Alsin, the Product of ALS2 Gene, Suppresses SOD1 Mutant Neurotoxicity through RhoGEF Domain by Interacting with SOD1 Mutants

Kohsuke Kanekura, Yuichi Hashimoto, Takako Niikura, Sadakazu Aiso, Masaaki Matsuoka, Ikuo Nishimoto
Biol. Chem. Apr 1, 2004
… DNA Construction —Full-length alsin SF cDNA was obtained from human heart cDNA (BioChain) by PCR using a sense primer (ACTAGTACCATGGACCAAAGAAGAGAAGCTC) and an antisense primer (GCGGCCGCGCTACCAAGCCTTACCCCTTTTAAAG). …_x000D_
… EcoRI site to the NheI site of alsin LF, was obtained from human thalamus cDNA (BioChain) by PCR using a sense primer (GCTTCCATAGTGGAGCAGTGACAGAC) and an antisense primer (GCGGCCGCCTCAATGAGGCTCCATGCTGACC). …
Back to Top
x