RAD51AP2, a novel vertebrate- and meiotic-specific protein, shares a conserved RAD51-interacting C-terminal domain with RAD51AP1/PIR51

Oleg V. Kovalenko, Claudia Wiese, David Schild
Nucleic Acids Res. Oct 1, 2006
… …transcripts are present in cDNA samples from 16 different adult human tissues (Clontech), 5 different fetal human tissues (BioChain) and 7 different human cell lines (Clontech). The PCR primers used for RAD51AP1 were AP1-5: 5GATGACAAGCTCTACCAGAGAGAC3 and… …

Leave a Reply