Pannexin 1 in erythrocytes: Function without a gap

Silviu Locovei, Li Bao, Gerhard Dahl
PNAS May 1, 2006
… …Data were normalized to the control condition (incubation in Krebs solution). Human bone marrow cDNA was obtained from BioChain Institute (Hayward, CA). For PCR amplification, the primers gaggtatctgaaagcaccacttcaagtaccc and gaccactgctcttaatattctccagtacc… …

Leave a Reply