Identification of human STAT5-dependent gene regulatory elements based on inter-species homology

Erik A. Nelson, Sarah R. Walker, Wei Li, X. Shirley Liu, David A. Frank
J. Biol. Chem. Jul 1, 2006
… …between human, chimp, mouse, and rat were selected for subsequent analysis. Reporter gene construction: Human breast DNA (BioChain, Hayward, CA) was amplified with primers spanning the conserved NCAM2 intronic region with the following sequences: ACACATCCTTCATACCAGGAAA… …

Leave a Reply