (20 Mg) from…peripheral blood leukocyte first-strand cDNA (BioChain) using the following primers: 5-gacgacgacaagatggccgactacctgattagtgg-3…human retinal cDNA was purchased from BioChain. Retinal transcripts were analyzed with… … 
    Ref. link 
  • Liang-Ru Zhu, Paul E. Thomas, Gang Lu, Kenneth R. Reuhl, Guang-Yu Yang, Li-Dong Wang, Shou-Lin Wang, Chung S. Yang, Xiao-Yang He, and Jun-Yan Hong
    CYP2A13 in Human Respiratory Tissues and Lung Cancers: An Immunohistochemical Study with A New Peptide-specific Antibody
    Drug Metab. Dispos., Jun 2006; 10.1124/dmd.106.011049.
    … …trachea (T2234160), bronchus (HuFPT111) and lung (containing bronchiole areas, HuPFT131 and T2234152) were obtained from BioChain Institute, Inc. (Hayward, CA)… … 
  • Masato Otsuka, Takuya Matsumoto, Riyo Morimoto, Shigeo Arioka, Hiroshi Omote, and Yoshinori Moriyama
    From the Cover: A human transporter protein that mediates the final excretion step for toxic organic cations 
    PNAS, Dec 2005; 102: 17923 – 17928. 
    … …was performed subsequently as described (12). Immunohistochemistry. Human paraffin tissue sections were obtained from BioChain. Immunohistochemical analysis was performed by the HRP-DAB method or indirect immunofluorescence microscopy as described… … 
  • Hiroki Miyazaki, Naohiko Anzai, Sophapun Ekaratanawong, Takeshi Sakata, Ho Jung Shin, Promsuk Jutabha, Taku Hirata, Xin He, Hiroshi Nonoguchi, Kimio Tomita, Yoshikatsu Kanai, and Hitoshi Endou
    Modulation of Renal Apical Organic Anion Transporter 4 Function by Two PDZ Domain–Containing Proteins
    J. Am. Soc. Nephrol., Dec 2005; 16: 3498 – 3506. 
    … …primers used for PCR amplification are shown in Table 1. Immunohistochemical Analysis We used human single-tissue slides (BioChain) for light microscopic immunohistochemical analysis, and they were treated with 10 Mg/ml primary rabbit polyclonal antibodies… … 
  • Yasuna Kobayashi, Akiko Shibusawa, Hironori Saito, Naomi Ohshiro, Masayuki Ohbayashi, Noriko Kohyama, and Toshinori Yamamoto
    Isolation and Functional Characterization of a Novel Organic Solute Carrier Protein, hOSCP1 
    J. Biol. Chem., Sep 2005; 280: 32332 – 32339. 
    … …cysteine and the 14 amino acids of the COOH terminus of hOSCP1. A 5-mum wax section of human placenta was obtained from BioChain Institute, Inc. (San Leandro, CA), and light microscopic immunohistochemical analysis was carried out using the streptavidin-biotin-horseradish… …
  • Tsukasa Kawahara, Darren Ritsick, Guangjie Cheng, and J. David Lambeth
    Point Mutations in the Proline-rich Region of p22phox Are Dominant Inhibitors of Nox1- and Nox2-dependent Reactive Oxygen Generation 
    J. Biol. Chem., Sep 2005; 280: 31859 – 31869. 
    … …Thermo Shandon Cryotome) and placed on glass microscope slides. Tissue slides of the human kidney cortex were purchased from BioChain. Nox5 cDNA was amplified by PCR of human spleen cDNA library (BD Biosciences) using a set of primers (5-GCATGGATCCACCATGAACACATCTGGAGACCCA-3… … 
  • Mindy A. Maynard, Andrew J. Evans, Tomoko Hosomi, Shuntaro Hara, Michael A. S. Jewett, and Michael Ohh
    Human HIF-34 is a dominant-negative regulator of HIF-1 and is down-regulated in renal cell carcinoma
    FASEB J, Sep 2005; 19: 1396 – 1406. 
    … …based on the predicted HIF-3a4 cDNA (accession no. BC026308), and PCR was performed using human cerebellum cDNA library (BioChain Institute, San Leandro, CA, USA). The amplified fragment was cloned into pGEM-T Easy vector (Promega, Madison, WI, USA… … 
  • Masanori Onda, Mark Willingham, Satoshi Nagata, Tapan K. Bera, Richard Beers, Mitchell Ho, Raffit Hassan, Robert J. Kreitman, and Ira Pastan
    New Monoclonal Antibodies to Mesothelin Useful for Immunohistochemistry, Fluorescence-Activated Cell Sorting, Western Blotting, and ELISA 
    Clin. Cancer Res., Aug 2005; 11: 5840 – 5846. 
    … …peroxidase immunohistochemical results are shown. Paraffin-embedded tissue sections (as shown in Table 2) were obtained from BioChain Institute (Hayward, CA) and treated with a citraconic anhydride antigen retrieval procedure (23). The complete results… … 
  • Akira Togashi, Toyomasa Katagiri, Shingo Ashida, Tomoaki Fujioka, Osamu Maruyama, Yoshiaki Wakumoto, Yoshiro Sakamoto, Makoto Fujime, Yoshio Kawachi, Taro Shuin, and Yusuke Nakamura
    Hypoxia-Inducible Protein 2 (HIG2), a Novel Diagnostic Marker for Renal Cell Carcinoma and Potential Target for Molecular Therapy 
    Cancer Res., Jun 2005; 65: 4817 – 4826. 
    … …Paraffin-embedded specimens of normal human tissues (heart, liver, lung, adult kidney, fetal kidney, prostate, pancreas, spinal cord; BioChain, Hayward, CA) were treated with xylene and ethanol to remove the paraffin. We used ENVISION+ Kit/HRP (DakoCytomation, Kyoto… … 
  • Tetsuo Mashima, Tomoko Oh-hara, Shigeo Sato, Mikiko Mochizuki, Yoshikazu Sugimoto, Kanami Yamazaki, Jun-ichi Hamada, Mitsuhiro Tada, Tetsuya Moriuchi, Yuichi Ishikawa, Yo Kato, Hiroshi Tomoda, Takao Yamori, and Takashi Tsuruo
    p53-Defective Tumors With a Functional Apoptosome-Mediated Pathway: A New Therapeutic Target 
    J Natl Cancer Inst, May 2005; 97: 765 – 777. 
    … …METHODS Materials Normal cell lysates were prepared from tissues obtained during surgical resection or purchased from BioChain Institute, Inc. (San Leandro, CA). Written informed consent was obtained from those patients (or their guardians) whose… … 
  • Keisuke Taniuchi, Hidewaki Nakagawa, Masayo Hosokawa, Toru Nakamura, Hidetoshi Eguchi, Hiroaki Ohigashi, Osamu Ishikawa, Toyomasa Katagiri, and Yusuke Nakamura
    Overexpressed P-Cadherin/CDH3 Promotes Motility of Pancreatic Cancer Cells by Interacting with p120ctn and Activating Rho-Family GTPases
    Cancer Res., Apr 2005; 65: 3092 – 3099. 
    … …Cardiovascular Diseases under the appropriate rules for informed consent. Tissue sections from normal pancreas were purchased from BioChain (Hayward, CA). Tissue-microarray sections of pancreatic carcinomas (AccuMax Array) were purchased from Petagene Inc. (Seoul… … 
  • Keisuke Taniuchi, Hidewaki Nakagawa, Toru Nakamura, Hidetoshi Eguchi, Hiroaki Ohigashi, Osamu Ishikawa, Toyomasa Katagiri, and Yusuke Nakamura
    Down-regulation of RAB6KIFL/KIF20A, a Kinesin Involved with Membrane Trafficking of Discs Large Homologue 5, Can Attenuate Growth of Pancreatic Cancer Cell
     Cancer Res., Jan 2005; 65: 105 – 112.
     … Tissue sections from normal pancreas were purchased from Biochain (Hayward, CA). … 
  • F. Duprat, C. Girard, G. Jarretou, and M. Lazdunski
    Pancreatic two P domain K+ channels TALK-1 and TALK-2 are activated by nitric oxide and reactive oxygen species
     J. Physiol., Jan 2005; 562: 235 – 244.
     … In situ hybridization experiments were performed on adult human pancreas paraffin-embedded slices purchased from BioChain (Hayward, CA, USA). …  
  • Pierfrancesco Tassone, Victor S. Goldmacher, Paola Neri, Antonella Gozzini, Masood A. Shammas, Kathleen R. Whiteman, Linda L. Hylander-Gans, Daniel R. Carrasco, Teru Hideshima, Reshma Shringarpure, Jialan Shi, Charles K. Allam, John Wijdenes, Salvatore Venuta, Nikhil C. Munshi, and Kenneth C. Anderson
    Cytotoxic activity of the maytansinoid immunoconjugate B-B4–DM1 against CD138+ multiple myeloma cells
     Blood, Dec 2004; 104: 3688 – 3696.
     … Immunolocalization of B-B4 in human normal tissues Frozen section Paraffin (1 st sample Biochain, 2 nd Zymed) Tissue No. cases Intensity * cell type or structure No. cases Intensity …
  • Marina Bibikova, Joanne M. Yeakley, Eugene Chudin, Jing Chen, Eliza Wickham, Jessica Wang-Rodriguez, and Jian-Bing Fan
    Gene Expression Profiles in Formalin-Fixed, Paraffin-Embedded Tissues Obtained with a Novel Assay for Microarray Analysis
     Clin. Chem., Dec 2004; 50: 2384 – 2386.
     … samples, we prepared RNA from 5-{mu}m human tissue sections mounted on microscope slides, obtained from BioChain Institute according to an Institutional Review Board-approved protocol. … 
  • Mark Powzaniuk, Sheila McElwee-Witmer, Robert L. Vogel, Tadashi Hayami, Su Jane Rutledge, Fang Chen, Shun-ichi Harada, Azriel Schmidt, Gideon A. Rodan, Leonard P. Freedman, and Chang Bai
    The LATS2/KPM Tumor Suppressor Is a Negative Regulator of the Androgen Receptor
     Mol. Endocrinol., Aug 2004; 18: 2011 – 2023.
     … Paraffin-embedded tissue sections were from BioChain Institute (Hayward, CA). …
     … Immunohistochemisty For detection of LATS2, paraffin-embedded tissue sections (BioChain Institute) were deparaffinized in xylene, hydrated in graded ethanol, and treated with Dako target retrieval …
  • MEMBRANE TRANSPORT, STRUCTURE, FUNCTION, AND BIOGENESIS:
    Naohiko Anzai, Hiroki Miyazaki, Rie Noshiro, Suparat Khamdang, Arthit Chairoungdua, Ho-Jung Shin, Atsushi Enomoto, Shinichi Sakamoto, Taku Hirata, Kimio Tomita, Yoshikatsu Kanai, and Hitoshi Endou
    The multivalent PDZ domain-containing protein PDZK1 regulates transport activity of renal urate-anion exchanger URAT1 via its C-terminal
     J. Biol. Chem., Oct 2004; 279: 45942 – 45950.
     … We used human single-tissue slides (Biochain) for light microscopic immunohistochemical analysis using the streptavidin-biotin-HRP complex technique (LSAB kit; DAKO, Carpinteria, CA). …
     … For the coimmunoprecipitation of endogenous URAT1 and PDZK1, we used human kidney membrane fractions (Biochain) and added 13 anti-PDZK1 antibody or control IgG to this solution. …
  • Pierfrancesco Tassone, Victor S Goldmacher, Paola Neri, Antonella Gozzini, Masood A Shammas, Kathleen R Whiteman, Linda Hylander, Daniel R Carrasco, Teru Hideshima, Reshma Shringarpure, Jialan Shi, Charles K Allam, John Wijdenes, Salvatore Venuta, Nikhil C Munshi, and Kenneth C Anderson
    Cytotoxic activity of the maytansinoid immunoconjugate B-B4-DM1 against CD138+ Multiple Myeloma cells
     Blood, Aug 2004; 10.1182/blood-2004-03-0963.
     … 7 Immunohistochemistry Paraffin multi-tissue arrays were purchased from Biochain Institute (Cat. …
     … I: reactivity of mb B-B4 on human tissues Tissue FROZEN SECTION PARAFFIN (1 st sample Biochain, 2 nd Zymed) No. cases Intensity*/Cell type or structure No. cases Intensity*/Cell type or structure … 
  • Kazuishi Kubota, Kaori Nakahara, Toshiaki Ohtsuka, Shuku Yoshida, Junko Kawaguchi, Yoko Fujita, Yohei Ozeki, Ayako Hara, Chigusa Yoshimura, Hidehiko Furukawa, Hideyuki Haruyama, Kimihisa Ichikawa, Makoto Yamashita, Tatsuji Matsuoka, and Yasuteru Iijima
    Identification of 2′-phosphodiesterase, which plays a role in the 2-5A system regulated by interferon
     J. Biol. Chem., Jun 2004; 10.1074/jbc.M400089200.
     … 21 kidney and fetal liver were purchased from Clontech, and human adult colon was from BioChainInstitute. …
  • Tomoaki Tanaka, Edward T. H. Yeh, and Tetsu Kamitani
    NUB1-mediated targeting of the ubiquitin precursor UbC1 for its C-terminal hydrolysis
    Eur. J. Biochem., Mar 2004; 271: 972 – 982.  
    … In situ hybridization Paraffin-embedded tissue sections (thickness, 5{micro}m) of human adult testis were purchased from BIOCHAIN (Hayward, CA, USA). … 
  • Ryoko Iizuka, Katsuyoshi Chiba, and Shinobu Imajoh-Ohmi
    A Novel Approach for the Detection of Proteolytically Activated Transglutaminase 1 in Epidermis Using Cleavage Site-Directed Antibodies
     J. Invest. Dermatol., Sep 2003; 121: 457 – 464.
     … Immunofluorescence analysis Frozen sections of normal human skin (BioChain Institute, Inc., Hayward, California), monolayer-cultured keratinocytes on collagen-coated cover glasses, and frozen sections of three-dimensional …
     … In situ TGase assays Frozen sections of normal human skin (BioChain Institute, Hayward, CA) were rinsed with 1% (w v) BSA in Tris-buffered saline, and incubated …
  • Daisuke Kobayashi, Takashi Nozawa, Kozue Imai, Jun-ichi Nezu, Akira Tsuji, and Ikumi Tamai
    Involvement of Human Organic Anion Transporting Polypeptide OATP-B (SLC21A9) in pH-Dependent Transport across Intestinal Apical Membrane
     J. Pharmacol. Exp. Ther., Aug 2003; 306: 703 – 708.
     … Human adult normal small intestinal tissue slides were purchased from Biochain Institute, Inc. …
  • Daisuke Kobayashi, Takashi Nozawa, Kozue Imai, Jun-ichi Nezu, Akira Tsuji, and Ikumi Tamai
    Involvement of Human Organic Anion Transporting Polypeptide OATP-B (SLC21A9) in pH-Dependent Transport across Intestinal Apical Membrane
    J. Pharmacol. Exp. Ther., Apr 2003; 103051300.
     … Human adult normal small intestinal tissue slides were purchased from Biochain Institute, Inc. …
  • Takehiko Ogura, Tetsushi Furukawa, Tetsuya Toyozaki, Katsuya Yamada, Ya-Juan Zheng, Yoshifumi Katayama, Haruaki Nakaya, and Nobuya Inagaki
    ClC-3B, a novel ClC-3 splicing variant that interacts with EBP50 and facilitates expression of CFTR-regulated ORCC
    FASEB J, Apr 2002; 108451.
     … Immunohistochemistry Ready-to-use tissue section slides of various human tissues (Biochain, Hayward, CA) were incubated with an anti-human ClC-3B antibody (1:200) at 4?C in a moist …
  • Hisayuki Nomiyama, Kunio Hieshima, Takashi Nakayama, Tomonori Sakaguchi, Ryuichi Fujisawa, Sumio Tanase, Hiroshi Nishiura, Kenjiro Matsuno, Hiroshi Takamori, Youichi Tabira, Tetsuro Yamamoto, Retsu Miura, and Osamu Yoshie
    Human CC chemokine liver-expressed chemokine/CCL16 is a functional ligand for CCR1, CCR2 and CCR5, and constitutively expressed by hepatocytes
    Int. Immunol., Aug 2001; 13: 1021 – 1029. 
     … Paraffin sections of formaldehyde-fixed normal human liver obtained from Biochain Institute (San Leandro, CA) were also dewaxed and rehydrated. …

Tissue Arrayx

  • Silencing of Ghrelin Receptor Expression Inhibits Endometrial Cancer Cell Growth in vitro and in vivo
    Jenny N T Fung, Penny L Jeffery, John D Lee, Inge Seim, Deborah Roche, Andreas Obermair, Lisa K Chopin, Chen Chen
    Am. J. Physiol. Endocrinol. Metab. (4.7), 2013-06-04, , 
    … 99 100 Page 5. Endometrial Tissue Microarray (TMA) 101 Human endometrial cancer tissue microarrays were purchased fromBioChain (Hayward, CA). 102 This array consisted of pathologist-verified tissue samples from 5 normal endometrial tissues 103 …
  • Raising antibodies against circulating foetal cells from maternal peripheral blood
    Morten Draeby Sørensen, Connie Jenning Melchjorsen, Ole Aalund Mandrup, Peter Kristensen
    Prenat. Diagn. (2.2), 2013-03-04, 33, 284-91
    … Immunocytochemical staining of paraffin-embedded tissues. Paraffin embedded tissue arrays, “Human Fetal Normal Tissue Array IV” or “Human Adult and Fetal Normal Tissue, Array II” from BioChain (BioChain Institute, CA, USA) was applied. …
  • Vav1 fine tunes p53 control of apoptosis versus proliferation in breast cancer
    Shulamit Sebban, Marganit Farago, Dan Gashai, Lena Ilan, Eli Pikarsky, Ittai Ben-Porath, Shulamit Katzav
    PLoS ONE (4.4), 2013-01-23, 8, e54321
    … Materials and Methods. Human Breast Tissue Array. Human breast paraffin tissue array (http://www.BioChain.com/BioChain/datasheet/Z7020004-B410017.pdf) was purchased (BioChain, CA, USA) and treated according to manufacturer’s instructions. Immunohistochemistry. …
  • Protein expression pattern of human MIER1 alpha, a novel estrogen receptor binding protein
    Patti L McCarthy, Gary D Paterno, Laura L Gillespie
    J. Mol. Histol. (1.2), 2013-01-01, , 
    … For the current study, we used purified anti-MIER1α IgG and negative controls included sections stained with pre-immune IgG. Paraffin sections of human adult tissues were purchased from BioChain Institute, Inc. … and tissue microarrays were from BioChain. …
  • Maintenance of S-nitrosothiol homeostasis plays an important role in growth suppression of estrogen receptor-positive breast tumors
    Amanda Cañas, Laura M López-Sánchez, Araceli Valverde-Estepa, Vanessa Hernández, Elena Fuentes, Juan R Muñoz-Castañeda, Chary López-Pedrera, Juan R De La Haba-Rodríguez, Enrique Aranda, Antonio Rodríguez-Ariza
    Breast Cancer Res. (5.8), 2012-12-05, 14, R153
    … samples were from a paraffin tissue array of breast tumors provided by BioChain (Newark, CA, USA). … Immunohistochemical analyses Immunohistochemical analyses were performed in a par- affin tissue array of breast tumors (BioChain, Newark, CA, USA). … 
  • Modulation of endoplasmic reticulum calcium pump expression during lung cancer cell differentiation
    Atousa Arbabian, Jean-Philippe Brouland, Agota Apáti, Katalin Pászty, Luca Hegedűs, Agnes Enyedi, Christine Chomienne, Béla Papp
    FEBS J. (3.1), 2012-11-15, , 
    … Formalin fixed paraffin embedded lung cancer tissue microarray slides were purchased from BioChain Institute, Hayward, CA, USA (T8235724, T8235732, Z7020066, Z7020067; CliniSciences, Montrouge, France), and from US Biomax, Rockville, MD, USA (BC04015 … 
  • Subunit isoform selectivity in assembly of Na,K-ATPase α-β heterodimers
    Elmira Tokhtaeva, Rebecca J Clifford, Jack H Kaplan, George Sachs, Olga Vagin
    J. Biol. Chem. (5.3), 2012-07-27, 287, 26115-25
    … for 5 min. Fixed cells or frozen tissue sections on FDA standard frozen tissue rat or human arrays (BioChain) were incubated with Dako protein block serum-free solution (Dako Corp.) for 30 min. Immunostaining was performed …
  • Identification of anaplastic lymphoma kinase as a potential therapeutic target in ovarian cancer
    Hong Ren, Zhi-Ping Tan, Xin Zhu, Katherine Crosby, Herbert Haack, Jian-Min Ren, Sean Beausoleil, Albrecht Moritz, Gregory Innocenti, John Rush, Yi Zhang, Xin-Min Zhou, Ting-Lei Gu, Yi-Feng Yang, Michael J Comb
    Cancer Res. (8.2), 2012-07-01, 72, 3312-23
    … General pathologic information of the 69 ovarian tumor patients is listed in Supplementary Table S1. FFPE ovarian tumor tissue microarray (TMA) slides were purchased from Folio Biosciences and BioChain Institute, Inc. Cell lines and antibodies. …
  • Specificity and prognostic validation of a polyclonal antibody to detect Six1 homeoprotein in ovarian cancer
    Lubna Qamar, Erin Deitsch, Aaron N Patrick, Miriam D Post, Monique A Spillman, Ritsuko Iwanaga, Andrew Thorburn, Heide L Ford, Kian Behbakht
    Gynecol. Oncol. (3.8), 2012-05-09, 125, 451-7
    … Ovarian tissue microarrays (OTMA) were obtained from the BioChain Institute (OTMA1, Catalog #T8235725-5, lot #A912112 and OTMA2, Catalog# Z7020086, www.BioChain.com, Hayward, CA, USA). … Specimen key is available at www.BioChain.com, catalog #T823575-5. … 
  • Loss of 5-hydroxymethylcytosine is accompanied with malignant cellular transformation
    Yotaro Kudo, Keisuke Tateishi, Keisuke Yamamoto, Shinzo Yamamoto, Yoshinari Asaoka, Hideaki Ijichi, Genta Nagae, Haruhiko Yoshida, Hiroyuki Aburatani, Kazuhiko Koike
    Cancer Sci. (3.8), 2012-04-28, 103, 670-6
    … with the Guide for the Care and Use of Laboratory Animals. A frozen acetone-fixed tumor and normal tissue arrays were purchased from BioChain (Hayward, CA, USA). Slides were treated with 2 M hydrochloric acid followed by …
  • Jieqiong Liu, Shan Liao, Yuhui Huang, Rekha Samuel, Tony Shi, Kamila Naxerova, Peigen Huang, Walid Kamoun, Rakesh K. Jain, Dai Fukumura, and Lei Xu
    PDGF-D Improves Drug Delivery and Efficacy via Vascular Normalization, But Promotes Lymphatic Metastasis by Activating CXCR4 in Breast Cancer
     Clin. Cancer Res., Jun 2011; 17: 3638 – 3648.
     … …puromycin. Immunohistochemistry Tissue microarray slides (Biochain) was immunostained with anti-PDGF-D antibody (1:200, RD Systems…hyperplasia sections, and 6 normal human mammary gland sections (BioChain; Supplementary Table S1). Using immunohistochemical (IHC) staining… … 
    Ref. link
  • Yoshihiro Inami, Satoshi Waguri, Ayako Sakamoto, Tsuguka Kouno, Kazuto Nakada, Okio Hino, Sumio Watanabe, Jin Ando, Manabu Iwadate, Masayuki Yamamoto, Myung-Shik Lee, Keiji Tanaka, and Masaaki Komatsu
    Persistent activation of Nrf2 through p62 in hepatocellular carcinoma cells
     J. Cell Biol., Apr 2011; 193: 275 – 284.
     … …Human tissue samples Glass slides with tissue array of various liver diseases were purchased from Shanghai Outdo Biotech Co.; Biochain Institute, Inc.; and Biomax, Inc. Frozen tissues and the corresponding mRNAs were purchased from Shanghai Outdo Biotech Co… … 
    Ref. link
  • Kotb Abdelmohsen, Emmette R. Hutchison, Eun Kyung Lee, Yuki Kuwano, Mihee M. Kim, Kiyoshi Masuda, Subramanya Srikantan, Sarah S. Subaran, Bernard S. Marasa, Mark P. Mattson, and Myriam Gorospe
    miR-375 Inhibits Differentiation of Neurites by Lowering HuD Levels
     Mol. Cell. Biol., Sep 2010; 30: 4197 – 4210. 
     … …Biosciences) with miR-375- and U1 snRNA-specific forward primers (Table 1). Immunohistochemistry. Human tissue slides (Array II; BioChain Institute, Inc., Hayward, CA, and Pantomics, Inc.) were subjected to heat-induced epitope retrieval, incubation with primary… … 
    Ref. link
  • Binnur Eroglu, Demetrius Moskophidis, and Nahid F. Mivechi
    Loss of Hsp110 Leads to Age-dependent Tau Hyperphosphorylation and Early Accumulation of Insoluble Amyloid-beta
     Mol. Cell. Biol., Aug 2010; 10.1128/MCB.01493-09. 
     … …of Hsp110 and A in healthy and Alzheimer’s brain tissue. (A) Paraffin-embedded human tissue sections of Alzheimer’s brain (Biochain) (hippocampal region) were immunostained using primary antibodies to Hsp110, and A, and Cy3 or FITC fluorescent conjugated… … 
    Ref. link
  • Shivani Nautiyal, Victoria E. H. Carlton, Yontao Lu, James S. Ireland, Diane Flaucher, Martin Moorhead, Joe W. Gray, Paul Spellman, Michael Mindrinos, Paul Berg, and Malek Faham
    High-throughput method for analyzing methylation of CpGs in targeted genomic regions
     PNAS, Jul 2010; 107: 12587 – 12592.
     … …Repositories; American Type Culture Collection; J.W.G.’s laboratory), 37 for normal tissue samples (BioChain), and 76 for tumor tissue samples (BioChain). Generation of DNA for Calibration Standards. Unmethylated DNA was prepared by whole-genome amplification… … 
    Ref. link
  • David Sgier, Kathrin Zuberbuehler, Stefanie Pfaffen, and Dario Neri
    Isolation and characterization of an inhibitory human monoclonal antibody specific to the urokinase-type plasminogen activator, uPA
    Protein Eng. Des. Sel., Apr 2010; 23: 261 – 269. 
    … …Carl Zeiss AG). The cross-reactivity of IgG(DS2) with normal tissue was studied on an FDA standard panel of healthy tissue (Biochain, Hayward, CA, USA). Sections were blocked with FCS and then incubated with 10 microg ml1 of purified FITC-labeled IgG(DS2… … 
    Ref. link 
  • Shin-ichi Akaboshi, Sugiko Watanabe, Yuko Hino, Yoko Sekita, Yang Xi, Kimi Araki, Ken-ichi Yamamura, Masanobu Oshima, Takaaki Ito, Hideo Baba, and Mitsuyoshi Nakao
    HMGA1 Is Induced by Wnt/β-Catenin Pathway and Maintains Cell Proliferation in Gastric Cancer
    Am. J. Pathol., Oct 2009; 175: 1675 – 1685. 
    … …in 4% paraformaldehyde and embedded in paraffin. Histological sections were cut at 3 um. Human stomach tumor tissue arrays (BioChain Institute, Inc., Hayward, CA) or mouse tissue samples were deparaffinized, and antigens were retrieved by autoclaving at 120C… … 
    Ref. link 
  • Yi-Chun Liao, Nien-Tsu Chen, Yi-Ping Shih, Ying Dong, and Su Hao Lo
    Up-regulation of C-Terminal Tensin-like Molecule Promotes the Tumorigenicity of Colon Cancer through β-Catenin
    Cancer Res., Jun 2009; 69: 4563 – 4566. 
    … …quantified as 2(deltaC T sample deltaC T control ). Immunohistochemical staining. Colon cancer tissue arrays from Imgenex, BioChain Institute, and University of California-Davis Cancer Center Specimen Repository were deparaffinized and rehydrated. After antigen… … 
    Ref. link 
  • Sugiko Watanabe, Yasuaki Ueda, Shin-ichi Akaboshi, Yuko Hino, Yoko Sekita, and Mitsuyoshi Nakao
    HMGA2 Maintains Oncogenic RAS-Induced Epithelial-Mesenchymal Transition in Human Pancreatic Cancer Cells
    Am. J. Pathol., Mar 2009; 174: 854 – 868. 
    … …was used as a control. Immunohistochemistry Immunohistochemistry was performed with human pancreas tumor tissue array I (BioChain Institute, Inc., Hayward, CA). The array slides were deparaffinized, and antigens were retrieved by autoclaved heating at 120C… …
    Ref. link 
  • Lifeng Liu, Ko Ishihara, Takaya Ichimura, Naoyuki Fujita, Shinjiro Hino, Saori Tomita, Sugiko Watanabe, Noriko Saitoh, Takaaki Ito, and Mitsuyoshi Nakao
    MCAF1/AM is involved in Sp1-mediated maintenance of cancer-associated telomerase activity
    J. Biol. Chem., Feb 2009; 284: 5165 – 5174. 
    … …Immunohistochemistry was performed with human Tumor Tissue Arrays including stomach, breast and lung tumors, and various normal tissues (BioChain Institute, Inc. and ISU Abxis Co., Ltd). The array slides were deparaffinized and then incubated in methanol with 0.3% hydrogen… … 
    Ref. link 
  • Karina Dalsgaard Sørensen, Peter Johannes Wild, Ashkan Mortezavi, Katja Adolf, Niels Tørring, Sara Heebøll, Benedicte Parm Ulhøi, Peter Ottosen, Tullio Sulser, Thomas Hermanns, Holger Moch, Michael Borre, Torben Falck Ørntoft, and Lars Dyrskjøt
    Genetic and Epigenetic SLC18A2 Silencing in Prostate Cancer Is an Independent Adverse Predictor of Biochemical Recurrence after Radical Prostatectomy
    Clin. Cancer Res., Feb 2009; 15: 1400 – 1410. 
    … …were excluded from analysis. AB1767 antibody specificity was validated by staining of a human multitissue array (T8235713-5; BioChain Institute), which showed the expected SLC18A2 expression patterns (data not shown). Western blotting. Protein extracts from… … 
    Ref. link 
  • Tobias Stumpf, Qi Zhang, Daniela Hirnet, Urs Lewandrowski, Albert Sickmann, Ulrich Wissenbach, Janka Dörr, Christian Lohr, Joachim W. Deitmer, and Claudia Fecher-Trost
    The Human TRPV6 Channel Protein Is Associated with Cyclophilin B in Human Placenta
    J. Biol. Chem., Jun 2008; 283: 18086 – 18098. 
    … …results of an experiment, repeated at least three times (B). CypB was detected with a CypB antibody on a multi-human tissue blot (BioChain, Hayward, CA). Lanes 1, heart; 2, brain; 3, kidney; 4, liver; 5, lung; 6, pancreas; 7, spleen; 8, skeletal muscle; 9, stomach… 
    Ref. link 
  • Zhenhua Miao, Kathryn E. Luker, Bretton C. Summers, Rob Berahovich, Mahaveer S. Bhojani, Alnawaz Rehemtulla, Celina G. Kleer, Jeffrey J. Essner, Aidas Nasevicius, Gary D. Luker, Maureen C. Howard, and Thomas J. Schall
    CXCR7 (RDC1) promotes breast and lung tumor growth in vivo and is expressed on tumor-associated vasculature 
    PNAS, Oct 2007; 104: 15735 – 15740.
    … …different reduction mammoplasties were used. Tumor microarrays were purchased from Imgenex, Zymed/Invitrogen, Cybrdi, US Biomax, Biochain, and Petagen/Telechem. Specimens were stained with 10 mug/ml CXCR7 antibody by using conventional methods; detection was performed… … 
    Ref. link 
  • Kwang S. Suh, John M. Crutchley, Arash Koochek, Andrew Ryscavage, Kiran Bhat, Takemi Tanaka, Akira Oshima, Peter Fitzgerald, and Stuart H. Yuspa
    Reciprocal Modifications of CLIC4 in Tumor Epithelium and Stroma Mark Malignant Progression of Multiple Human Cancers 
    Clin. Cancer Res., Jan 2007; 13: 121 – 131. 
    … …matched human tumor tissue arrays (Imgenex, San Diego, CA), Food and Drug Administration-standard normal and tumor tissue arrays (Biochain, Hayward, CA) and human cancer screen tissue arrays (Clinomics), prostate tumor arrays (Baylor Specialized Programs of Research… … 
    Ref. link 
  • Ke Guo, Jie Li, Haihe Wang, Motomi Osato, Jing Ping Tang, Samantha Yiling Quah, Bin Qi Gan, and Qi Zeng
    PRL-3 Initiates Tumor Angiogenesis by Recruiting Endothelial Cells In vitro and In vivo 
    Drug Metab. Dispos., Oct 2006; 34: 1672 – 1676.
    … …in rat fetal and adult hearts, in human adult heart, in blood vessels using normal and colorectal cancer arrays T8235790D (BioChain Institute, Inc., Hayward, CA) and TS-4205-05 and TS42050903 (BioGenex, San Ramon, CA), and in normal human bone marrow tissues… … 
    Ref. link 
  • Ulrike Fiedler, Sven Christian, Stefanie Koidl, Dontscho Kerjaschki, Maxine S. Emmett, David O. Bates, Gerhard Christofori, and Hellmut G. Augustin
    The Sialomucin CD34 Is a Marker of Lymphatic Endothelial Cells in Human Tumors
    Am. J. Pathol., Mar 2006; 168: 1045 – 1053. 
    … …were fixed at the time of excision and embedded in paraffin. 7-11 Tissue arrays of normal tissue were purchased form BioChain (Hayward, CA) and the tumor tissue arrays from BioCat GmbH (Heidelberg, Germany). Composite double-transgenic mice (Rip1Tag2… 
  • Oksana Akhova, Matthew Bainbridge, and Vikram Misra
    The Neuronal Host Cell Factor-Binding Protein Zhangfei Inhibits Herpes Simplex Virus Replication
    J. Virol., Dec 2005; 79: 14708 – 14718. 
    … …Triton X-100. Immunohistochemistry of human cervical dorsal-root ganglion (provided by Anurag Saxena) or tissue arrays (BioChain, catalog no. T8235712-2) was performed on 5-Mm paraffin-embedded sections. The sections were dewaxed in CitriSolv (Fisher… … 
  • Jie Li, Ke Guo, Vicki Wei Chyi Koh, Jing Ping Tang, Bin Qi Gan, Hong Shi, Hui Xiang Li, and Qi Zeng
    Generation of PRL-3- and PRL-1-Specific Monoclonal Antibodies as Potential Diagnostic Markers for Cancer Metastases
     Clin. Cancer Res., Mar 2005; 11: 2195 – 2204.
     … We investigated PRL-3 expression on human colorectal cancer tissue arrays T8235790D (BioChainInstitute, Inc., Hayward, CA), TS-4205-05, and TS43050702 (BioGenex, San Ramon, CA). … 
  • Tetsuya Nakatsura, Hiroyuki Komori, Tatsuko Kubo, Yoshihiro Yoshitake, Satoru Senju, Toyomasa Katagiri, Yoichi Furukawa, Michio Ogawa, Yusuke Nakamura, and Yasuharu Nishimura
    Mouse Homologue of a Novel Human Oncofetal Antigen, Glypican-3, Evokes T-Cell–Mediated Tumor Rejection without Autoimmune Reactions in Mice
     Clin. Cancer Res., Dec 2004; 10: 8630 – 8640.
     … Cancers, Tissue Array, BC4 (SuperBioChips Laboratories, Seoul, Korea) and Human Fetal Normal Multi Tissue Slide (BioChain, Hayward, CA) for immunohistochemical analysis. …
  • Pierfrancesco Tassone, Victor S. Goldmacher, Paola Neri, Antonella Gozzini, Masood A. Shammas, Kathleen R. Whiteman, Linda L. Hylander-Gans, Daniel R. Carrasco, Teru Hideshima, Reshma Shringarpure, Jialan Shi, Charles K. Allam, John Wijdenes, Salvatore Venuta, Nikhil C. Munshi, and Kenneth C. Anderson
    Cytotoxic activity of the maytansinoid immunoconjugate B-B4–DM1 against CD138+ multiple myeloma cells
     Blood, Dec 2004; 104: 3688 – 3696.
     … Immunohistochemistry Paraffin multitissue arrays were purchased from Biochain Institute (catalog no. …

Genomic DNAx

  • Quantitative methylation analysis of HOXA3, 7, 9, and 10 genes in glioma: association with tumor WHO grade and clinical outcome
    Angela Di Vinci, Ida Casciano, Elena Marasco, Barbara Banelli, Gian Luigi Ravetti, Luana Borzì, Claudio Brigati, Alessandra Forlani, Alessandra Dorcaratto, Giorgio Allemanni, Gianluigi Zona, Renato Spaziante, Henning Gohlke, Giovanni Gardin, Domenico Franco Merlo, Vilma Mantovani, Massimo Romani
    J. Cancer Res. Clin. Oncol. (2.5), 2012-01-02, 138, 35-47
    … 36 J Cancer Res Clin Oncol (2012) 138:35–47 123 Page 3. Total human brain DNA (BioChain Institute, Inc., Hayward, CA, USA) and normal human astrocytes (NHA) DNA (ScienceCell, Carlsbad CA, USA) were utilized as non-tumoral methylation controls. … 
  • CCL3L1 gene copy number in individuals with and without HIV-associated neurocognitive disorder
    Amanda Brown, Ned Sacktor, Karen Marder, Bruce Cohen, Giovanni Schifitto, Richard L Skolasky, Jason Creighton, Liping Guo, Justin C McArthur
    Curr Biomark Find 0, 2012-01-01, 2012, 1-6
    … Serial dilutions of genomic DNA from A431 cells (25–1.56 ng, BioChain Institute Inc, Hayward, CA), which have been shown to have two copies of CCL3L1 per diploid genome were used to generate standard curves of the threshold cycle (Ct) against the log [DNA] for each 96 …
  • Identifying RNA editing sites using RNA sequencing data alone
    Gokul Ramaswami, Rui Zhang, Robert Piskol, Liam P Keegan, Patricia Deng, Mary A O’Connell, Jin Billy Li
    Nat. Methods (20.7), 2013-01-30, 10, 128-32
    … Samples 1 and 2 were from the same individual (a 26-year-old male), and gDNA from the frontal lobe of the same individual was also obtained (all from BioChain Institute). … We obtained cDNA and gDNA from the cerebellum of a 26-year-old human male (BioChain Institute). …
  • LGR5 is a marker of poor prognosis in glioblastoma and is required for survival of brain cancer stem-like cells
    Susumu Nakata, Benito Campos, Josephine Bageritz, Justo Lorenzo Bermejo, Natalia Becker, Felix Engel, Till Acker, Stefan Momma, Christel Herold-Mende, Peter Lichter, Bernhard Radlwimmer, Violaine Goidts
    Brain Pathol. (4.7), 2013-01-10, 23, 60-72
    … standards. All primers were tested to exclude amplification from genomic DNA. Pooled total normal brain extract from five adult donors were purchased (BioChain Institute, Inc., Hayward, CA, USA) and used as control. The relative …
  • The epigenetic effects of a high prenatal folate intake in male mouse fetuses exposed in utero to arsenic
    Verne Tsang, Rebecca C Fry, Mihai D Niculescu, Julia E Rager, Jesse Saunders, David S Paul, Steven H Zeisel, Michael P Waalkes, Miroslav Stýblo, Zuzana Drobná
    Toxicol. Appl. Pharmacol. (4), 2012-11-01, 264, 439-50
    … 16 k CpG-island microarrays (Agilent). Each treatment group was hybridized against universal control (genomic DNA isolated from the mouse liver) purchased from BioChain (Hayward, CA). Arrays were washed then scanned …
  • Identification of microRNAs changed in the neonatal lungs in response to hyperoxia exposure
    Manoj Bhaskaran, Dong Xi, Yang Wang, Chaoqun Huang, Telugu Narasaraju, Weiqun Shu, Chunling Zhao, Xiao Xiao, Sunil More, Melanie Breshears, Lin Liu
    Physiol. Genomics (3.4), 2012-10-17, 44, 970-80
    … Table 2. Primers for mRNA quantification by real-time PCR. 3′-UTR reporter assay. 3′-UTR encompassing two putative miR-150 binding sites of GPNMB was amplified from rat lung genomic DNA (BioChain Institute). The PCR …
  • Genome-wide analysis of DNA methylation identifies novel cancer-related genes in hepatocellular carcinoma
    Masahiro Shitani, Shigeru Sasaki, Noriyuki Akutsu, Hideyasu Takagi, Hiromu Suzuki, Masanori Nojima, Hiroyuki Yamamoto, Takashi Tokino, Koichi Hirata, Kohzoh Imai, Minoru Toyota, Yasuhisa Shinomura
    Tumour Biol. (2), 2012-10-11, 33, 1307-17
    … Total RNA was extracted using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) and then treated with a DNA-free kit (Ambion, Austin, TX, USA). Genomic DNA and total RNA from normal liver tissue from a healthy individual were purchased fromBioChain (Hayward, CA, USA). …
  • Adenoviral delivery of the EMX2 gene suppresses growth in human gastric cancer
    Jie Li, Minli Mo, Zhao Chen, Zhe Chen, Qing Sheng, Hang Mu, Fang Zhang, Yi Zhang, Xiu-Yi Zhi, Hui Li, Biao He, Hai-Meng Zhou
    PLoS ONE (4.4), 2012-10-02, 7, e45970
    … Medical University in Beijing. Total RNA and genomic DNA extracted from human adult normal gastric tissues were purchased from BioChain (Hayward, CA, USA). DNA Constructs. Topflash/Fopflash reporters containing wild …
  • Donor-dependent variations in hepatic differentiation from human-induced pluripotent stem cells
    Masatoshi Kajiwara, Takashi Aoi, Keisuke Okita, Ryosuke Takahashi, Haruhisa Inoue, Naoya Takayama, Hiroshi Endo, Koji Eto, Junya Toguchida, Shinji Uemoto, Shinya Yamanaka
    Proc. Natl. Acad. Sci. U.S.A. (9.8), 2012-07-31, 109, 12538-43
    … Pyrosequencing analysis was performed by the PyroMarkQ96 ID system (QIAGEN) according to standard procedures. Genomic DNA of human heart, liver, and brain was purchased from BioChain. The primer sequences used are shown in Table S4. Additional Methods. …
  • Molecular trajectories leading to the alternative fates of duplicate genes
    Michael Marotta, Helen Piontkivska, Hisashi Tanaka
    PLoS ONE (4.4), 2012-06-21, 7, e38958
    … Primary fibroblasts from gorillas, chimpanzees and humans were obtained from Coriell Institute (http://www.coriell.org/). Commercially available normal colon DNA was purchased from BioChain (www.BioChain.com). Primary …
  • TLR9 provokes inflammation in response to fetal DNA: mechanism for fetal loss in preterm birth and preeclampsia
    Andrea Scharfe-Nugent, Sinéad C Corr, Susan B Carpenter, Louise Keogh, Brendan Doyle, Cara Martin, Katherine A Fitzgerald, Sean Daly, John J O’Leary, Luke A J O’Neill
    J. Immunol. (5.7), 2012-06-01, 188, 5706-12
    … for assay. IκBα degradation. Cells were stimulated for various times with either fetal DNA (22-wk female fetus; BioChain), adult DNA (blood of a 50-y-old female; BioChain) or human CpG (Invivogen) at 1.5 μg/ml or 3 μg/ml. IκBα …
  • Genome-wide identification of OTP gene as a novel methylation marker of breast cancer
    Myung Soon Kim, Jinsun Lee, Taejeong Oh, Youngho Moon, Eilsung Chang, Kwang Sun Seo, Benjamin Douglas Hoehn, Sungwhan An, Jeung-Hoon Lee
    Oncol. Rep. (1.7), 2012-05-07, 27, 1681-8
    … Each tumor specimen was histologically verified by a board-certified pathologist and archived for further DNA study. Genomic DNA of normal tissues without any history of malignancy was purchased from BioChain, Inc. (CA, USA). …
  • Both variant and IGHV4-34-expressing hairy cell leukemia lack the BRAF V600E mutation
    Liqiang Xi, Evgeny Arons, Winnifred Navarro, Katherine R Calvo, Maryalice Stetler-Stevenson, Mark Raffeld, Robert J Kreitman
    Blood (10.6), 2012-04-05, 119, 3330-2
    … described. 8 DNA samples were extracted using a Precision System Science automated robot (PSS USA). Twenty-four commercially available normal DNA control samples (BioChain) were used to establish baseline values. For …
  • Detection of parvovirus B19 capsid proteins in testicular tissues
    Monica E Polcz, Laura A Adamson, Reva S Datar, Larry J Fowler, Jacqueline A Hobbs
    Urology (2.3), 2012-03-05, 79, 744.e9-15
    … T8234700-1) were obtained from BioChain Institute (Hayward, CA). … All ages and pathologic findings are listed in Table 1. Testicular genomic DNA (gDNA) from a 24-year-old normal man was purchased from BioChain (catalog no. D1234260). …
  • No evidence of cross-species transmission of mouse retroviruses to animal workers exposed to mice
    James Brooks, Karly Lycett-Lambert, Kyna Caminiti, Harriet Merks, Rachel McMillan, Paul Sandstrom
    Transfusion (3.3), 2012-02-13, 52, 317-25
    … Negative controls consisted of both water and 5 ng of DNA extracted from 22Rv1 cell culture (Cedarlane Labs, Burlington, Ontario, Canada). The positive control was 200 ng of genomic DNA extracted from nude mouse (NM) kidney cells (BioChainInstitute, Hayward, CA). …
  • Single-step capture and sequencing of natural DNA for detection of BRCA1 mutations
    John F Thompson, Jeffrey G Reifenberger, Eldar Giladi, Kristen Kerouac, Jaime Gill, Erik Hansen, Avak Kahvejian, Philipp Kapranov, Travis Knope, Doron Lipson, Kathleen E Steinmann, Patrice M Milos
    Genome Res. (13.6), 2012-02-03, 22, 340-5
    … on a custom basis from Helicos. DNA preparation and hybridization. HapMap genomic DNA was ordered from the Coriell Institute for Medical Research (Camden, NJ) and K562 DNA from BioChain. The DNA was sheared to …
  • A promoter DNA demethylation landscape of human hematopoietic differentiation
    Vincenzo Calvanese, Agustín F Fernández, Rocío G Urdinguio, Beatriz Suárez-Alvarez, Cristina Mangas, Vicente Pérez-García, Clara Bueno, Rosa Montes, Verónica Ramos-Mejía, Pablo Martínez-Camblor, Cecilia Ferrero, Yassen Assenov, Christoph Bock, Pablo Menendez, Ana Clara Carrera, Carlos Lopez-Larrea, Mario F Fraga
    Nucleic Acids Res. (7.8), 2012-01-27, 40, 116-31
    … Purity of all isolated cellular fractions was >95%. Hematological samples were pooled to reduce interindividual variability (n = 5). DNA from human normal primary tissues was obtained from BioChain (Hayward, CA, USA). Generation of iPSC from CD34 + CB cells. … 
  • Plasmacytoid dendritic cells infiltrate the skin in positive tuberculin skin test indurations
    Emily Bond, Frank Liang, Kerrie J Sandgren, Anna Smed-Sörensen, Peter Bergman, Susanna Brighenti, William C Adams, Senait A Betemariam, Molebogeng X Rangaka, Christoph Lange, Robert J Wilkinson, Jan Andersson, Karin Loré
    J. Invest. Dermatol. (6.3), 2012-01-14, 132, 114-23
    … Complexes were formed by co-incubation of either 10 μg ml −1 human DNA (BioChain Institute, Hayward, CA) or 5 μg ml −1 CpG ODN (class B 10103, Coley Pharmaceutical Group GmbH, Düsseldorf, Germany) with 10–50 μg ml −1 LL37 (Innovagen, Lund, Sweden) for 30 …
  • Characterization of NOL7 gene point mutations, promoter methylation, and protein expression in cervical cancer
    Colleen L Doçi, Tanmayi P Mankame, Alexander Langerman, Kelly R Ostler, Rajani Kanteti, Timothy Best, Kenan Onel, Lucy A Godley, Ravi Salgia, Mark W Lingen
    Int. J. Gynecol. Pathol. (2.1), 2012-01-14, 31, 15-24
    … Genomic DNA from cell lines was extracted using the Gentra Puregene Kit (Qiagen, Valencia, CA) per manufacturer’s instructions. Genomic DNA from normal adult cervix was obtained from BioChain Institute Incorporated (Hayward, CA). Tissue Specimens. …
  • Chester Kuei, Jingxue Yu, Jessica Zhu, Jiejun Wu, Li Zhang, Amy Shih, Taraneh Mirzadegan, Timothy Lovenberg, and Changlu Liu
    Study of GPR81, the Lactate Receptor, from Distant Species Identifies Residues and Motifs Critical for GPR81 Functions
    Mol. Pharmacol., Nov 2011; 80: 848 – 858.
    … …flanking the predicted zebrafish gpr81-related gene coding regions were designed to amplify the genes using zebrafish genomic DNA (Biochain, Hayward, CA) as the template. The resulting polymerase chain reaction products were purified and sequenced using internal… … 
    Ref. link
  • Monica Y. Lee, Sean M. Garvey, Marcia L. Ripley, and Brian R. Wamhoff
    Genome-Wide Microarray Analyses Identify the Protein C Receptor as a Novel Calcineurin/Nuclear Factor of Activated T Cells–Dependent Gene in Vascular Smooth Muscle Cell Phenotypic Modulation
    Arterioscler Thromb Vasc Biol, Nov 2011; 31: 2665 – 2675.
    … …To make this construct, 908 base pairs of the WT PROCR promoter was originally amplified from rat normal liver genomic DNA (BioChain Institute) using the PROCR-8F (5-GTGCACTTGTCCTCACAGCA) and PROCR-9R (5-AAGCTTGAGGGAAGGGTGGAAAGAGA) primers. This amplicon was… … 
    Ref. link
  • Sita Awasthi, John M. Lubinski, Carolyn E. Shaw, Shana M. Barrett, Michael Cai, Fushan Wang, Michael Betts, Susan Kingsley, Daniel J. DiStefano, John W. Balliet, Jessica A. Flynn, Danilo R. Casimiro, Janine T. Bryan, and Harvey M. Friedman
    Immunization with a Vaccine Combining Herpes Simplex Virus 2 (HSV-2) Glycoprotein C (gC) and gD Subunits Improves the Protection of Dorsal Root Ganglia in Mice and Reduces the Frequency of Recurrent Vaginal Shedding of HSV-2 DNA in Guinea Pigs Compared to Immunization with gD Alone
    J. Virol., Oct 2011; 85: 10472 – 10486. 
    … …prepared using purified HSV-2 DNA (Advanced Biotechnologies) and mouse lung genomic DNA as the source of the adipsin gene (BioChain Institute). The standard curve samples were run in triplicate wells at 50,000, 5,000, 500, 50, and 5 copies of DNA. HSV-2 DNA… … 
    Ref. link
  • Vincenzo Calvanese, Agustín F. Fernández, Rocío G. Urdinguio, Beatriz Suárez-Alvarez, Cristina Mangas, Vicente Pérez-García, Clara Bueno, Rosa Montes, Verónica Ramos-Mejía, Pablo Martínez-Camblor, Cecilia Ferrero, Yassen Assenov, Christoph Bock, Pablo Menendez, Ana Clara Carrera, Carlos Lopez-Larrea, and Mario F. Fraga
    A promoter DNA demethylation landscape of human hematopoietic differentiation
    Nucleic Acids Res., Sep 2011; 10.1093/nar/gkr685.
    … …Hematological samples were pooled to reduce interindividual variability (n5). DNA from human normal primary tissues was obtained from Biochain (Hayward, CA, USA). Generation of iPSC from CD34+ CB cells CD34+ HSCs purified from CB (1cells/ml) were pre-stimulated… … 
    Ref. link 
  • María Gutièrrez-Mecinas, Alexandra F. Trollope, Andrew Collins, Hazel Morfett, Shirley A. Hesketh, Flavie Kersanté, Johannes M. H. M. Reul, María Gutièrrez-Mecinas, Alexandra F. Trollope, Andrew Collins, Hazel Morfett, Shirley A. Hesketh, Flavie Kersanté, and Johannes M. H. M. Reul
    Long-lasting behavioral responses to stress involve a direct interaction of glucocorticoid receptors with ERK1/2–MSK1–Elk-1 signaling
    PNAS, Aug 2011; 108: 13806 – 13811.  
    … …TCTCAGTTGC- TAGCTGCAATCG). In addition to the samples a standard curve using total rat brain genomic DNA (0.02 ZZQQhy100 ng; Biochain Institute) was run in parallel. On the basis of Ct values derived from the real-time PCR amplification curves, the amount of… … 
    Ref. link
  • Devora Cohen-Karni, Derrick Xu, Lynne Apone, Alexey Fomenkov, Zhiyi Sun, Paul J. Davis, Shannon R. Morey Kinney, Megumu Yamada-Mabuchi, Shuang-yong Xu, Theodore Davis, Sriharsa Pradhan, Richard J. Roberts, and Yu Zheng
    The MspJI family of modification-dependent restriction endonucleases for epigenetic studies
    PNAS, Jul 2011; 108: 11040 – 11045.
    … …16) and enzymatically m CpG-methylated Jurkat cell DNA were obtained from NEB, and other genomic DNAs were purchased from BioChain [rabbit liver DNA (#D1834149), corn DNA (#D1634330), soy bean DNA (#D1634370)]. In the digestion series presented in Fig… … 
    Ref. link
  • Genta Nagae, Takayuki Isagawa, Nobuaki Shiraki, Takanori Fujita, Shogo Yamamoto, Shuichi Tsutsumi, Aya Nonaka, Sayaka Yoshiba, Keisuke Matsusaka, Yutaka Midorikawa, Shumpei Ishikawa, Hidenobu Soejima, Masashi Fukayama, Hirofumi Suemori, Norio Nakatsuji, Shoen Kume, and Hiroyuki Aburatani
    Tissue-specific demethylation in CpG-poor promoters during cellular differentiation
    Hum. Mol. Genet., Jul 2011; 20: 2710 – 2721. 
    … …clinical samples was extracted using the QIAamp DNA Mini Kit (QIAGEN). Genomic DNA of further individuals was purchased from BioChain (details are listed in Supplementary Material, Table S1 ). For the methylation-negative control, totally unmethylated genomic… … 
    Ref. link
  • Shannon Morey Kinney, Hang Gyeong Chin, Romualdas Vaisvila, Jurate Bitinaite, Yu Zheng, Pierre-Olivier Estève, Suhua Feng, Hume Stroud, Steven E. Jacobsen, and Sriharsa Pradhan
    Tissue-specific Distribution and Dynamic Changes of 5-Hydroxymethylcytosine in Mammalian Genomes
    J. Biol. Chem., Jul 2011; 286: 24685 – 24693. 
    … …Qiagen DNeasy Blood and Tissue kit. NIH 3T3 and HeLa cells were obtained from ATCC. DNA from human tissues was purchased from Biochain. Five g of genomic DNA (E14 and human normal brain) was digested with MspI (NEB). Digested DNA was purified with phenol chloroform… … 
    Ref. link
  • Duncan Sproul, Colm Nestor, Jayne Culley, Jacqueline H. Dickson, J. Michael Dixon, David J. Harrison, Richard R. Meehan, Andrew H. Sims, and Bernard H. Ramsahoye
    Transcriptionally repressed genes become aberrantly methylated and distinguish tumors of different lineages in breast cancer
    PNAS, Mar 2011; 108: 4364 – 4369. 
    … …Regenerative Medicine). DNA from normal breast, fetal and adult brain, testis, liver, placenta, spleen, blood, and colon were from Biochain, After approval by our ethical board, 47 fresh frozen unselected tumor samples were obtained through the Experimental Cancer… … 
    Ref. link
  • Dvir Aran, Gidon Toperoff, Michael Rosenberg, and Asaf Hellman
    Replication timing-related and gene body-specific methylation of active human genes
    Hum. Mol. Genet., Feb 2011; 20: 670 – 680. 
    … …were obtained from Dr Benjamin Glaser, Hadassah Medical Center. Other DNA samples were obtained from the Biochain Institute ( www.biochain.com ). High throughput methylation assay One microgram of genomic DNA was digested at 37C for 16 h with… …
    Ref. link
  • Hiromu Suzuki, Eiichiro Yamamoto, Masanori Nojima, Masahiro Kai, Hiro-o Yamano, Kenjiro Yoshikawa, Tomoaki Kimura, Toyoki Kudo, Eiji Harada, Tamotsu Sugai, Hiroyuki Takamaru, Takeshi Niinuma, Reo Maruyama, Hiroyuki Yamamoto, Takashi Tokino, Kohzoh Imai, Minoru Toyota, and Yasuhisa Shinomura
    Methylation-associated silencing of microRNA-34b/c in gastric cancer and its involvement in an epigenetic field defect
    Carcinogenesis, Dec 2010; 31: 2066 – 2073.
    … …kit (Ambion, Austin, TX). Genomic DNA and total RNA from normal gastric mucosa from a healthy individual were purchased from BioChain (Hayward, CA). miRNA microarray analysis miRNA expression was analyzed using a color microarray according to the manufacturers… … 
    Ref. link 
  • Natalia Teider, Deborah K. Scott, Adrianne Neiss, S. Dilhan Weeraratne, Vladimir M. Amani, Yifei Wang, Victor E. Marquez, Yoon-Jae Cho, and Scott L. Pomeroy
    Neuralized1 causes apoptosis and downregulates Notch target genes in medulloblastoma
    Neuro Oncology, Dec 2010; 12: 1244 – 1256.
    … …obtained from BD Biosciences, Ambion, Biochain, Clontech, and Stratagene; normal…33-week fetal cerebellum RNA was from Biochain. Matched samples of normal cerebellar RNA and genomic DNA were fromBiochain. Cell Culture MB cell lines UW228… … 
    Ref. link
  • Katherine Elena Varley and Robi David Mitra
    Bisulfite Patch PCR enables multiplexed sequencing of promoter methylation across cancer samples
    Genome Res., Sep 2010; 20: 1279 – 1287. 
    … …idtdna.com ). Bisulfite Patch PCR Genomic DNA from cancer and adjacent normal tissue was obtained from Biochain ( http://www.biochain.com ) for both the breast and colon . Patient information and lot numbers are listed in Supplemental Table… … 
    Ref. link
  • Leah R. Villegas, Theodore J. Kottom, and Andrew H. Limper
    Characterization of PCEng2, a β-1,3-Endoglucanase Homolog in Pneumocystis carinii with Activity in Cell Wall Regulation
    Am. J. Respir. Cell Mol. Biol., Aug 2010; 43: 192 – 200. 
    … …enzyme (HindIII or EcoRI; Promega, Inc., Madison, WI) for 4 hours at 37C. Genomic DNA (10 mug) from normal rat lung tissue (BioChain, Hayward, CA) was also digested under the same conditions as controls. The digested genomic DNA was then electrophoresed through… … 
    Ref. link
  • Xiwei Wu, Tibor A. Rauch, Xueyan Zhong, William P. Bennett, Farida Latif, Dietmar Krex, and Gerd P. Pfeifer
    CpG Island Hypermethylation in Human Astrocytomas
    Cancer Res., Apr 2010; 70: 2718 – 2727. 
    … …Methods Tissue and DNA samples Six normal human brain tissues from accident victims were obtained from Capital Biosciences and BioChain. Twenty-four brain tumor tissues from astrocytomas (WHO grades 1-4) were obtained on Institutional Review Board-approved protocols… … 
    Ref. link
  • Hiromu Suzuki, Shinichi Igarashi, Masanori Nojima, Reo Maruyama, Eiichiro Yamamoto, Masahiro Kai, Hirofumi Akashi, Yoshiyuki Watanabe, Hiroyuki Yamamoto, Yasushi Sasaki, Fumio Itoh, Kohzoh Imai, Tamotsu Sugai, Lanlan Shen, Jean-Pierre J. Issa, Yasuhisa Shinomura, Takashi Tokino, and Minoru Toyota
    IGFBP7 is a p53-responsive gene specifically silenced in colorectal cancer with CpG island methylator phenotype
    Carcinogenesis, Mar 2010; 31: 342 – 349.
    … …kit (Ambion, Austin, TX). Genomic DNA and total RNA from normal colon tissue from a healthy individual were purchased from BioChain (Hayward, CA). Drug treatment To analyze restoration of IGFBP7 gene expression, CRC cells were treated with 2 muM 5-aza-2-deoxycytidine… …
    Ref. link
  • Xun Zhang, Roger Gejman, Ali Mahta, Ying Zhong, Kimberley A. Rice, Yunli Zhou, Pornsuk Cheunsuchon, David N. Louis, and Anne Klibanski
    Maternally Expressed Gene 3, an Imprinted Noncoding RNA Gene, Is Associated with Meningioma Pathogenesis and Progression
    Cancer Res., Mar 2010; 70: 2350 – 2358. 
    … …Invitrogen). Normal meningeal RNA samples were purchased from BioChain and Analytical Biological Services, or extracted from normal…Normal meningeal genomic DNA samples were either purchased fromBioChain and Analytical Biological Services or extracted from normal… … 
    Ref. link 
  • C.L. Galindo, L.J. McIver, J.F. McCormick, M.A. Skinner, Y. Xie, R.A. Gelhausen, K. Ng, N.M. Kumar, and H.R. Garner
    Global Microsatellite Content Distinguishes Humans, Primates, Animals, and Plants
    Mol. Biol. Evol., Dec 2009; 26: 2809 – 2819.
    … …genomic DNA was purchased from Coriell Cell Repositories (Camden, NJ), and Arabidopsis and corn genomic DNA was purchased from Biochain Institute, Inc. (Hayward, CA). Alaskan husky and Angus bull genomic DNA was graciously provided by John Fondon III (University… … 
    Ref. link
  • Kazumori Kawakami, Hiroshi Hirata, Soichiro Yamamura, Nobuyuki Kikuno, Sharanjot Saini, Shahana Majid, Yuichiro Tanaka, Ken Kawamoto, Hideki Enokida, Masayuki Nakagawa, and Rajvir Dahiya
    Functional Significance of Wnt Inhibitory Factor-1 Gene in Kidney Cancer
    Cancer Res., Nov 2009; 69: 8603 – 8610. 
    … …EpiTect Bisulfite kit (Qiagen) following the manufacturer’s directions. The genomic DNA from adult human normal kidney tissue (BioChain) was also modified and used as a control. Primers for bisulfite genomic sequencing PCR were designed by using the online program… … 
    Ref. link
  • Leah R Villegas, Theodore J Kottom, and Andrew H. Limper
    Characterization of PCEng2 a  -1,3-Endoglucanase Homologue in Pneumocystis carinii with Activity in Cell Wall Regulation
    Am. J. Respir. Cell Mol. Biol., Sep 2009; 10.1165/rcmb.2009-0131OC. 
    … …restriction enzyme (HindIII or EcoRI, Promega, Inc.) for 4 hours at 37°C. Genomic DNA (10µg) from normal rat lung tissue (BioChain) was also digested under the same conditions as controls. The digested genomic DNA was then electrophoresed through a 1% agarose… … 
    Ref. link
  • Huiqing Chen, Kyunghee Yang, Suyoung Choi, James H. Fischer, and Hyunyoung Jeong
    Up-Regulation of UDP-Glucuronosyltransferase (UGT) 1A4 by 17β-Estradiol: A Potential Mechanism of Increased Lamotrigine Elimination in Pregnancy
    Drug Metab. Dispos., Sep 2009; 37: 1841 – 1847.
    … …construct the pGL3-UGT1A4 plasmid, the upstream region of UGT1A4 (-2399 to +28) was PCR-amplified using human genomic DNA (Biochain, Hayward, CA) as the template and a pair of primers: forward and reverse primers of 5-TGCCTACCACAGACACTAAG-3 and 5-TCAGCAGAAGCCACCGAC-3… … 
    Ref. link
  • Sivan Osenberg, Dan Dominissini, Gideon Rechavi, and Eli Eisenberg
    Widespread cleavage of A-to-I hyperediting substrates
    RNA, Sep 2009; 15: 1632 – 1639. 
    … …Experimental materials and methods Human adult hippocampus total RNA and genomic DNA from the same subject were purchased from Biochain. For RT-PCR, each RNA sample was treated with DNase I (Invitrogen) and reverse transcribed using M-MLV RT and random hexamers… … 
    Ref. link
  • Hui-Wen Lo, Hu Zhu, Xinyu Cao, Amy Aldrich, and Francis Ali-Osman
    A Novel Splice Variant of GLI1 That Promotes Glioblastoma Cell Migration and Invasion
    Cancer Res., Aug 2009; 10.1158/0008-5472.CAN-09-0886. 
    … …purchased from Sigma unless otherwise stated. cDNAs of normal tissues and genomic DNAs from peripheral leukocytes were from BioChain. Human GBM cell lines were established in our laboratory from primary specimens (7), with the exception of U87MG, T98G, U373MG… … 
    Ref. link
  • Hehuang Xie, Min Wang, Maria de F. Bonaldo, Christina Smith, Veena Rajaram, Stewart Goldman, Tadanori Tomita, and Marcelo B. Soares
    High-throughput sequence-based epigenomic analysis of Alu repeats in human cerebellum
    Nucleic Acids Res., Jul 2009; 37: 4331 – 4340. 
    … …those in the remainder Alu elements. DNA samples Human genomic DNA samples for fetal adrenal gland tissues were purchased (BioChain Inc., Hayward, CA). Human snap-frozen cerebellum and cortex tissues were obtained from the tissue bank of the Department of… … 
    Ref. link
  • Paul N. Kongkham, Paul A. Northcott, Young Shin Ra, Yukiko Nakahara, Todd G. Mainprize, Sidney E. Croul, Christian A. Smith, Michael D. Taylor, and James T. Rutka
    An Epigenetic Genome-Wide Screen Identifies SPINT2 as a Novel Tumor Suppressor Gene in Pediatric Medulloblastoma
    Cancer Res., Dec 2008; 68: 9945 – 9953.
    … …culture were purchased from Wisent, Inc. Normal human fetal and adult cerebellar genomic DNA and RNA samples were purchased from Biochain. 5-aza-dC treatment protocol, reverse transcription-PCR/quantitative real-time PCR, and affymetrix HG U133 plus 2.0 expression… … 
    Ref. link
  • Daniel Diaczok, Christopher Romero, Janice Zunich, Ian Marshall, and Sally Radovick
    A Novel Dominant Negative Mutation of OTX2 Associated with Combined Pituitary Hormone Deficiency
    J. Clin. Endocrinol. Metab., Nov 2008; 93: 4351 – 4359. 
    … …informed consent and with appropriate institutional review board approval. Control DNA (n 50) was obtained from healthy adults (Biochain, Hayward, CA). Genomic DNA was prepared from peripheral blood using the DNeasy Tissue Kit (QIAGEN, Inc., Valencia, CA). DNA… … 
    Ref. link
  • Willemijn M. Gommans, Nicholas E. Tatalias, Christina P. Sie, Dylan Dupuis, Nicholas Vendetti, Lauren Smith, Rikhi Kaushal, and Stefan Maas
    Screening of human SNP database identifies recoding sites of A-to-I RNA editing
    RNA, Oct 2008; 14: 2074 – 2085.
    … …RNA editing analysis For experimental validation, human brain total RNA and gDNA isolated from the same specimen (Biochain) were used and processed using standard protocols for reverse transcription and PCR (see Supplemental Table S1 for primer sequences… … 
    Ref. link
  • Yi-Chun Liao, Yi-Ping Shih, and Su Hao Lo
    Mutations in the Focal Adhesion Targeting Region of Deleted in Liver Cancer-1 Attenuate Their Expression and Function
    Cancer Res., Oct 2008; 68: 7718 – 7722. 
    … …Materials and Methods Mutation analysis. Prostate cDNA and colon genomic DNA samples were purchased from OriGene Technologies and BioChain, respectively. DNA fragments were amplified by PCR using DLC-1 primers 5-GGCAGCCTGCCCTCTCCCAAGGAA (forward) and 5-CAGGGCTGAGTCCGAATCTCCCTC-3… … 
    Ref. link
  • Maile Reed Brown, Jack Kronengold, Valeswara-Rao Gazula, Charalampos G. Spilianakis, Richard A. Flavell, Christian A. von Hehn, Arin Bhattacharjee, and Leonard K. Kaczmarek
    Amino-termini isoforms of the Slack K+ channel, regulated by alternative promoters, differentially modulate rhythmic firing and adaptation
    J. Physiol., Sep 2008; 10.1113/jphysiol.2008.160861.  
    … …amino-terminus (forward primer CCCATCTTCTTCCTTCCCTGAGCCGTC and reverse primer ATCCTGCGGGAGCGCTTGGCGC). Using PCR-ready rat genomic DNA (Biochain, Hayward CA, USA) and Pfu Turbo, 2 kb products were amplified and subcloned using the TA cloning kit (Invitrogen), and sequenced… … 
    Ref. link
  • Elizabeth E. Brittle, Fushan Wang, John M. Lubinski, Ralph M. Bunte, and Harvey M. Friedman
    A Replication-Competent, Neuronal Spread-Defective, Live Attenuated Herpes Simplex Virus Type 1 Vaccine
    J. Virol., Sep 2008; 82: 8431 – 8441.
    … …Applied Biosystems). Standard curves were derived using 5 to 107 copies of HSV-1 DNA and 5 to 105 copies of murine cellular DNA (Biochain, Hayward, CA). RT qPCR results were expressed as the HSV-1 DNA copy number per 5 105 copies of murine adipsin. Explant… … 
    Ref. link
  • Daniel Diaczok, Christopher Romero, Janice Zunich, Ian Marshall, and Sally Radovick
    A Novel Dominant Negative Mutation of OTX2 Associated with Combined Pituitary Hormone Deficiency
    J. Clin. Endocrinol. Metab., Aug 2008; 10.1210/jc.2008-1189.
    … …informed consent and with appropriate Institutional Review Board approval. Control DNA (n=50) was obtained from healthy adults (Biochain, Hayward, CA). Genomic DNA was prepared from peripheral blood using DNeasy Tissue Kit (QIAGEN, Valencia, CA). DNA from 19 patients… …
    Ref. link
  • Jian Qin, Robert C. Jones, and Ramesh Ramakrishnan
    Studying copy number variations using a nanofluidic platform
    Nucleic Acids Res., Aug 2008; 10.1093/nar/gkn518. 
    … …We used digital arrays to analyze the ERBB2 copy numbers of 40 breast cancer and 8 normal breast tissue DNA samples from BioChain (Hayward, CA). All DNA samples were from Asian individuals except one normal sample that was from a Caucasian. Of the 40 breast… … 
    Ref. link
  • Seonhoe Kim, Ui Jin Lee, Mi Na Kim, Eun-Ju Lee, Ji Young Kim, Mi Young Lee, Sorim Choung, Young Joo Kim, and Young-Chul Choi
    MicroRNA miR-199a* Regulates the MET Proto-oncogene and the Downstream Extracellular Signal-regulated Kinase 2 (ERK2)
    J. Biol. Chem., Jun 2008; 283: 18158 – 18166. 
    … …cells using the DNA Wizard Genomic DNA Purification Kit (Promega). DNA from human normal and tumor tissues were obtained from Biochain (Hayward, CA). Prior to treatment with bisulfite, DNA was digested with NcoI (New England Biolabs, Ipswich, MA). The digested… … 
    Ref. link
  • Zheng Chen, Mireille Montcouquiol, Rene Calderon, Nancy A. Jenkins, Neal G. Copeland, Matthew W. Kelley, and Konrad Noben-Trauth
    Jxc1/Sobp, Encoding a Nuclear Zinc Finger Protein, Is Critical for Cochlear Growth, Cell Fate, and Patterning of the Organ of Corti
    J. Neurosci., Jun 2008; 28: 6633 – 6641. 
    … …purchased from Clontech Laboratories. Rat and chicken genomic DNA was purchased from Seegene. Rhesus genomic DNA was obtained from BioChain Institute, Takifugu rubripes genomic DNA was obtained from Genservice, and Anopheles gambiae flies were obtained from American… … 
    Ref. link
  • Yih-Jyh Shann, Ching Cheng, Chun-Hui Chiao, Dow-Tien Chen, Pei-Hsin Li, and Ming-Ta Hsu
    Genome-wide mapping and characterization of hypomethylated sites in human tissues and breast cancer cell lines
    Genome Res., May 2008; 18: 791 – 801.  
    … …addition, samples of genomic DNA of human brain, breast, liver, testis, leukocytes, and breast tumor tissues, were purchased from BioChain. Preparation of RNA Cells were rinsed twice with 1 PBS. Total RNA was extracted according to the RNeasy Mini Kit Spin Protocol… … 
    Ref. link
  • Kaiko Kunii, Lenora Davis, Julie Gorenstein, Harold Hatch, Masakazu Yashiro, Alessandra Di Bacco, Cem Elbi, and Bart Lutterbach
    FGFR2-Amplified Gastric Cancer Cell Lines Require FGFR2 and Erbb3 Signaling for Growth and Survival
    Cancer Res., Apr 2008; 68: 2340 – 2348. 
    … …s at 95C, and 1 min at 60C). Data were normalized to RNase P and then to the calibrator sample (normal stomach genomic DNA, BioChain Institute D1234248). Fluorescence in situ hybridization analysis. KatoIII gastric carcinoma cells were treated with colcemid… … 
    Ref. link
  • Mathias Ehrich, Julia Turner, Peter Gibbs, Lara Lipton, Mara Giovanneti, Charles Cantor, and Dirk van den Boom
    Cytosine methylation profiling of cancer cell lines
    PNAS, Mar 2008; 105: 4844 – 4849. 
    … …D123062), breast (D1234086), colon (D1234090), kidney (D1234142), leukocyte (D1234148), and lung (D1234152) were obtained from BioChain. Clinical Colon Cancer Tissue. Tissue colorectal cancer and normal colon tissue samples were obtained from the Royal Melbourne… … 
    Ref. Link
  • Anilkumar Bettegowda, Jianbo Yao, Aritro Sen, Qinglei Li, Kyung-Bon Lee, Yasuhiro Kobayashi, Osman V. Patel, Paul M. Coussens, James J. Ireland, and George W. Smith 
    JY-1, an oocyte-specific gene, regulates granulosa cell function and early embryonic development in cattle
    PNAS, Nov 2007; 104: 17602 – 17607.
    … …RNA digestion and DNA precipitation. RNase-treated human genomic DNA (source: liver) was purchased from a commercial vendor (Biochain Institute., Hayward CA). Southern blot was prepared by digesting ?5 mg of genomic DNA per sample with EcoRI for… …
    Ref. link
  • KyeongJin Kim, Hyeong Hoe Kim, Joon Hong Kim, Yung Hyun Choi, Young Hee Kim, and JaeHun Cheong 
    Chemokine stromal cell-derived factor-1 induction by C/EBP?activation is associated with all-trans-retinoic acid-induced leukemic cell differentiation
    J. Leukoc. Biol., Nov 2007; 82: 1332 – 1339. 
    … …was amplified by PCR from normal human spleen genomic DNA (BioChain Institute, Inc., Hayward, CA, USA) using the primer set, SDF-1-1918…GCT CGA GCG GTT ACT TGT TTA AAG C-3) from human liver cDNA (BioChain Institute). The PCR product was ligated into the pcDNA expression… … 
    Ref. link 
  • Hirohide Yoshikawa, Kenichi Matsubara, Xiaoling Zhou, Shu Okamura, Takahiko Kubo, Yaeko Murase, Yuko Shikauchi, Manel Esteller, James G. Herman, Xin Wei Wang, and Curtis C. Harris 
    WNT10B Functional Dualism: -Catenin/Tcf-dependent Growth Promotion or Independent Suppression with Deregulated Expression in Cancer
    Mol. Biol. Cell, Nov 2007; 18: 4292 – 4303. 
    … …medium, supplemented with 10% fetal bovine serum. Normal DNA and RNA samples (liver, colon, and placenta) were purchased from Biochain Institute (Hayward, CA) and BD Biosciences (Palo Alto, CA). Primary HCC samples are as described previously (Yoshikawa et al… … 
    Ref. link
  • Changfa Guo, Husnain Kh. Haider, Winston S.N. Shim, Ru-San Tan, Lei Ye, Shujia Jiang, Peter K. Law, Philip Wong, and Eugene K.W. Sim 
    Myoblast-based cardiac repair: Xenomyoblast versus allomyoblast transplantation
    J. Thorac. Cardiovasc. Surg., Nov 2007; 134: 1332 – 1339. 
    … …QIAGEN), according to the manufacturers instructions. Male genomic DNA from human subjects (Research Instruments) or rats (Biochain) was used as standard after a serial dilution (5). Real-time PCR analysis was performed with the SYBR Green kit (ABgene). Briefly… … 
    Ref. link 
  • April Smith Torhan, Boonlert Cheewatrakoolpong, Lia Kwee, and Scott Greenfeder 
    Cloning and characterization of the hamster and guinea pig nicotinic acid receptors
    J. Lipid Res., Sep 2007; 48: 2065 – 2071. 
    … …GPR109A (nicotinic acid receptor) receptor Guinea pig and hamster genomic DNA and cDNA from various tissues were purchased from Biochain Institute, Inc. (Hayward, CA). The Advantage 2 PCR kit was purchased from Clontech (Mountain View, CA). All primers were synthesized… … 
    Ref. link
  • Hirohide Yoshikawa, Kenichi Matsubara, Xiaoling Zhou, Shu Okamura, Takahiko Kubo, Yaeko Murase, Yuko Shikauchi, Manel Esteller, James G. Herman, Xin Wei Wang, and Curtis C. Harris 
    WNT10B Functional Dualism: -Catenin/Tcf-dependent Growth Promotion or Independent Suppression with Deregulated Expression in Cancer
    Mol. Biol. Cell, Aug 2007; 10.1091/mbc.E06-10-0889. 
    … …1640, supplemented with 10% fetal bovine serum. Normal DNA and RNA samples (liver, colon, and placenta) were purchased from Biochain Institute, Inc. (Hayward, CA) and BD Biosciences (Palo Alto, CA). Primary HCC samples are as described(Ye et al., 2003; Yoshikawa… … 
    Ref. link 
  • KyeongJin Kim, Hyeong Hoe Kim, Joon Hong Kim, Yung Hyun Choi, Young Hee Kim, and JaeHun Cheong 
    Chemokine stromal cell-derived factor-1 induction by C/EBP activation is associated with all-trans-retinoic acid-induced leukemic cell differentiation
    J. Leukoc. Biol., Jul 2007; 10.1189/jlb.1106697. 
    … …was amplified by PCR from normal human spleen genomic DNA (BioChain Institute, Hayward, CA, USA) 1 Correspondence: Department of…GCT CGA GCG GTT ACT TGT TTA AAG C-3) from human liver cDNA (BioChain Institute). The PCR product was ligated into the pcDNA expression… … 
    Ref. link
  • Qiwei Yang, Colleen M. Kiernan, Yufeng Tian, Helen R. Salwen, Alexandre Chlenski, Babette A. Brumback, Wendy B. London, and Susan L. Cohn 
    Methylation of CASP8, DCR2, and HIN-1 in Neuroblastoma Is Associated with Poor Outcome
    Clin. Cancer Res., Jun 2007; 13: 3191 – 3197. 
    … …bisulfite using the CpGenome DNA Modification Kit (Intergen Co.). Genomic DNA from human normal adrenal tissue was purchased from BioChain Institute, Inc. As previously described (3), 1 mug of genomic DNA was denatured by NaOH and modified by sodium bisulfite, which… … 
    Ref. link
  • Helen C. Turner, Murat T. Budak, M. A. Murat Akinci, and J. Mario Wolosin 
    Comparative Analysis of Human Conjunctival and Corneal Epithelial Gene Expression with Oligonucleotide Microarrays
    Invest. Ophthalmol. Vis. Sci., May 2007; 48: 2050 – 2061. 
    … …sample in which the reverse transcriptase was omitted from the transcription reaction, and three contained human genomic DNA (Biochain, Hayward, CA). Products were analyzed by agarose (4%) gel chromatography. Relative amounts of the target genes in the corneal… … 
    Ref. link
  • Youngsoo Kim, Joon Won Yoon, Xiaokun Xiao, Nicholas M. Dean, Brett P. Monia, and Eric G. Marcusson 
    Selective Down-Regulation of Glioma-Associated Oncogene 2 Inhibits the Proliferation of Hepatocellular Carcinoma Cells
    Cancer Res., Apr 2007; 67: 3583 – 3593
    … …Genomic DNA was either isolated from HCC cells using Genomic DNA Isolation kit (BioVision, Mountain View, CA) or purchased from Biochain Institute, Inc. (Hayward, CA) for normal human heart and liver tissues. PCR amplification was done using PfuUltra High-Fidelity… … 
    Ref. link
  • Vivianne Deng, Valerie Matagne, Fatima Banine, Matthew Frerking, Patricia Ohliger, Sarojini Budden, Jonathan Pevsner, Gregory A. Dissen, Larry S. Sherman, and Sergio R. Ojeda 
    FXYD1 is an MeCP2 target gene overexpressed in the brains of Rett syndrome patients and Mecp2-null mice
    Hum. Mol. Genet., Mar 2007; 16: 640 – 650.
    … …Bisulfite PCR sequencing of human and mouse genomic DNA Genomic DNA from adult human brain and heart were purchased from BioChain, Inc. (Hayward, CA, USA). Genomic DNA from the mouse FC and CB was extracted as described (53). The presence of 5′-methylcytosines… … 
    Ref. link
  • Nashi Widodo, Custer C. Deocaris, Kamaljit Kaur, Kamrul Hasan, Tomoko Yaguchi, Kazuhiko Yamasaki, Takashi Sugihara, Tetsuro Ishii, Renu Wadhwa, and Sunil C. Kaul 
    Stress Chaperones, Mortalin, and Pex19p Mediate 5-Aza-2′ Deoxycytidine-Induced Senescence of Cancer Cells by DNA Methylation-Independent Pathway
    J. Gerontol. A Biol. Sci. Med. Sci., Mar 2007; 62: 246 – 255.
    … …and tumor-derived human cells and tumor tissues (59-61). In a panel of normal and tumor tissues from the same individuals (Biochain, Hayward, CA), we detected a higher level of expression of mortalin in tumor tissues as compared to their normal counterparts… … 
    Ref. link
  • Bart Lutterbach, Qinwen Zeng, Lenora J. Davis, Harold Hatch, Gaozhen Hang, Nancy E. Kohl, Jackson B. Gibbs, and Bo-Sheng Pan 
    Lung Cancer Cell Lines Harboring MET Gene Amplification Are Dependent on Met for Growth and Survival
    Cancer Res., Mar 2007; 67: 2081 – 2088.
    … …cycles of 15 s 92C; and 1 min 60C) Data were normalized to RNase P and then to the calibrator sample (normal lung genomic DNA; BioChain Institute, Hayward, CA). ShRNA production and infection. shRNA sequences for Met were M1: GAAGATCACGAAGATCCCATTCAAGAGATGGGATCTTCGTGATCTTC… … 
    Ref. link
  • Shen Qu, Dongming Su, Jennifer Altomonte, Adama Kamagate, Jing He, German Perdomo, Tonia Tse, Yu Jiang, and H. Henry Dong 
    PPAR mediates the hypolipidemic action of fibrates by antagonizing FoxO1
    Am J Physiol Endocrinol Metab, Feb 2007; 292: E421 – E434.
    … …mouse FoxO1 promoter 1,748/407 nucleotide (nt), including the 5-untranslated region, was cloned from Balb/C mouse genomic DNA (BioChain Institute, Hayward, CA) into the TA-cloning vector pCR2.1 (Invitrogen) by PCR using specific primers (for forward reaction… … 
    Ref. link
  • Shen Qu, Dongming Su, Jennifer Altomonte, Adama Kamagate, Jing He, German Perdomo, Tonia Tse, Yu Jiang, and H. Henry Dong
    PPAR- Mediates the Hypolipidemic Action of Fibrates by Antagonizing FoxO1
    Am J Physiol Endocrinol Metab, Sep 2006; 10.1152/ajpendo.00157.2006.
    … …2-kb mouse FoxO1 promoter (-1748/+407 nt) including the 5′-untranslated region (UTR) was cloned from Balb/C mouse genomic DNA (BioChain Institute Inc., Hayward, CA) into the TA-cloning vector pCR2.1 (Invitrogen) by PCR using specific primers (for forward reaction… … 
    Ref. link
  • Daniel A. Peiffer, Jennie M. Le, Frank J. Steemers, Weihua Chang, Tony Jenniges, Francisco Garcia, Kirt Haden, Jiangzhen Li, Chad A. Shaw, John Belmont, Sau Wai Cheung, Richard M. Shen, David L. Barker, and Kevin L. Gunderson
    High-resolution genomic profiling of chromosomal aberrations using Infinium whole-genome genotyping
    Genome Res., Sep 2006; 16: 1136 – 1148.
    … …leukemia cell line (HL-60) was also obtained from ATCC (ATCC No. HL60). The paired colon tumor genomic DNA was obtained from BioChain (A704198). For the DNA fragmentation experiments, cell line NA60136 was obtained from Coriell as was the cell line exhibiting… … 
    Ref. link
  • Emmanuel Zorn, Erik A. Nelson, Mehrdad Mohseni, Fabrice Porcheray, Haesook Kim, Despina Litsa, Roberto Bellucci, Elke Raderschall, Christine Canning, Robert J. Soiffer, David A. Frank, and Jerome Ritz 
    IL-2 regulates FOXP3 expression in human CD4+CD25+ regulatory T cells through a STAT-dependent mechanism and induces the expansion of these cells in vivo
    Blood, Sep 2006; 108: 1571 – 1579.
    … …the UCSC genome browser, May 2004 assembly ( http://genome.ucsc.edu ). FOXP3 genomic DNA was amplified from human breast DNA (BioChain, Hayward, CA) using the following primers: 5-GGACGTCCCTTTCTGACTG-3 and 5-TCACCTACCACATCCACCAG-3. Amplified DNA was cloned using… … 
    Ref. link
  • Lingbao Ai, Wan-Ju Kim, Tae-You Kim, C. Robert Fields, Nicole A. Massoll, Keith D. Robertson, and Kevin D. Brown 
    Epigenetic Silencing of the Tumor Suppressor Cystatin M Occurs during Breast Cancer Progression
    Cancer Res., Aug 2006; 66: 7899 – 7909.
    … …polyacrylamide gels and the gel was stained with ethidium bromide and directly visualized under UV illumination. Human placental gDNA (Biochain Institute, Hayward, CA) was used in primer validation experiments and methylated in vitro with SssI methylase (NEB, Ipswich… … 
    Ref. link
  • Erik A. Nelson, Sarah R. Walker, Wei Li, X. Shirley Liu, and David A. Frank
    Identification of human STAT5-dependent gene regulatory elements based on inter-species homology
    J. Biol. Chem., Jul 2006; 10.1074/jbc.M605001200. 
    … …between human, chimp, mouse, and rat were selected for subsequent analysis. Reporter gene construction: Human breast DNA (BioChain, Hayward, CA) was amplified with primers spanning the conserved NCAM2 intronic region with the following sequences: ACACATCCTTCATACCAGGAAA… … 
  • Blow MJ, Grocock RJ, van Dongen S, Enright AJ, Dicks E, Futreal PA, Wooster R, Stratton MR. 
    RNA editing of human microRNAs
    Genome Biol. 2006; 7(4): R27.
    … …For the initial screen of RNA editing in ten human tissues, total RNA and matching genomic DNA from the same tissue sample was obtained for human brain, heart, liver, lung, ovary, placenta, skeletal muscle, small intestine, spleen and testis from Biochain (Hayward, USA). … … 
    Ref. link 
  • Emmanuel Zorn, Erik A Nelson, Mehrdad Mohseni, Fabrice Porcheray, Haesook Kim, Despina Litsa, Roberto Bellucci, Elke Raderschall, Christine Canning, Robert J Soiffer, David A Frank, and Jerome Ritz
    IL-2 regulates FOXP3 expression in human CD4+CD25+ regulatory T cells through a STAT dependent mechanism and induces the expansion of these cells in vivo 
    Blood, Apr 2006; 10.1182/blood-2006-02-004747. 
    … …UCSC genome browser, May 2004 assembly (http://genome.ucsc.edu). FOXP3 genomic DNA was amplified from human breast DNA (BioChain, Hayward, CA) using the following primers: 5′-GGACGTCCCTTTCTGACTG-3′ and 5′-TCACCTACCACATCCACCAG-3′. Amplified DNA was… … 
  • Gong X, Tsai SW, Yan B, Rubin LP. 
    Cooperation between MEF2 and PPAR? in human intestinal ??carotene 15,15′-monooxygenase gene expression
    BMC Mol Biol. 2006; 7: 7.
    … …A 1022 bp BCMO1 promoter fragment spanning nt 79828775 to 79829795 [Ensembl Gene, ENSG00000135697] [54] was amplified by the polymerase chain reaction (PCR) from human liver genomic DNA (BioChain Institute, Hayward, CA) using a 5′ primer …. … 
    Ref. link 
  • Nadia Felli, Laura Fontana, Elvira Pelosi, Rosanna Botta, Desirée Bonci, Francesco Facchiano, Francesca Liuzzi, Valentina Lulli, Ornella Morsilli, Simona Santoro, Mauro Valtieri, George Adrian Calin, Chang-Gong Liu, Antonio Sorrentino, Carlo M. Croce, and Cesare Peschle
    MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation 
    PNAS, Dec 2005; 102: 18081 – 18086. 
    … ..Plasmids and Constructs. PGL3-3′ UTR plasmid. Kit 3′ UTR was cloned from human spleen genomic DNA (BioChain, Hayward, CA) by using the forward primer 5′-CTCGAGCGTCTTAGTCCAAACCCAG-3′ and the reverse primer 5′-CTCGAGCAAGGACAAAAGATCT-3… 
  • Erez Y. Levanon, Martina Hallegger, Yaron Kinar, Ronen Shemesh, Kristina Djinovic-Carugo, Gideon Rechavi, Michael F. Jantsch, and Eli Eisenberg
    Evolutionarily conserved human targets of adenosine to inosine RNA editing
     Nucleic Acids Res., Feb 2005; 33: 1162 – 1168.
     … RNA and genomic DNA (gDNA) isolated simultaneously from the same tissue sample were purchased from Biochain Institute (Hayward, CA). …
  • Qiwei Yang, Peter Zage, David Kagan, Yufeng Tian, Roopa Seshadri, Helen R. Salwen, Shuqing Liu, Alexandre Chlenski, and Susan L. Cohn
    Association of Epigenetic Inactivation of RASSF1A with Poor Outcome in Human Neuroblastoma
     Clin. Cancer Res., Dec 2004; 10: 8493 – 8500.
     … Genomic DNA from human normal adrenal and brain tissues were purchased from BioChain Institute, Inc. … 
  • Daniel P. Morse, P. Joseph Aruscavage, and Brenda L. Bass
    RNA hairpins in noncoding regions of human brain and Caenorhabditis elegans mRNA are edited by adenosine deaminases that act on RNA
    PNAS, Jun 2002; 99: 7906 – 7911. we used poly(A) + RNA and genomic DNA isolated from the same individual (purchased from BioChain Institute, Hayward, CA) to ensure differences between genomic and cDNA sequences were due to RNA …

Kits and Reagentsx

  • A thermogenic secondary sexual character in male sea lamprey
    Yu-Wen Chung-Davidson, M Cody Priess, Chu-Yin Yeh, Cory O Brant, Nicholas S Johnson, Ke Li, Kaben G Nanlohy, Mara B Bryan, C Titus Brown, Jongeun Choi, Weiming Li
    J. Exp. Biol. (3), 2013-07-15, 216, 2702-12
    … Louis, MO, USA). Mitochondrial assays. Mitochondria were extracted from rope, gill and muscle tissues using a mitochondria isolation kit following the manufacturer’s instructions (BioChain Institute, Newark, CA, USA). Briefly, 100 ..
  • Amelioration of ethanol-induced liver injury in rats by nanogold flakes
    Ya-Ling Chen, Hsiang-Chi Peng, Shan-Wen Tan, Cheng-Yuh Tsai, Yi-Huei Huang, Hao-Yu Wu, Suh-Ching Yang
    Alcohol (2.4), 2013-07-02, , 
    … Measurements and analytical procedures. Blood alcohol concentration. Blood samples were collected 2 h after the ethanol liquid diet feeding. The blood alcohol concentration was determined using an ethanol assay kit (BioChain, Hayward, CA, USA). …
  • Susceptibility Loci associations with prostate cancer risk in northern chinese men
    Na-Na Wang, Yong Xu, Kuo Yang, Dong Wei, Yao-Guang Zhang, Ming Liu, Xiao-Hong Shi, Si-Ying Liang, Liang Sun, Xiao-Quan Zhu, Yi-Ge Yang, Lei Tang, Cheng-Xiao Zhao, Xin Wang, Xin Chen, Juan Hui, Yu-Hong Zhang, Ling Zhu, Fan Yang, Yu-Rong Zhang, Ze Yang, Jian-Ye Wang
    Asian Pac. J. Cancer Prev. (1.2), 2013-06-27, 14, 3075-8
    … These loci included rs13385191, rs12653946, rs1983891, rs339331, rs9600079 and rs2735839. Whole blood genomic DNA extraction kit (BioChain (Beijing) Science- Technology Beijing, People’s Republic of China) was used to extract blood genomic DNA. …
  • Expression of immune genes on chromosome 6p21.3-22.1 in schizophrenia
    Melissa L Sinkus, Catherine E Adams, Judith Logel, Robert Freedman, Sherry Leonard
    Brain Behav. Immun. (4), 2013-06-17, 32, 51-62
    … Then they were rinsed in dimethylpyrocarbonate treated water. In situ hybridization was performed with an ISHyb in situ hybridization kit (BioChain, Hayward, CA). For each experiment a DIG labeled sense mRNA probe control was also included as a specificity control. …
  • Computational analysis of bacterial RNA-Seq data
    Ryan McClure, Divya Balasubramanian, Yan Sun, Maksym Bobrovskyy, Paul Sumby, Caroline A Genco, Carin K Vanderpool, Brian Tjaden
    Nucleic Acids Res. (7.8), 2013-05-28, , 
    … A complementary DNA (cDNA) library of the resulting messenger RNA (mRNA) was then prepared using BioChain‘s Directional mRNA Sample Prep kit according to the manufacturer’s instructions. Briefly, RNA was fragmented with metal ion scission and treated with PNK. …
  • Evaluation of polypropylene hollow-fiber prototype bioreactor for bioartificial liver
    Anwar Azad Palakkan, Deepa K Raj, Jose Rojan, Sajin Raj R G, P R Anil Kumar, C V Muraleedharan, T V Kumary
    Tissue Eng Part A 0, 2013-05-27, 19, 1056-66
    … Urea estimation Urea production by cells in a prototype bioreactor was estimated using an urea assay kit (BioChain) as per the manufacturer’s instructions. The medium collected on 1, 3, 5, and 7 days was used for analysis. …
  • Nucleophosmin, a critical Bax cofactor in ischemia-induced cell death
    Zhiyong Wang, Jonathan M Gall, Ramon Bonegio, Andrea Havasi, Katarina Illanes, John H Schwartz, Steven C Borkan
    Mol. Cell. Biol. (6.2), 2013-05-24, 33, 1916-24
    … digitonin (8 μg/ml). Cytosolic proteins were extracted from renal cortical samples using a commercially available tissue protein extraction kit (BioChain Institute, Newark, CA) by following the manufacturer’s instructions. Briefly, 50 to …
  • Nrf2 is not required for epithelial prohibitin-dependent attenuation of experimental colitis
    Arwa S Kathiria, Mackenzie A Butcher, Jason M Hansen, Arianne L Theiss
    Am. J. Physiol. Gastrointest. Liver Physiol. (3.5), 2013-05-15, 304, G885-96
    … Two micrograms of reverse-transcribed cDNA (Optimaz First Strand cDNA Synthesis Kit, BioChain, Newark, CA) were amplified by quantitative real-time PCR (qRT-PCR) using 10 μM gene-specific primers and iQ SYBR Green Supermix (Bio-Rad). …
  • Baicalin ameliorates neuropathic pain by suppressing HDAC1 expression in the spinal cord of spinal nerve ligation rats
    Chen-Hwan Cherng, Kwong-Chiu Lee, Chih-Cheng Chien, Kuang-Yi Chou, Yu-Che Cheng, Shih-Tai Hsin, Sing-Ong Lee, Ching-Hui Shen, Ru-Yin Tsai, Chih-Shung Wong
    J. Formos. Med. Assoc. (1.1), 2013-05-15, , 
    … The dorsal part of the ipsilateral spinal cord was fractionated into cytosolic, membrane, and nuclear fractions using a cytoplasmic, nuclear, and membrane (CNM) compartment protein extraction kit as recommended by the manufacturer (BioChain Institute Inc., Hayward, CA, USA …
  • Arterial klotho expression and FGF23 effects on vascular calcification and function
    Karolina Lindberg, Hannes Olauson, Risul Amin, Arvind Ponnusamy, Regina Goetz, Rebecca F Taylor, Moosa Mohammadi, Ann Canfield, Karolina Kublickiene, Tobias E Larsson
    PLoS ONE (4.4), 2013-04-11, 8, e60658
    … Sequences of the primers used for genotyping are listed in Table S1. Serum biochemistries. Serum calcium, phosphate and creatinine were measured using quantitative colorimetric assay kits (BioAssay/BioChain, Hayward, CA, US). …
  • Gold nanoparticle mediated laser transfection for efficient siRNA mediated gene knock down
    Dag Heinemann, Markus Schomaker, Stefan Kalies, Maximilian Schieck, Regina Carlson, Hugo Murua Escobar, Tammo Ripken, Heiko Meyer, Alexander Heisterkamp
    PLoS ONE (4.4), 2013-03-28, 8, e58604
    … times. In order to determine the viability, 10% (v/v) of the QBlue viability assay kit (BioChain, Newark, USA), a resazurin based, fluorometric metabolism assay, were added to the culture medium and incubated for one hour. Delivery …
  • Proteasome dysfunction mediates obesity-induced endoplasmic reticulum stress and insulin resistance in the liver
    Toshiki Otoda, Toshinari Takamura, Hirofumi Misu, Tsuguhito Ota, Shigeo Murata, Hiroto Hayashi, Hiroaki Takayama, Akihiro Kikuchi, Takehiro Kanamori, Kosuke R Shima, Fei Lan, Takashi Takeda, Seiichiro Kurita, Kazuhide Ishikura, Yuki Kita, Kaito Iwayama, Ken-ichiro Kato, Masafumi Uno, Yumie Takeshita, Miyuki Yamamoto, Kunpei Tokuyama, Shoichi Iseki, Keiji Tanaka, Shuichi Kaneko
    Diabetes (8.9), 2013-03-22, 62, 811-24
    … Nuclear matrix and cell membrane fractions were extracted from whole cell lysates by using the CNMCS compartmental protein extraction kit (BioChain Institute) according to the manufacturer’s protocol. Electron microscopy. …
  • SIRT3 reverses aging-associated degeneration
    Katharine Brown, Stephanie Xie, Xiaolei Qiu, Mary Mohrin, Jiyung Shin, Yufei Liu, Dan Zhang, David T Scadden, Danica Chen
    Cell Rep 0, 2013-02-21, 3, 319-27
    … Reverse transcription was performed using qScript cDNA SuperMix (Quanta BioSciences). Gene expression was determined by real-time PCR using Eva qPCR SuperMix kit (BioChain Institute) on an ABI StepOnePlus. GAPDH or β-actin was used as an internal control. …
  • Gelatin gel as a carrier of platelet-derived growth factors
    Shuko Suzuki, Natsumi Morimoto, Yoshito Ikada
    J Biomater Appl (2.2), 2013-02-13, , 
    … R&D Systems TGF-β1 and bFGF ELISA kits and Hemoglobin (HGB) assay kit (BioChain, CA, USA) were purchased from Wakenyaku Co., Ltd (Osaka, Japan). … The HGB extracted in the solution was quantified using a HGB assay kit (BioChain, CA, USA). …
  • Reduction of intestinal mucosal immune function in heat-stressed rats and bacterial translocation
    Xiaoxi Liu, Huanrong Li, An Lu, Yougang Zhong, Xiaolin Hou, Ning Wang, Dan Jia, Junlan Zan, Hong Zhao, Jianqin Xu, Fenghua Liu
    Int J Hyperthermia (2.9), 2012-11-16, 28, 756-65
    … Thus, protein from rat jejunum was extracted by a total protein extraction kit (K3011010, BioChain, San Francisco, CA, USA). The concentration of extracted protein was quantified by a BCA protein assay kit (23225, Pierce, Thermo Scientific, Rockford, IL, USA). … 
  • Solution structure and siRNA-mediated knockdown analysis of the mitochondrial disease-related protein C12orf65
    Hiroyuki Kogure, Yusuke Hikawa, Mamoru Hagihara, Naoya Tochio, Seizo Koshiba, Yusuke Inoue, Peter Güntert, Takanori Kigawa, Shigeyuki Yokoyama, Nobukazu Nameki
    Proteins (2.8), 2012-11-04, 80, 2629-42
    … Cytochrome c oxidase assay. The cytochrome c oxidase assay was conducted using the Mitochondria Isolation Kit for Cultured Cells (PIERCE) and the cytochrome c oxidase activity assay kit (BioChain) according to the manufacturers’ instructions. Results. …
  • Ischemia-reperfusion induces myocardial infarction through mitochondrial Ca²⁺ overload
    Kaori Shintani-Ishida, Makoto Inui, Ken-Ichi Yoshida
    J. Mol. Cell. Cardiol. (5.5), 2012-08-03, 53, 233-9
    … The mitochondria (approximately 0.2 mg) isolated using a Mitochondria Isolation Kit (BioChain, Hayward, CA) were preincubated at 30 °C for 10 min in medium containing 110 mM KCl, 20 mM MOPS, 10 mM Tris–HCl, 0.5 μM rotenone and 0.5 μM antimycin (pH 7.4). … 
  • Carnosic acid (CA) prevents lipid accumulation in hepatocytes through the EGFR/MAPK pathway
    Ting Wang, Yasuhiro Takikawa, Takahito Tabuchi, Takumi Satoh, Kunio Kosaka, Kazuyuki Suzuki
    J. Gastroenterol. (3.6), 2012-07-19, 47, 805-13
    … tractant protein 1 (MCP-1). Western blot analysis Total protein was isolated from liver tissue or HepG2 cells by a total protein extraction kit purchased from BioChain Institute, Inc. (Hayward, CA, USA). The nuclear fraction was …
  • Increased Cdk5/p35 activity in the dentate gyrus mediates depressive-like behaviour in rats
    Wei-Li Zhu, Hai-Shui Shi, Shen-Jun Wang, Chun-Mei Xu, Wen-Gao Jiang, Xi Wang, Ping Wu, Qian-Qian Li, Zeng-Bo Ding, Lin Lu
    Int. J. Neuropsychopharmacol. (4.7), 2012-07-11, 15, 795-809
    … Beyotime Biotechnology, China). The cytoplasmic and membrane fractions were sep- arated using the CNM (cytoplasmic, nuclear, mem- brane) Compartment Protein Extraction kit (K3012010, BioChain Institute, USA). The protein …
  • Cellular localization of aquaporin mRNA in hybrid poplar stems
    Adriana M Almeida-Rodriguez, Uwe G Hacke
    Am. J. Bot. (3.1), 2012-07-10, 99, 1249-54
    … al. (2006). Sense probe hybridizations were used as controls. In situ hybridization was performed using an IsHyb In Situ Hybridization Kit (BioChain, Hayward, California, USA) following the manufacturer’s instructions. An additional …
  • Identification of novel DNA methylation markers in colorectal cancer using MIRA-based microarrays
    Hai Li, Yong Du, Dong Zhang, Li-Na Wang, Chun Yang, Bin Liu, Wei-Jie Wang, Lei Shi, Wei-Guo Hong, Liang Zhang, Yin-Xue Yang
    Oncol. Rep. (1.7), 2012-07-09, 28, 99-104
    … K5011425, BioChain Institute, Inc., Hayward, CA) according to the manufacturer’s instructions. … First, DNA was sodium bisulfite modified by using the DNA methylation detection kit (BioChain) as according to the manufacturer’s instructions. …
  • CD73-generated adenosine promotes osteoblast differentiation
    Masahide Takedachi, Hiroyuki Oohara, Brenda J Smith, Mitsuyoshi Iyama, Mariko Kobashi, Kenichiro Maeda, Courtney L Long, Mary B Humphrey, Barbara J Stoecker, Satoru Toyosawa, Linda F Thompson, Shinya Murakami
    J. Cell. Physiol. (4), 2012-06-27, 227, 2622-31
    … Serum inorganic phosphate was determined by the improved Malachite Green method utilizing the malachite green dye and molybdate provided by the Phosphate assay kit (BioChain, Hayward, CA). Reverse transcription (RT)-PCR. …
  • In vivo clearance and toxicity of monodisperse iron oxide nanocrystals
    Luo Gu, Ronnie H Fang, Michael J Sailor, Ji-Ho Park
    ACS Nano (9.9), 2012-06-26, 6, 4947-54
    … The iron concentration of the serum sample was analyzed using an iron assay kit (BioChain Institute, Inc.), and the blood half-life was calculated by fitting the absorbance data to a single-exponential equation using a one-compartment open pharmacokinetic model(28) (mean …
  • Characterization of a novel splice variant of δ ENaC subunit in human lungs
    Run-Zhen Zhao, Hong-Guang Nie, Xue-Feng Su, Dong-Yun Han, Andrew Lee, Yao Huang, Yongchang Chang, Sadis Matalon, Hong-Long Ji
    Am. J. Physiol. Lung Cell Mol. Physiol. (4.1), 2012-06-15, 302, L1262-72
    … Following two washes with DEPC-PBS, slides were treated with Proteinase K (100 μg/ml) at 37°C for 15 min. Slides were rinsed once with DEPC-water and prehybridized at 42°C for 2 h in prehybridization solution (IsHyb ISH kit, BioChain Institute, Hayward, CA). …
  • Expression of lactoperoxidase in differentiated mouse colon epithelial cells
    Byung-Wook Kim, R Steven Esworthy, Maria A Hahn, Gerd P Pfeifer, Fong-Fong Chu
    Free Radic. Biol. Med. (5.7), 2012-05-01, 52, 1569-76
    … 3′. The mRNA levels were normalized against β-actin mRNA (5′-GCTCCTCCTGAGCGCAAGT- 3′ and 5′-TCATCGTACTCCTGCTTGCTGAT-3′). All qPCRs were performed with the Eva qPCR SuperMix kit containing SYBR green dye (BioChain Institute, Hayward, CA …
  • Absence of μ opioid receptor mRNA expression in astrocytes and microglia of rat spinal cord
    Sheng-Chin Kao, Xiuli Zhao, Chun-Yi Lee, Fidelis E Atianjoh, Estelle B Gauda, Myron Yaster, Yuan-Xiang Tao
    Neuroreport (1.8), 2012-04-18, 23, 378-84
    … Life Sciences, Piscataway, NJ). In situ hybridization histochemistry was conducted by using the IsHyb in Situ Hybridization kit (BioChain Institute, Inc., Hayward, CA) following the manufacturer’s instructions. Briefly, the sections …
  • Allosteric modulation of beta1 integrin function induces lung tissue repair
    Rehab Aljamal-Naylor, Linda Wilson, Susan McIntyre, Fiona Rossi, Beth Harrison, Mark Marsden, David J Harrison
    Adv Pharmacol Sci 0, 2012-04-16, 2012, 768720
    … At the end of the stretch, the media was aspirated, and protein extracted from the cell layer was fractionated using the compartmental protein extraction kit (CNMCS, BioChain). Protein content was measured using the BCA methods. …
  • Eight new mutations and the expanding phenotype variability in muscular dystrophy caused by ANO5
    S Penttilä, J Palmio, T Suominen, O Raheem, A Evilä, N Muelas Gomez, G Tasca, L B Waddell, N F Clarke, A Barboi, P Hackman, B Udd
    Neurology (8), 2012-03-20, 78, 897-903
    … RNA was extracted from muscle tissue with a Dr. P Kit (BioChain, Hayward, CA) for Finnish patients or by a modified TRIzol extraction protocol (TRI Reagent; Molecular Research Center, Cincinnati, OH) for Australian patients. …
  • The level of DING proteins is increased in HIV-infected patients: in vitro and in vivo studies
    Ahmed Djeghader, Gerard Aragonès, Nune Darbinian, Mikael Elias, Daniel Gonzalez, Anabel García-Heredia, Raúl Beltrán-Debón, Rafal Kaminski, Guillaume Gotthard, Julien Hiblot, Anna Rull, Olivier Rohr, Christian Schwartz, Carlos Alonso-Villaverde, Jorge Joven, Jordi Camps, Eric Chabriere
    PLoS ONE (4.4), 2012-03-19, 7, e33062
    … p24 ELISA. Approximately 1×10 6 PBMC were infected with HIV-1 JF-RL. Six days post-infection, supernatants were collected and analyzed for the presence of p24 by ELISA assay using p24 ELISA Assay kit purchased from BioChain (BioChain Institute, Inc., Hayward, CA). …
  • Association of six susceptibility Loci with prostate cancer in northern chinese men
    Yu-Rong Zhang, Yong Xu, Kuo Yang, Ming Liu, Dong Wei, Yao-Guang Zhang, Xiao-Hong Shi, Jian-Ye Wang, Fan Yang, Xin Wang, Si-Ying Liang, Cheng-Xiao Zhao, Fei Wang, Xin Chen, Liang Sun, Xiao-Quan Zhu, Ling Zhu, Yi-Ge Yang, Lei Tang, Hai-Yan Jiao, Zheng-Hao Huo, Ze Yang
    Asian Pac. J. Cancer Prev. (1.2), 2012-03-07, 13, 6273-6
    … decent risk loci (MSMB, rs10993994, T; 11p15, rs7127900, A; 11q13, rs7931342, T; HNF1B, rs4430796, A; 17q24, rs11859962, G; and KLK2, rs2735839, A). Blood genomic DNA was extracted using a whole blood genomic DNA extraction kit (BioChain Science-Technology …
  • Interaction of α-synuclein with vesicles that mimic mitochondrial membranes
    Imola G Zigoneanu, Yoo Jeong Yang, Alexander S Krois, Emdadul Haque, Gary J Pielak
    Biochim. Biophys. Acta 0, 2012-03-06, 1818, 512-9
    … from Pierce. Their activity was tested by assessing the cytochrome c oxidase activity with the Mitochondria Activity Assay Kit from BioChain Institute, Inc. (Hayward, CA). 2.3. Mitochondrial import of α-synuclein. Freshly isolated …
  • MicroRNA-1826 targets VEGFC, beta-catenin (CTNNB1) and MEK1 (MAP2K1) in human bladder cancer
    Hiroshi Hirata, Yuji Hinoda, Koji Ueno, Varahram Shahryari, Z Laura Tabatabai, Rajvir Dahiya
    Carcinogenesis (5.4), 2012-01-29, 33, 41-8
    … In situ hybridization. We performed ISH using BC tissue array (catalog#: BL801; US Biomax, Inc) and IsHyb In Situ Hybridization Kit (BioChain, Hayward, CA) in order to detect miR-1826 in human bladder tissues (normal and cancer) following the manufacturers’ protocol. …
  • Analysis of osteopontin levels for the identification of asymptomatic patients with calcific aortic valve disease
    Juan B Grau, Paolo Poggio, Rachana Sainger, William J Vernick, William F Seefried, Emanuela Branchetti, Benjamin C Field, Joseph E Bavaria, Michael A Acker, Giovanni Ferrari
    Ann. Thorac. Surg. (3.6), 2012-01-21, 93, 79-86
    … In situ mRNA hybridization was used to detect total OPN and its isoforms with the custom-designed probes purchased from Exiqon (Woburn, MA). An in situ hybridization kit from BioChain Institute Inc (Hayward, CA) was used to perform the detection steps. In Vitro Calcification. …
  • Biao Feng, Shali Chen, Kara McArthur, Yuexiu Wu, Subhrojit Sen, Qingming Ding, Ross D. Feldman, and Subrata Chakrabarti
    miR-146a–Mediated Extracellular Matrix Protein Production in Chronic Diabetes Complications
    Diabetes, Nov 2011; 60: 2975 – 2984. 
    … …detection probes (Exiqon, Vedbaek, Denmark) were used to detect miR-146a expression using an in situ hybridization (ISH) kit (Biochain Institute, Hayward, CA), as described (22,32). Scrambled probes and no-probe controls were used as controls. Statistical… … 
  • YanFei Qi, Vinayak Shenoy, Fong Wong, Hongwei Li, Aqeela Afzal, J. Mocco, Colin Sumners, Mohan K. Raizada, and Michael J. Katovich
    Lentivirus-mediated overexpression of angiotensin-(1–7) attenuated ischaemia-induced cardiac pathophysiology
    Exp Physiol, Sep 2011; 96: 863 – 874. 
    … …treatment. One hour after exposure to hypoxia, cell viability was tested using CellQuanti-BlueTM Cell Viability Assay Kits (BioChain, Hayward, CA, USA). Twenty-four hours after exposure to hypoxia, cell lysate was collected to isolate RNA. RNA isolation… … 
  • Yifan Geng, Jeffrey J. Hsu, Jinxiu Lu, Tabitha C. Ting, Makoto Miyazaki, Linda L. Demer, and Yin Tintut
    Role of Cellular Cholesterol Metabolism in Vascular Cell Calcification
    J. Biol. Chem., Sep 2011; 286: 33701 – 33706. 
    … …from cells using TRIzol reagent (Invitrogen). Real-time RT-quantitative PCR (qPCR) was performed using a One-Step qRT-PCR kit (BioChain Institute, Inc. Hayward, CA) in an Mx3005P system (Stratagene La Jolla, CA). beta-Actin was used for normalization. Data Analysis… … 
  • Seong O. Suh, Yi Chen, Mohd Saif Zaman, Hiroshi Hirata, Soichiro Yamamura, Varahram Shahryari, Jan Liu, Z.Laura Tabatabai, Sanjay Kakar, Guoren Deng, Yuichiro Tanaka, and Rajvir Dahiya
    MicroRNA-145 is regulated by DNA methylation and p53 gene mutation in prostate cancer
    Carcinogenesis, May 2011; 32: 772 – 778.  
    … …muM; 5-AGGGATTCCTGGGAAAACTGGAC-3, Exiqon, Tustin, CA) complementary to mature miR-145 and IsHyb in situ hybridization Kit (BioChain, Hayward, CA) following the protocol from Exiqon. Briefly, 5 mum sections were deparaffinized, hydrated, treated with proteinase… … 
  • Kee K. Kim, Yong C. Kim, Robert S. Adelstein, and Sachiyo Kawamoto
    Fox-3 and PSF interact to activate neural cell-specific alternative splicing
    Nucleic Acids Res., Apr 2011; 39: 3064 – 3078. 
    … …5-CTGGGGTTTCACGGGCTTAGGCGATTCCTG-3′. Hybridization and detection were carried out using an IsHyb In Situ Hybridization kit (Biochain Institute Inc.) and a DNADetector System (KPL Inc.) according to the manufacturers protocols. The specimens were examined using… … 
  • Cornelia Bigler, Helmut Hopfer, Doris Danner, Monica Schaller, Michael J. Mihatsch, and Marten Trendelenburg
    Anti-C1q autoantibodies do not correlate with the occurrence or severity of experimental lupus nephritis
    Nephrol. Dial. Transplant., Apr 2011; 26: 1220 – 1228. 
    … …was measured by quantitative colorimetric determination at 510-nm using a commercially available assay (Creatinine Assay Kit, Biochain, Hayward, CA, USA). Antibody elution from kidneys The procedure was performed as described before [9]. In short, six kidneys… … 
  • Sandrine Vitry, Julie Bruyère, Michaël Hocquemiller, Stéphanie Bigou, Jérôme Ausseil, Marie-Anne Colle, Marie-Christine Prévost, and Jean Michel Heard
    Storage Vesicles in Neurons Are Related to Golgi Complex Alterations in Mucopolysaccharidosis IIIB
    Am. J. Pathol., Dec 2010; 177: 2984 – 2999. 
    …. …NaCl, 50 mmol/L Tris pH7.8, protease inhibitors). Membrane proteins were extracted with a CNMCS Compartmental extraction kit (Biochain, Hayward, US) according to manufacturer recommendations. Endo-H (Biolabs, Beverly, US) and peptide N-glycosidase F (PNGase… … 
  • Chi-Wen Lo, Min-Wei Chen, Michael Hsiao, Shiuan Wang, Chi-An Chen, Sheng-Mou Hsiao, Jeng-Shou Chang, Tsung-Ching Lai, Stefan Rose-John, Min-Liang Kuo, and Lin-Hung Wei
    IL-6 Trans-Signaling in Formation and Progression of Malignant Ascites in Ovarian Cancer
    Cancer Res., Jan 2011; 71: 424 – 434. 
    … …Tyr 685; ECM Biosciences). Cytoplasmic VE-cadherin protein was prepared by the CNMCS compartmental protein extraction kit (BioChain). Cytotoxicity assay Cell survival was determined using the MTT assay (Sigma). Assay of chemotactic endothelial cell… … 
  • Haiping Zhou, Yan Liu, Feng He, Lan Mo, Tung-Tien Sun, and Xue-Ru Wu
    Temporally and spatially controllable gene expression and knockout in mouse urothelium
    Am J Physiol Renal Physiol, Aug 2010; 299: F387 – F395. 
    … …with digoxigenin-tagged cRNA probes and the hybridization was visualized by anti-digoxigenin immunohistochemical staining (Biochain). The expression of EGFP was assessed by directly examining the frozen sections of 4% paraformaldehyde-fixed mouse bladder… … 
  • Peng Jin, Xiao-juan Lu, Jian-qiu Sheng, Lei Fu, Xiao-ming Meng, Xin Wang, Tai-ping Shi, Shi-rong Li, and Jianyu Rao
    Estrogen Stimulates the Expression of Mismatch Repair Gene hMLH1 in Colonic Epithelial Cells
    Cancer Prevention Research, Aug 2010; 3: 910 – 916. 
    … …the results of semiquantitative RT-PCR in COLO205 cells. PCR was done in a volume of 20 muL containing 12.5 muL 2 PCR Mix (BioChain), 2 muL cDNA, 0.3 muL EvaGreen (Biotium), 0.5 muL of primers each, and 4.2 muL DEPC-treated water. The mixtures were amplified… … 
  • Joanne L. Welton, Sanjay Khanna, Peter J. Giles, Paul Brennan, Ian A. Brewis, John Staffurth, Malcolm D. Mason, and Aled Clayton
    Proteomics Analysis of Bladder Cancer Exosomes
    Mol. Cell. Proteomics, Jun 2010; 9: 1324 – 1338. 
    … …basigin, hnRNPK, gp96, cytokeratins 18 and 17, and CD44 (Santa Cruz Biotechnology), glyceraldehyde-3-phosphate dehydrogenase (BioChain Institute, Inc.), CD9 (RD Systems), and CD63 and CD81 (Serotec). Anti-5T4 was a gift from Dr. R. Harrop (Oxford BioMedica UK… … 
  • Wendy Tseng, Jinxiu Lu, Gail A. Bishop, Andrew D. Watson, Andrew P. Sage, Linda Demer, and Yin Tintut
    Regulation of interleukin-6 expression in osteoblasts by oxidized phospholipids
    J. Lipid Res., May 2010; 51: 1010 – 1016. 
    … …Total RNA was isolated using TRIzol reagent (Invitrogen). Real-time PCR was performed using the One-Step qRT-PCR SuperMix Kit (BioChain, Inc.) and Mx3005P (Stratagene). DNA constructs Generation of murine IL-6 promoter luciferase reporter constructs was previously… … 
  • Ali Ö. Yildirim, Vandana Muyal, Gerrit John, Bernd Müller, Carola Seifart, Michael Kasper, and Heinz Fehrenbach
    Palifermin Induces Alveolar Maintenance Programs in Emphysematous Mice
    Am. J. Respir. Crit. Care Med., Apr 2010; 181: 705 – 717. 
    … …details.) Protein Isolation and Immunoblotting Protein was extracted from lung tissue using total protein extraction kit (Biochain Institute, Hayward, CA). Protein concentrations were measured using BCA protein assay kit (Pierce, Rockford, IL). After fragmentation… … 
  • Juan Lucas Argueso, Marcelo F. Carazzolle, Piotr A. Mieczkowski, Fabiana M. Duarte, Osmar V.C. Netto, Silvia K. Missawa, Felipe Galzerani, Gustavo G.L. Costa, Ramon O. Vidal, Melline F. Noronha, Margaret Dominska, Maria G.S. Andrietta, Sílvio R. Andrietta, Anderson F. Cunha, Luiz H. Gomes, Flavio C.A. Tavares, André R. Alcarde, Fred S. Dietrich, John H. McCusker, Thomas D. Petes, and Gonçalo A.G. Pereira
    Genome structure of a Saccharomyces cerevisiae strain widely used in bioethanol production
    Genome Res., Dec 2009; 19: 2258 – 2270. 
    … …the weight of the cell pellets. The supernatant was frozen and later used to determine the ethanol concentration using the BioChain Saccharide Removal and Ethanol Assay kits in sequence according to the manufacturer’s recommendations. Microarray and physical… … 
  • Ali O Yildirim, Vandana Muyal, Gerrit John, Bernd Mueller, Carola Seifart, Michael Kasper, and Heinz Fehrenbach
    Palifermin Induces Alveolar Maintenance Programs in Emphysematous Mice
    Am. J. Respir. Crit. Care Med., Dec 2009; 10.1164/rccm.200804-573OC.
    … …extracted from lung tissue using total protein extraction kit (Biochain Institute, Hayward, USA). Protein concentrations were measured using BCATM protein assay kit (Pierce, Rockford, USA). After fragmentation…extracted from lung tissue using total protein extraction kit (Biochain Institute, Hayward, USA) according to the manufacturer’s protocol… … 
  • Géraldine Arrode-Brusés, Darlene Sheffer, Ramakrishna Hegde, Sukbir Dhillon, Zhengian Liu, François Villinger, Opendra Narayan, and Yahia Chebloune
    Characterization of T cell responses in macaques immunized with a single dose of HIV DNA vaccine
    J. Virol., Nov 2009; 10.1128/JVI.01846-09. 
    … …immunized animals have developed specific antibodies to HIV we used a commercial ELISA kit for detection of HIV-1 and 2 Abs (BioChain Institute). To examine whether DNA immunization has induced autoimmune anti-DNA responses we also used a commercial kit that… … 
  • Myoung-Gwi Ryou, Devin C Flaherty, Besim Hoxha, Jie Sun, Hunaid Gurji, Steven Rodriguez, Glenn Bell, Albert H Olivencia-Yurvati, and Robert T Mallet
    Pyruvate-fortified cardioplegia evokes myocardial erythropoietin signaling in swine undergoing cardiopulmonary bypass
    Am J Physiol Heart Circ Physiol, Nov 2009; 297: H1914 – H1922. 
    … …arterial plasma was obtained by centrifugation. Plasma EPO concentrations were measured by enzyme-linked immunosorbent assay (Biochain, Hayward, CA). Immune complexes detected at 450 nm were quantified by comparison with a recombinant EPO standard curve. Myocardial… … 
  • Hai-Chun Yang, Sebastien Deleuze, Yiqin Zuo, Sebastian A. Potthoff, Li-Jun Ma, and Agnes B. Fogo
    The PPAR  Agonist Pioglitazone Ameliorates Aging-Related Progressive Renal Injury
    J. Am. Soc. Nephrol., Nov 2009; 20: 2380 – 2388. 
    … …activity in the soluble and membrane-bound mitochondria sample was assayed for mitochondria activity using a commercial kit (Biochain Institute, Hayward, CA). Mitochondrial DNA Deletion Cortical tissue (100 mg) was homogenized, and mitochondrial DNA was extracted… … 
  • Cho-Kai Wu, Chuen-Den Tseng, Yin-Tsen Huang, Chia-Shan Hsieh, Wei-Shan Tsai, Jiunn-Lee Lin, Fu-Tien Chiang, and Chia-Ti Tsai
    Angiotensin II does not influence expression of sarcoplasmic reticulum Ca2 + ATPase in atrial myocytes
    Journal of Renin-Angiotensin-Aldosterone System, Sep 2009; 10: 121 – 126. 
    … …treated with Ang II (10-6 mol/L) and subsequently harvested after 0, 2, 6, and 24 hours using a Nonide P40-based lysis buffer (BioChain Institute, Inc., Hayward, CA, USA) (13 ml HEPES pH 7.9, MgCl2, KCl, EDTA, sucrose, glycerol, sodium deoxycholate, Nonide P40… … 
  • Guomin Jiang, Yan Ke, Deming Sun, Hao Li, Mark Ihnen, Marcia M. Jumblatt, Gary Foulks, Yali Wang, Yang Bian, Henry J. Kaplan, and Hui Shao
    A New Model of Experimental Autoimmune Keratoconjunctivitis Sicca (KCS) Induced in Lewis Rat by the Autoantigen Klk1b22
    Invest. Ophthalmol. Vis. Sci., May 2009; 50: 2245 – 2254.
    … …glands and salivary glands of B6 mice by homogenization and sonication following the method of a total protein extraction kit (BioChain Institute, Inc., Hayward, CA). Briefly, the glands were isolated from PBS perfused mice, cut into small pieces, and incubated… …
  • Dane Meredith, Manikandan Panchatcharam, Sumitra Miriyala, Yau-Sheng Tsai, Andrew J. Morris, Nobuyo Maeda, George A. Stouffer, and Susan S. Smyth
    Dominant-Negative Loss of PPAR  Function Enhances Smooth Muscle Cell Proliferation, Migration, and Vascular Remodeling
    Arterioscler. Thromb. Vasc. Biol., Apr 2009; 29: 465 – 471. 
    … …FBS. The number of viable cells was quantified after 24, 48, 72, and 96 through incubation for 2 hours in a WST-1 solution (Biochain). WST-1 is cleaved by mitochondrial succinate-tetrazolium reductase in viable cells to form formazan dye. The amount of formazan… … 
  • Dane Meredith, Manikandan Panchatcharam, Sumitra Miriyala, Yau-Sheng Tsai, Andrew J. Morris, Nobuyo Maeda, George A. Stouffer, and Susan S. Smyth
    Dominant-Negative Loss of PPAR  Function Enhances Smooth Muscle Cell Proliferation, Migration, and Vascular Remodeling
    Arterioscler. Thromb. Vasc. Biol., Jan 2009; 10.1161/ATVBAHA.109.184234. 
    … …FBS. The number of viable cells was quantified after 24, 48, 72, and 96 through incubation for 2 hours in a WST-1 solution (Biochain). WST-1 is cleaved by mitochondrial succinate-tetrazolium reductase in viable cells to form formazan dye. The amount of formazan… …  … 
  • Sarbani Ghoshal, Jassir Witta, Jian Zhong, Willem de Villiers, and Erik Eckhardt
    Chylomicrons promote intestinal absorption of lipopolysaccharides
    J. Lipid Res., Jan 2009; 50: 90 – 97. 
    … …tubes were certified endotoxin free. RT-PCR RNA was transcribed into cDNA with MMLV reverse transcriptase as part of the Biochain Optimax kit, using random hexamers. Expression of TNFalpha cDNA was quantified with real-time PCR using the primer pairs 5… … 
  • Katarina Stark, Zhong-Liu Wu, Cheryl J. Bartleson, and F. Peter Guengerich
    mRNA Distribution and Heterologous Expression of Orphan Cytochrome P450 20A1
    Drug Metab. Dispos., Sep 2008; 36: 1930 – 1937. 
    … …hybridization fluorescence sections were thawed to room temperature before a hybridization solution (IsHyb In Situ Hybridization Kit; BioChain Institute, Hayward, CA) was added, and sections were prehybridized in a humidified chamber (2 h at 42C). The sections were… 
  • Wenli Liu, Yueqin Liu, Jianqiong Zhu, Elizabeth Wright, Ivan Ding, and Griffin P. Rodgers
    Reduced hGC-1 Protein Expression Is Associated with Malignant Progression of Colon Carcinoma
    Clin. Cancer Res., Feb 2008; 14: 1041 – 1049. 
    … …with antisense and sense Dig-labeled hGC-1 probe (2 ng/muL) at 62C for 15 h with rotation using an in situ hybridization kit (Biochain). The result was detected with anti-dig antibody (1:1,000) and nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate… … 
    Ref. Link 
  • Yingqiu Xie, Kexin Xu, Douglas E. Linn, Xi Yang, Zhiyong Guo, Hermela Shimelis, Takeo Nakanishi, Douglas D. Ross, Hegang Chen, Ladan Fazli, Martin E. Gleave, and Yun Qiu 
    The 44-kDa Pim-1 Kinase Phosphorylates BCRP/ABCG2 and Thereby Promotes Its Multimerization and Drug-resistant Activity in Human Prostate Cancer Cells
    J. Biol. Chem., Feb 2008; 283: 3349 – 3356.
    … …for three times at 4 C with the lysis buffer. Cell fractionation was carried out using compartmental protein extraction kit (BioChain, Inc.). Immunoblotting was performed as described previously (24). Briefly, blots were incubated with primary antibodies, 1… … 
    Ref. link 
  • Chun-Chun Li, Tsai-Chen Chiang, Tsung-Sheng Wu, Gustavo Pacheco-Rodriguez, Joel Moss, and Fang-Jen S. Lee
    ARL4D Recruits Cytohesin-2/ARNO to Modulate Actin Remodeling
    Mol. Biol. Cell, Nov 2007; 18: 4420 – 4437. 
    … …DSP, and then the cytosol and membrane fractions of COS-7 cells were prepared using a CNM compartment protein extraction kit (BioChain Institute, Hayward, CA) according to the manufacturer’s instructions. Pull-Down Assay for ARF6-GTP The activation levels… … 
    Ref. link 
  • Chang-Yi Cui, Makoto Kunisada, Diana Esibizione, Sergei I. Grivennikov, Yulan Piao, Sergei A. Nedospasov, and David Schlessinger 
    Lymphotoxin-?regulates periderm differentiation during embryonic skin development
    Hum. Mol. Genet., Nov 2007; 16: 2583 – 2590.
    … …and 0.1x SSC at 60C, sections were incubated with anti-DIG antibody for 2 h and signals were visualized with NBT/BCIP stain (Biochain, 1:1000 dilution). ACKNOWLEDGEMENTS We thank Drs M. Ko and R. Nagaraja for helpful discussions and technical advices… … 
    Ref. link
  • Chun-Chun Li, Tsai-Chen Chiang, Tsung-Sheng Wu, Gustavo Pacheco-Rodriguez, Joel Moss, and Fang-Jen S. Lee
    ARL4D Recruits Cytohesin-2/ARNO to Modulate Actin Remodeling
    Mol. Biol. Cell, Sep 2007; 10.1091/mbc.E07-02-0149.
    … …DSP and then the cytosol and membrane fractions of COS-7 cells were prepared using a CNM compartment protein extraction kit (BioChain Institute Inc., Hayward, CA) according to the manufacturer’s instructions. Pull-down Assay for ARF6-GTP The activation levels… …
    Ref. link 
  • Kenneth D. Bromberg, Harriet M. Kluger, Agnes Delaunay, Sabiha Abbas, Kyle A. DiVito, Stan Krajewski, and Ze’ev Ronai 
    Increased Expression of the E3 Ubiquitin Ligase RNF5 Is Associated with Decreased Survival in Breast Cancer
    Cancer Res., Sep 2007; 67: 8172 – 8179. 
    … …and Methods Tumor tissue mRNA array. The BioChain Human Adult Tumor/Normal Tissues mRNA Array (BioChain Institute, Inc.) was used to analyze RNF5…overnight using FastHyb-Hybridization Solution (BioChain Institute) according to the manufacturers… … 
    Ref. link
  • Daisuke Shiokawa, Tokiyoshi Matsushita, Yukari Shika, Mamoru Shimizu, Masahiro Maeda, and Sei-ichi Tanuma
    DNase X Is a Glycosylphosphatidylinositol-anchored Membrane Enzyme That Provides a Barrier to Endocytosis-mediated Transfer of a Foreign Gene
    J. Biol. Chem., Jun 2007; 282: 17132 – 17140.
    … …paraffin-embedded normal human tissues were obtained from BioChain. Immunohistochemistry was performed using a cell and tissue…slides, pretreated with an antigen retrieval dewax solution (BioChain), were incubated with anti-DNase X mAb at a concentration of… … 
    Ref. link 
  • Mark E. Lasbury, Salim Merali, Pamela J. Durant, Dennis Tschang, Chad A. Ray, and Chao-Hung Lee 
    Polyamine-mediated apoptosis of alveolar macrophages during Pneumocystis pneumonia
    J. Biol. Chem., Feb 2007; 10.1074/jbc.M611686200. 
    … …1 by vacuum centrifugation) were incubated with the proprietary chromogenic, urea-complexing reagent of the Urea assay kit (Biochain, Hayward, CA). Samples were read at 520 nm after a 20-min incubation at room temperature. Sample absorbance was divided by… … 
    Ref. link
  • Emily I. Chen, Johannes Hewel, Joseph S. Krueger, Claire Tiraby, Martin R. Weber, Anastasia Kralli, Katja Becker, John R. Yates, III, and Brunhilde Felding-Habermann
    Adaptation of Energy Metabolism in Breast Cancer Brain Metastases
    Cancer Res., Feb 2007; 67: 1472 – 1486.
    … …extracts were prepared with the TotalProteinExtraction kit (BioChain, Hayward, CA) and protein concentration was determined…extracts were prepared with the TotalProteinExtraction kit (BioChain) and protein concentrations determined by BCA assay (Pierce… … 
    Ref. link 
  • Pinthus JH, Bryskin I, Trachtenberg J, Lu JP, Singh G, Fridman E, Wilson BC. 
    Androgen Induces Adaptation to Oxidative Stress in Prostate Cancer: Implications for Treatment with Radiation Therapy.
    Neoplasia. 2007 Jan; 9(1): 68-80. 
    … …Centrifuging at 12,000g for 15 minutes separated insoluble materials. Supernatants were dissolved in Laemmli sample buffer. Protein purification from tumor tissues was performed using a protein extraction kit (Biochain Institute, Inc., Greenland, NH)…. … 
    Ref. link
  • Jia-Perng Chen, Hsin-Lin Lu, Szu-Liang Lai, Gabriele S. Campanella, Jui-Ming Sung, Mei-Yi Lu, Betty A. Wu-Hsieh, Yi-Ling Lin, Thomas E. Lane, Andrew D. Luster, and Fang Liao
    Dengue Virus Induces Expression of CXC Chemokine Ligand 10/IFN–Inducible Protein 10, Which Competitively Inhibits Viral Binding to Cell Surface Heparan Sulfate
    J. Immunol., Sep 2006; 177: 3185 – 3192.
    … …the reference were approximately equal. ELISA Livers were weighed and homogenized on ice in protein extraction buffer (BioChain Institute) using a tapered tissue grinder (Wheaton Science Products). The resultant homogenates were centrifuged at 15,000… … 
    Ref. link 
  • Kasie K. Cole-Edwards, Alberto E. Musto, and Nicolas G. Bazan 
    c-Jun N-Terminal Kinase Activation Responses Induced by Hippocampal Kindling Are Mediated by Reactive Astrocytes
    J. Neurosci., Aug 2006; 26: 8295 – 8304.
    … …Alternatively, to separate brain tissue into cytosolic, membrane, and nuclear protein fractions, a compartmental extraction kit from BioChain (Hayward, CA) was used. Tissue was homogenized in a Dounce homogenizer with five strokes of the loose-fitting pestle and manipulated… … 
    Ref. link
  • Brian J. Siroky, William B. Ferguson, Amanda L. Fuson, Yi Xie, Attila Fintha, Peter Komlosi, Bradley K. Yoder, Erik M. Schwiebert, Lisa M. Guay-Woodford, and P. Darwin Bell
    Loss of primary cilia results in deregulated and unabated apical calcium entry in ARPKD collecting duct cells
    Am J Physiol Renal Physiol, Jun 2006; 290: F1320 – F1328. 
    … …PC2 antibody. Cytosolic and membrane protein fractions were isolated using the CNM Compartment Protein Extraction Kit (BioChain). Proteins were separated using polyacrylamide electrophoresis and transferred onto PVDF membranes. Proteins labeled with… …
  • Jie Pan, Ian Copland, Martin Post, Herman Yeger, and Ernest Cutz
    Mechanical stretch-induced serotonin release from pulmonary neuroendocrine cells: implications for lung development
    Am J Physiol Lung Cell Mol Physiol, Jan 2006; 290: L185 – L193.
    … …added for 1 h. The membranes were washed and incubated using the Attoglow Western blot system with Millennium Enhancer (BioChain, Hayward, CA) and exposed to autoradiography film. The band densities within the linear range were analyzed with NIH Scion… … 
  • Takaho Okada, Masanori Akada, Tomonobu Fujita, Takashi Iwata, Yasufumi Goto, Kenji Kido, Tsutomu Okada, Yuriko Matsuzaki, Kouichi Kobayashi, Seiki Matsuno, Makoto Sunamura, and Yutaka Kawakami
    A Novel Cancer Testis Antigen That Is Frequently Expressed in Pancreatic, Lung, and Endometrial Cancers
    Clin. Cancer Res., Jan 2006; 12: 191 – 197. 
    … …fetal liver, and fetal thymus, were purchased from Clontech (Palo Alto, CA). Total RNA from esophagus was purchased from BioChain Institute, Inc. (Hayward, CA). The pancreatic ductal adenocancer, malignant melanoma, endometrial cancer, stomach cancer… …
  • X. Chang, R. Yamada, A. Suzuki, Y. Kochi, T. Sawada, and K. Yamamoto
    Citrullination of fibronectin in rheumatoid arthritis synovial tissue
    Rheumatology, Nov 2005; 44: 1374 – 1382.
    … …the Total Protein Extraction Kit (Biochain, USA) according to the manufacturers…prostate and thymus adenocarcinoma (BioChain). Fn in the total proteins was precipitated…the Total Protein Extraction Kit (Biochain, USA) according to the manufacturer’s… …
  • Emily I. Chen, Laurence Florens, Fumiko T. Axelrod, Edward Monosov, Carlos F. Barbas III, John R. Yates III, Brunhilde Felding-Habermann, and Jeffrey W. Smith
    Maspin alters the carcinoma proteome 
    FASEB J, Apr 2005; 10.1096/fj.04-2970fje. 
    … …using TotalProteinExtraction kit (BioChain, Hayward, CA), and protein concentration…homogenized in the lysis buffer from the Biochain total protein extraction kit (Biochain). Cellular 20S proteasome activity… … 
  • Robert A. Sack, Lenard Conradi, David Krumholz, Ann Beaton, Sonal Sathe, and Carol Morris
    Membrane Array Characterization of 80 Chemokines, Cytokines, and Growth Factors in Open- and Closed-Eye Tears: Angiogenin and Other Defense System Constituents
    Invest. Ophthalmol. Vis. Sci., Apr 2005; 46: 1228 – 1238. 
    … …membranes were pretreated with a proprietary enhancing agent (Millennium Enhancer) used as directed by the manufacturer (BioChain Institute, Inc., Hayward, CA). Increased sensitivity unfortunately resulted in a high level of background luminescence… … 
  • Robert A. Sack, Lenard Conradi, David Krumholz, Ann Beaton, Sonal Sathe, and Carol Morris
    Membrane Array Characterization of 80 Chemokines, Cytokines, and Growth Factors in Open- and Closed-Eye Tears: Angiogenin and Other Defense System Constituents
    Invest. Ophthalmol. Vis. Sci., Apr 2005; 46: 1228 – 1238.
     … were pretreated with a proprietary enhancing agent (Millennium Enhancer) used as directed by the manufacturer (BioChain Institute, Inc., Hayward, CA). .
  • Christian Korn, Sebastian R. Scholz, Oleg Gimadutdinow, Rudi Lurz, Alfred Pingoud, and Gregor Meiss
    Interaction of DNA Fragmentation Factor (DFF) with DNA Reveals an Unprecedented Mechanism for Nuclease Inhibition and Suggests That DFF Can Be Activated in a DNA-bound State
    Biol. Chem., Feb 2005; 280: 6005 – 6015.
     … Endogenous DFF ?Non-detergent cell lysis was performed using the CNM compartmental protein extraction kit (BioChain Institute, Inc.) according to the supplier’s recommendations. …
  • X. Chang, R. Yamada, A. Suzuki, T. Sawada, S. Yoshino, S. Tokuhiro, and K. Yamamoto
    Localization of peptidylarginine deiminase 4 (PADI4) and citrullinated protein in synovial tissue of rheumatoid arthritis
     Rheumatology, Jan 2005; 44: 40 – 50.
     … we purified total protein of RA synovial tissues and leucocytes using total protein extraction kits (Biochain). …
  • Neelam Sharma-Walia, Pramod P. Naranatt, Harinivas H. Krishnan, Ling Zeng, and Bala Chandran
    Kaposi’s Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 Envelope Glycoprotein gB Induces the Integrin-Dependent Focal Adhesion Kinase-Src-Phosphatidylinositol 3-Kinase-Rho GTPase Signal Pathways and Cytoskeletal Rearrangements
    J. Virol., Apr 2004; 78: 4207 – 4223.
     … The CNM compartment protein extraction kit was obtained from the Biochain Institute, Inc., Hayward, Calif. … 

Proteinx

  • Mechanisms of Human Erythrocytic Bioactivation of Nitrite
    Chen Liu, Nadeem Wajih, Xiaohua Liu, Swati Basu, John Janes, Madison Marvel, Christian Keggi, Christine C. Helms, Amber N. Lee, Andrea M. Belanger, Debra I. Diz, Paul J. Laurienti, David L. Caudell, Jun Wang, Mark T. Gladwin, and Daniel B. Kim-Shapiro J. Biol. Chem., Jan 2015; 290: 1281 – 1294.
    …from Jackson ImmunoResearch Laboratories (West Grove, PA). Normal human and mouse liver tissue lysates were purchased from BioChain (Newark, CA). Premade SDS 4?20% linear gradient gels were purchased from Bio-Rad. Protease inhibitor mixture for…
  • TLR7 and TLR8 expression increases tumor cell proliferation and promotes chemoresistance in human pancreatic cancer
    T Grimmig, N Matthes, K Hoeland, S Tripathi… – International journal of …, 2015
     Germany. Published online on: Thursday, July 2, 2015. Pages: 857-866 DOI:10.3892/ijo.2015.3069. Abstract. Chronic  Germany). 
    Normal tissue (protein lysate)was purchased from BioChain Institute Inc. (Hayward, CA, USA).
  • Cilostazol Induces PGI 2 Production via Activation of the Downstream Epac-1/Rap1 Signaling Cascade to Increase Intracellular Calcium by PLCε and to Activate p44/ …
    A Hashimoto, M Tanaka, S Takeda, H Ito, K Nagano – PloS one, 2015 Received: January 29, 2015; Accepted: June 19, 2015; Published: July 16, 2015.
    Copyright: ©2015 Hashimoto et al  positive and negative control for PDE3A and 3B, total protein lysates of normal adult human adipose tissue and artery were purchased from BioChain Institute, Inc 
     
  • Mechanisms of Human Erythrocytic Bioactivation of Nitrite
    Chen Liu, Nadeem Wajih, Xiaohua Liu, Swati Basu, John Janes, Madison Marvel, Christian Keggi, Christine C. Helms, Amber N. Lee, Andrea M. Belanger, Debra I. Diz, Paul J. Laurienti, David L. Caudell, Jun Wang, Mark T. Gladwin, and Daniel B. Kim-Shapiro
    J. Biol. Chem., Jan 2015; 290: 1281 – 1294.
    …from Jackson ImmunoResearch Laboratories (West Grove, PA). Normal human and mouse liver tissue lysates were purchased from BioChain (Newark, CA). Premade SDS 4?20% linear gradient gels were purchased from Bio-Rad. Protease inhibitor mixture for…
  • Pim1 kinase is upregulated in glioblastoma multiforme and mediates tumor cell survival
    S Herzog, MA Fink, K Weitmann, C Friedel, S Hadlich, S Langner, K Kindermann, T Holm, A Böhm, E Eskilsson, H Miletic, M Hildner, M Fritsch, S Vogelgesang, C Havemann, CA Ritter, HE Meyer zu Schwabedissen, B Rauch, W Hoffmann, HK Kroemer, H Schroeder, S Bien-Möller
    Neuro Oncology, Feb 2015; 17: 223 – 242.
    …disorders. Further, protein as well as RNA of 2 nonmalignant specimens (1 frontal and 1 temporal lobe) were obtained from BioChain Institute. For assessment of overall survival (OS), we made attempts to obtain information for all patients with glioblastoma…
  • Immunohistochemical detection of Helicobacter pylori without association of TLR5 expression in oral squamous cell carcinoma
    Martin Grimm, Adelheid Munz, Alexandros Exarchou, Joachim Polligkeit, Siegmar Reinert
    J. Oral Pathol. Med. (2.1), 2013-05-09, , 
    … TLR5 specificity was confirmed by Western blot analysis. Protein extraction from OSCC cell lines BICR3 and BICR56 was performed as described previously [33]. Normal human mucosal protein was purchased from BioChain (Hayward, CA, USA) and used as control. …
  • Dual roles of hemidesmosomal proteins in the pancreatic epithelium: the phosphoinositide 3-kinase decides
    S Laval, H Laklai, M Fanjul, M Pucelle, H Laurell, A Billon-Galés, S Le Guellec, M-B Delisle, A Sonnenberg, C Susini, S Pyronnet, C Bousquet
    Oncogene (7.4), 2013-04-29, , 
    … Human normal pancreatic and PDAC protein extracts, and paraffin-embedded samples were from BioChain (CliniSciences sa, Nanterre, France), from US Biomax (Rockville, MD, USA) (tissue-microarrays PA207) and from the Pathology Department of Toulouse Hospital …
  • Overexpression of TEX101, a potential novel cancer marker, in head and neck squamous cell carcinoma
    Hiroshi Yoshitake, Hidenori Yokoi, Hitoshi Ishikawa, Mayuko Maruyama, Shuichiro Endo, Michio Nojima, Koyo Yoshida, Hiroshi Yoshikawa, Fujihiko Suzuki, Kenji Takamori, Hiroshi Fujiwara, Yoshihiko Araki
    Cancer Biomark (2.4), 2012-03-13, 12, 141-8
    … Louis, MO, USA). Horseradish peroxidase (HRP)-conjugated goat anti-rabbit or mouse Ig pAb, and normal control rabbit Ig were obtained from DAKO (Glostrup, Denmark). Total protein lysates from human tissues were pur- chased from BioChain(Hayward, CA, USA). Page 3. …
  • Yasuhiro Katsumata, Yasushi Kawaguchi, Sayumi Baba, Seisuke Hattori, Koji Tahara, Kaori Ito, Tadao Iwasaki, Nozomi Yamaguchi, Masaaki Oyama, Hiroko Kozuka-Hata, Hiroaki Hattori, Kinya Nagata, Hisashi Yamanaka, and Masako Hara
    Identification of Three New Autoantibodies Associated with Systemic Lupus Erythematosus Using Two Proteomic Approaches
    Mol. Cell. Proteomics, Jun 2011; 10: M110.005330. 
    … …Candidate Autoantigens The total protein from human whole brain (BioChain Institute, Hayward, CA) was precipitated once using the ReadyPrep…separate assay, 10 mg of total protein from human whole brain (BioChain Institute) was added to this mixture of lysates from the four… … 
  • Mohammed S. Shazeeb, Christopher H. Sotak, Michael DeLeo, III, and Alexei Bogdanov, Jr.
    Targeted Signal-Amplifying Enzymes Enhance MRI of EGFR Expression in an Orthotopic Model of Human Glioma
    Cancer Res., Mar 2011; 71: 2230 – 2239.
    … …used for calibration. Immunoblotting Membrane proteins were extracted using CNM compartmental protein extraction procedure (BioChain Institute Inc.) following manufacturer’s recommendations with subsequent immunoblotting of protein-normalized lysates on PVDF… …
    Ref. link
  • Christoph S. Clemen, Karthikeyan Tangavelou, Karl-Heinz Strucksberg, Steffen Just, Linda Gaertner, Hanna Regus-Leidig, Maria Stumpf, Jens Reimann, Roland Coras, Reginald O. Morgan, Maria-Pilar Fernandez, Andreas Hofmann, Stefan Müller, Benedikt Schoser, Franz-Georg Hanisch, Wolfgang Rottbauer, Ingmar Blümcke, Stephan von Hörsten, Ludwig Eichinger, and Rolf Schröder
    Strumpellin is a novel valosin-containing protein binding partner linking hereditary spastic paraplegia to protein aggregation diseases
    Brain, Oct 2010; 133: 2920 – 2941.
    … …150mM NaCl, 0.2% Tween-20) containing 5% milk powder. Human multiple tissue western blot membranes were purchased from BioCat/BioChain (Human Adult Normal Tissue, #W1234404) and ProSci (Human Normal Tissue customized selection of human brain regions, #1541N… … 
    Ref. link
  • Arthur T. Suckow, Branch Craige, Victor Faundez, William J. Cain, and Steven D. Chessler
    An AP-3-dependent mechanism drives synaptic-like microvesicle biogenesis in pancreatic islet β-cells
    Am J Physiol Endocrinol Metab, Jul 2010; 299: E23 – E32. 
    … …Protein Assay kit. Western blot analysis. Human brain and human and rat liver protein extracts were obtained commercially (Biochain, Hayward, CA, and ProSci, Poway, CA). INS-1 and human islet extracts (ICR Basic Science Islet Distribution Program; City of… … 
    Ref. link
  • Ruey-Bing Yang, Heng-Kien Au, Chii-Ruey Tzeng, Ming-Tzu Tsai, Ping Wu, Yu-Chih Wu, Thai-Yen Ling, and Yen-Hua Huang
    Characterization of a novel cell-surface protein expressed on human sperm
    Hum. Reprod., Jan 2010; 25: 42 – 51. 
    … …USA). The PCR products were cloned into pGEM-T Easy plasmid vector (Promega). Human testis tissue lysate was purchased from BioChain Institute, Inc. (Hayward, CA, USA). Human sperm samples were from the Department of Obstetrics and Gynecology, Center for Reproductive… … 
    Ref. link
  • Hanzhong Liu, Li Liu, Kaifeng Liu, Peyman Bizargity, Wayne W. Hancock, and Gary A. Visner
    Reduced Cytotoxic Function of Effector CD8+ T Cells Is Responsible for Indoleamine 2,3-Dioxygenase-Dependent Immune Suppression
    J. Immunol., Jul 2009; 183: 1022 – 1031. 
    … …pathophysiology Commercial kits were used to determine intracellular ATP level (Molecular Probes), to isolate mitochondrial protein (BioChain Institute) and to assess citrate synthase activity in isolated CD8 T cells according to the manufacturers instruction (13… … 
    Ref. link
  • Anuradha Chakrabarty, Audrey Blacklock, Stanislav Svojanovsky, and Peter G. Smith
    Estrogen Elicits Dorsal Root Ganglion Axon Sprouting via a Renin-Angiotensin System
    Endocrinology, Jul 2008; 149: 3452 – 3460. 
    … …antisera preabsorption overnight to a 5-fold excess of blocking peptides for AT2 (Santa Cruz Biotechnology) or REN native protein (BioChain Institute, Inc., Hayward, CA), and primary antisera heat inactivation for 20 min and antibody omission for ACE or AGN. A total… … 
    Ref. link
  • Jamie Fitzgerald, Cathleen Rich, Fiona H. Zhou, and Uwe Hansen
    Three Novel Collagen VI Chains, alpha4(VI), alpha5(VI), and alpha6(VI)
    J. Biol. Chem., Jul 2008; 283: 20170 – 20180. 
    … …human adult skeletal muscle for COL6A6 (BioChain Institute). The mouse Col6a4 coding region…structural proteins was obtained commercially (Biochain, catalog number P5244171). A sample was…and a normal adult human tissue panel (Biochain Institute). Sections were blocked with… … 
    Ref. link
  • Eric Soupene, Vladimir Serikov, and Frans A. Kuypers 
    Characterization of an acyl-CoA binding protein predominantly expressed in human primitive progenitor cells
    J. Lipid Res., Feb 2008; 10.1194/jlr.M800007-JLR200.
    … …protein array (Human adult normal tissues, Biochain Institute, Inc.) was performed as follows…according to the manufacturer’s instructions (Biochain Institute, Inc.). Immunohistochemistry…antibody on a MegaWestern protein array (Biochain Institute, Inc.) representing 30 different… … 
    Ref. link 
  • Kevin A. Glenn, Rick F. Nelson, Hsiang M. Wen, Adam J. Mallinger, and Henry L. Paulson 
    Diversity in tissue expression, substrate binding and SCF complex formation for a lectin family of ubiquitin ligases
    J. Biol. Chem., Jan 2008; 10.1074/jbc.M709508200. 
    … …and pelleting debris by centrifugation at 16,000 x g, 4?C for 15 min. Mouse tissue preparations from a commercial supplier (BioChain, Hayward, CA) produced similar results. Immunoprecipitation (IP) Nondenatured lysates from 10 cm plates were incubated with… … 
    Ref. link 
  • Carrie E. Johnson, Yolanda Y. Huang, Amanda B. Parrish, Michelle I. Smith, Allyson E. Vaughn, Qian Zhang, Kevin M. Wright, Terry Van Dyke, Robert J. Wechsler-Reya, Sally Kornbluth, and Mohanish Deshmukh 
    Differential Apaf-1 levels allow cytochrome c to induce apoptosis in brain tumors but not in normal neural tissues
    PNAS, Dec 2007; 104: 20820 – 20825.
    … …Chemical) along with an ECL-Plus detection system (Amersham Biosciences). Protein array of human astrocytomas was from the BioChain Institute (A1235713-1). Real-Time RT-PCR. RNA was isolated by using the small-scale RNAqueous Kit and treated with DNase… … 
    Ref. link 
  • Yana Zavros, Meghna Waghray, Arthur Tessier, Longchuan Bai, Andrea Todisco, Deborah L. Gumucio, Linda C. Samuelson, Andrzej Dlugosz, and Juanita L. Merchant
    Reduced Pepsin A Processing of Sonic Hedgehog in Parietal Cells Precedes Gastric Atrophy and Transformation
    J. Biol. Chem., Nov 2007; 282: 33265 – 33274.
    … …and 60 min. Human Tissue Extracts-Three sets of normal corpus and intestinal-type tumor tissue extracts were purchased from BioChain Institute (Hayward, CA). The tumor tissues supplied were collected from patients with intestinal type gastric cancer. According… … 
    Ref. link 
  • Yana Zavros, Meghna Waghray, Arthur Tessier, Longchuan Bai, Andrea Todisco, Deborah L. Gumucio, Linda C. Samuelson, Andrzej Dlugosz, and Juanita L. Merchant 
    Reduced pepsin a processing of sonic hedgehog in parietal cells precedes gastric atrophy and transformation
    J. Biol. Chem., Sep 2007; 10.1074/jbc.M707090200. 
    … …and 60 min. 5 Human tissue extracts Three sets of normal corpus and intestinal-type tumor tissue extracts were purchased from BioChain Institute (Hayward, CA). Tumor tissues supplied were collected from patients with intestinal type gastric cancer. According… … 
    Ref. link 
  • Scott L. Kominsky, Betty Tyler, Jeffrey Sosnowski, Kelly Brady, Michele Doucet, Delissa Nell, James G. Smedley, III, Bruce McClane, Henry Brem, and Saraswati Sukumar
    Clostridium perfringens Enterotoxin as a Novel-Targeted Therapeutic for Brain Metastasis
    Cancer Res., Sep 2007; 67: 7977 – 7982. 
    … …glycerol, 5 SDS, and 250 mmol/L Tris-HCl (pH 6.7). Total protein from human brain and spinal cord tissue was obtained from BioChain. Equal amounts of protein from cell and tissue lysates were resolved using 12 SDS-PAGE (Invitrogen). Protein was transferred… …
    Ref. link 
  • Raghavan Raju, Goran Rakocevic, Ziwei Chen, Gerard Hoehn, Cristina Semino-Mora, Wei Shi, Richard Olsen, and Marinos C. Dalakas 
    Autoimmunity to GABAA-receptor-associated protein in stiff-person syndrome
    Brain, Dec 2006; 129: 3270 – 3276.
    … …bleed was tested for specificity by enzyme-linked immunosorbent assay (ELISA) and in western blot using total human brain (Biochain, Hayward, CA). Immunoprecipitation and western blot Aliquots of 15 mul serum from SPS or OND control patients were incubated… … 
    Ref. link 
  • Daniel B. Campbell, James S. Sutcliffe, Philip J. Ebert, Roberto Militerni, Carmela Bravaccio, Simona Trillo, Maurizio Elia, Cindy Schneider, Raun Melmed, Roberto Sacco, Antonio M. Persico, and Pat Levitt 
    From the Cover: A genetic variant that disrupts MET transcription is associated with autism
    PNAS, Nov 2006; 103: 16834 – 16839. 
    … …spontaneously aborted 22-week female fetus, was purchased from BioChain Institute, Inc. (Hayward, CA; catalog no. P2244035; lot…Human fetal brain nuclear protein was purchased from BioChain Institute, Inc. (Hayward, CA); the source of the human… … 
    Ref. link 
  • Daniel B. Campbell, James S. Sutcliffe, Philip J. Ebert, Roberto Militerni, Carmela Bravaccio, Simona Trillo, Maurizio Elia, Cindy Schneider, Raun Melmed, Roberto Sacco, Antonio M. Persico, and Pat Levitt
    A genetic variant that disrupts MET transcription is associated with autism
    PNAS, Oct 2006; 10.1073/pnas.0605296103.
    … …Human fetal brain nuclear protein was purchased from BioChain Institute, Inc. (Hayward, CA); the source of the human…spontaneously aborted 22-week female fetus, was purchased from BioChain Institute, Inc. (Hayward, CA; catalog no. P2244035; lot… … 
    Ref. link 
  • Raghavan Raju, Goran Rakocevic, Ziwei Chen, Gerard Hoehn, Cristina Semino-Mora, Wei Shi, Richard Olsen, and Marinos C. Dalakas
    Autoimmunity to GABAA-receptor-associated protein in stiff-person syndrome
    Brain, Sep 2006; 10.1093/brain/awl245.
    … …bleed was tested for specificity by enzyme-linked immunosorbent assay (ELISA) and in western blot using total human brain (Biochain, Hayward, CA). Immunoprecipitation and western blot Aliquots of 15 ml serum from SPS or OND control patients were incubated… … 
    Ref. link
  • Mark R. Garbrecht, Thomas J. Schmidt, Zygmunt S. Krozowski, and Jeanne M. Snyder
    11-Hydroxysteroid dehydrogenase type 2 and the regulation of surfactant protein A by dexamethasone metabolites
    Am J Physiol Endocrinol Metab, Apr 2006; 290: E653 – E660.
    … …Loading was monitored by staining the blots with Ponceau S, a nonspecific protein dye. Homogenate proteins of human liver (BioChain, Hayward, CA) and Caco2 cells (human colon epithelial cell line, a gift of Dr. F. Jeffrey Field, University of Iowa) were… … 
  • Xiaofeng Lu, Minhui Wang, Jin Qi, Haitao Wang, Xinna Li, Dipika Gupta, and Roman Dziarski
    Peptidoglycan Recognition Proteins Are a New Class of Human Bactericidal Proteins
    J. Biol. Chem., Mar 2006; 281: 5895 – 5907.
    … …esophagus, stomach, small intestine, and colon, from normal human donors (male and female, 21-65 years old), were prepared by BioChain. Following standard deparaffinization, re-hydration, and quenching of endogenous peroxidase by 30 min incubation in 0.3… …
  • Andrew M. F. Liu and Yung H. Wong
    Activation of Nuclear Factor B by Somatostatin Type 2 Receptor in Pancreatic Acinar AR42J Cells Involves G14 and Multiple Signaling Components: A MECHANISM REQUIRING PROTEIN KINASE C, CALMODULIN-DEPENDENT KINASE II, ERK, AND c-Src
    J. Biol. Chem., Oct 2005; 280: 34617 – 34625.
    … …luciferin substrate kit was a product of Roche Diagnostics. Normal rat pancreas membrane protein fraction was purchased from BioChain (Hayward, CA). Various antisera were products of Cell Signaling Technology (Beverly, MA) and Amersham Biosciences. Specific… … 
  • Hamid Mehenni, Nathalie Lin-Marq, Karine Buchet-Poyau, Alexandre Reymond, Martine A. Collart, Didier Picard, and Stylianos E. Antonarakis
    LKB1 interacts with and phosphorylates PTEN: a functional link between two proteins involved in cancer predisposing syndromes
    Hum. Mol. Genet., Aug 2005; 14: 2209 – 2219. 
    … …immunoprecipitate endogenous proteins with antibodies against PTEN, a commercial total protein extract from human small intestine (BioChain) was used. For immunoblotting, antibodies to LKB1 or to PTEN (both from Santa Cruz Biotechnology) were diluted 1:1000… … 
  • Wei Li, Zu-Xi Yu, and Robert M. Kotin
    Profiles of PrKX Expression in Developmental Mouse Embryo and Human Tissues
    J. Histochem. Cytochem., Aug 2005; 53: 1003 – 1009. 
    … …or fetal tissues including brain, heart, kidney, liver, lung, pancreas, spleen, and thymus were commercially obtained (BioChain Institute Hayward, CA). According to the manufacturer, the protein concentrations from each tissue were determined using… … 
  • Thomas A. Hughes and Hugh J. M. Brady
    Expression of axin2 Is Regulated by the Alternative 5′-Untranslated Regions of Its mRNA
     J. Biol. Chem., Mar 2005; 280: 8581 – 8588.
     …. RNA and protein that had been purified simultaneously from single tissue samples was purchased from BioChain (AMS Biotechnology). cDNA samples were subjected to semi-quantitative PCR using RedTaq (Sigma) and the following … 
  • Angela Relógio, Claudia Ben-Dov, Michael Baum, Matteo Ruggiu, Christine Gemund, Vladimir Benes, Robert B. Darnell, and Juan Valcárcel
    Alternative Splicing Microarrays Reveal Functional Expression of Neuron-specific Regulators in Hodgkin Lymphoma Cells
     Biol. Chem., Feb 2005; 280: 4779 – 4784.
     … Lymph node tumor samples from lymphoma patients were purchased from BioChain (catalog number P1235161A-1, P1235161B-1). … 
  • Reeves J, Xuan J, Arfanis K, Morin C, Garde S, Ruiz M, Wisniewski J, Panchal C, Tanner J.
    Identification, purification and characterization of a novel human blood protein with binding affinity for prostate secretory protein of 94 amino acids
    Biochem J. 2005 Jan 1; 385(Pt 1): 105-114.
    … …Total protein lysates from human prostate, pituitary and ovary were obtained from BioChain Institute (Hayward, CA, U.S.A.). All other reagents used were of analytical grade. … … 
    Ref. link 
  • X. Chang, R. Yamada, A. Suzuki, T. Sawada, S. Yoshino, S. Tokuhiro, and K. Yamamoto
    Localization of peptidylarginine deiminase 4 (PADI4) and citrullinated protein in synovial tissue of rheumatoid arthritis
    Rheumatology, Jan 2005; 44: 40 – 50.
     … The total protein in a commercial liver sample served as the control (Biochain). … 
  • Friederike Fellenberg, Tanja B. Hartmann, Reinhard Dummer, Dirk Usener, Dirk Schadendorf, and Stefan Eichmüller
    GBP-5 Splicing Variants: New Guanylate-Binding Proteins with Tumor-Associated Expression and Antigenicity
     J. Invest. Dermatol., Jun 2004; 122: 1510 – 1517.
     … cell lysate and commercial protein medleys of normal tissues (Clontech, Palo Alto, California, USA orBioChain, Hayward, California, USA). … 
  • Miki Shimada, Reiko Terazawa, Yoshiteru Kamiyama, Wataru Honma, Kiyoshi Nagata, and Yasushi Yamazoe
    Unique properties of a renal sulfotransferase, St1d1 in dopamine metabolism
     J. Pharmacol. Exp. Ther., Apr 2004; 10.1124/jpet.104.065532.
    … Human kidney cytosols were obtained from BioChain Institute, Inc. … 
  • Stephen A. Renshaw, Clare E. Dempsey, Frances A. Barnes, Stephanie M. Bagstaff, Steven K. Dower, Colin D. Bingle, and Moira K. B. Whyte
    Three Novel Bid Proteins Generated by Alternative Splicing of the Human Bid Gene
     J. Biol. Chem., Jan 2004; 279: 2846 – 2855.
    … Preprepared protein samples were from the BioChain Institute (Hayward, CA). …
  • Andrew M. Davidoff, Catherine Y. C. Ng, Junfang Zhou, Yunyu Spence, and Amit C. Nathwani
    Sex significantly influences transduction of murine liver by recombinant adeno-associated viral vectors through an androgen-dependent pathway
     Blood, Jul 2003; 102: 480 – 488.
     … normal liver nuclear protein and Swiss Webster mouse hepatocyte nuclear extract were also purchased from BioChain Institute (Hayward, CA).
  • Asako Otomo, Shinji Hadano, Takeya Okada, Hikaru Mizumura, Ryota Kunita, Hitoshi Nishijima, Junko Showguchi-Miyata, Yoshiko Yanagisawa, Eri Kohiki, Etsuko Suga, Masanori Yasuda, Hitoshi Osuga, Takeharu Nishimoto, Shuh Narumiya, and Joh-E Ikeda
    ALS2, a novel guanine nucleotide exchange factor for the small GTPase Rab5, is implicated in endosomal dynamics
     Hum. Mol. Genet., Jul 2003; 12: 1671 – 1687.
     … Protein samples for the human cerebral cortex and cerebellum were purchased from Biochain Inc. …
  • Andrew M Davidoff, Catherine Y C Ng, Junfang Zhou, Yunyu Spence, and Amit C Nathwani
    Gender significantly influences transduction of murine liver by recombinant adeno-associated viral vectors through an androgen-dependent pathway
    Blood, Mar 2003; 200209288
     … normal liver nuclear protein and Swiss Webster mouse hepatocyte nuclear extract were also purchased from (BioChain Institute Hayward, CA). …
     … and female mice, 2 weeks after castration or subcutaneous implantation of DHT pellets, respectively, by (BioChain Institute. …)
  • Yong Li, Kaihua Wei, Chengrong Lu, Yingxian Li, Ming Li, Guichun Xing, Handong Wei, Qingming Wang, Jizhong Chen, Chutse Wu, Huipeng Chen, Songcheng Yang, and Fuchu He
    Identification of hepatopoietin dimerization, its interacting regions and alternative splicing of its transcription
    Eur. J. Biochem., Aug 2002; 269: 3888 – 3893.
     …nuclear extracts of three different human liver tissues (fetal liver, adult normal liver and hepatoma,Biochain) were resolved on SDS PAGE, transferred to poly(vinylidene difluoride) membrane, and analyzed by immunoblotting with …
  • Chengrong Lu, Yong Li, Yanlin Zhao, Guichun Xing, Fei Tang, Qingming Wang, Yuhui Sun, Handong Wei, Xiaoming Yang, Chutse Wu, Jianguo Chen, Kun-liang Guan, Chenggang Zhang, Huipeng Chen, and Fuchu He
    Intracrine hepatopoietin potentiates AP-1 activity through JAB1 independent of MAPK pathway
    FASEB J, Nov 2001; 105061. (Liver protein lysate from BioChain…)
  • Katsuki Ohtani, Yasuhiko Suzuki, Souji Eda, Takao Kawai, Tetsuo Kase, Hiroyuki Keshi, Yoshinori Sakai, Atsushi Fukuoh, Takashi Sakamoto, Hiroyuki Itabe, Tatsuo Suzutani, Masahiro Ogasawara, Itsuro Yoshida, and Nobutaka Wakamiya
    The Membrane-type Collectin CL-P1 Is a Scavenger Receptor on Vascular Endothelial Cells
    J. Biol. Chem., Nov 2001; 276: 44222 – 44228. 
     …Western blotting analyses were performed using CL-P1 transfected cells, HUVEC , placental tissue membrane extracts (BioChain Institute, Inc., CA) without or with de-glycosylation (Enzymatic Deglycosylation kit, Bio-Rad), and in vitro transcription …
  • Hiroshi Sakamoto, Tetsuo Mashima, Shigeo Sato, Yuichi Hashimoto, Takao Yamori, and Takashi Tsuruo
    Selective Activation of Apoptosis Program by Sp-bromobenzylglutathione Cyclopentyl Diester in Glyoxalase I-overexpressing Human Lung Cancer Cells
    Clin. Cancer Res., Aug 2001; 7: 2513 – 2518.
     … Cytoplasmic protein from human normal tissue was purchased from BioChain Institute, Inc. …
     … normal tissues for GLO1 expressions using 48 Dot Human Tumor/Normal Tissue Total RNA Dot Blot (BioChain Institute, Inc.). …
  • Friederike Fellenberg, Tanja B. Hartmann, Reinhard Dummer, Dirk Usener, Dirk Schadendorf, and Stefan Eichmüller
    GBP-5 Splicing Variants: New Guanylate-Binding Proteins with Tumor-Associated Expression and Antigenicity
     J. Invest. Dermatol., Jun 2004; 122: 1510 – 1517.
     … cell lysate and commercial protein medleys of normal tissues (Clontech, Palo Alto, California, USA orBioChain, Hayward, California, USA). …
Back to Top
x