Amino-termini isoforms of the Slack K+ channel, regulated by alternative promoters, differentially modulate rhythmic firing and adaptation

Maile Reed Brown, Jack Kronengold, Valeswara-Rao Gazula, Charalampos G. Spilianakis, Richard A. Flavell, Christian A. von Hehn, Arin Bhattacharjee, Leonard K. Kaczmarek
J. Physiol. Sep 1, 2008
… …amino-terminus (forward primer CCCATCTTCTTCCTTCCCTGAGCCGTC and reverse primer ATCCTGCGGGAGCGCTTGGCGC). Using PCR-ready rat genomic DNA (Biochain, Hayward CA, USA) and Pfu Turbo, 2 kb products were amplified and subcloned using the TA cloning kit (Invitrogen), and sequenced… …

Leave a Reply