Homologous recombination mediates functional recovery of dysferlin deficiency following AAV5 gene transfer

William E Grose, K Reed Clark, Danielle Griffin, Vinod Malik, Kimberly M Shontz, Chrystal L Montgomery, Sarah Lewis, Robert H Brown, Paul M L Janssen, Jerry R Mendell, Louise R Rodino-Klapac
PLoS ONE Jun 21, 2012
… TTGAGCTCATCCAGAGAGAGAAGC3′) – Dysf 6243R (5’TCAGCTGAAGGGCTTCA CCAG3′). Human skeletal muscle total RNA (BioChain) and the pAAV.MHCK7.Dysf plasmid (50 ng) were used as positive controls. PCR products were gel …

Leave a Reply