The Effect of Variation in Expression of the Candidate Dyslexia Susceptibility Gene Homolog Kiaa0319 on Neuronal Migration and Dendritic Morphology in the Rat

Veronica J. Peschansky, Timothy J. Burbridge, Amy J. Volz, Christopher Fiondella, Zach Wissner-Gross, Albert M. Galaburda, Joseph J. Lo Turco, Glenn D. Rosen
Cereb Cortex Aug 1, 2009
… …Kiaa0319 as described below. The cDNAs prepared from frontal, parietal, and occipital lobes of human embryonic brain (20 weeks, Biochain Institute, Hayward, CA) were used as template to amplify the full-length coding sequence of Kiaa0319 using forward (5ATGGCGCCCCCCACAGGTGTG3… …

Leave a Reply