A Rac1/Phosphatidylinositol 3-Kinase/Akt3 Anti-apoptotic Pathway, Triggered by AlsinLF, the Product of the ALS2 Gene, Antagonizes Cu/Zn-superoxide Dismutase (SOD1) Mutant-induced Motoneuronal Cell Death*

Kohsuke Kanekura, Yuichi Hashimoto, Yoshiko Kita, Jumpei Sasabe, Sadakazu Aiso, Ikuo Nishimoto, Masaaki Matsuoka
Journal of Biological Chemistry Dec 3, 2004
A human RhoC cDNA was PCR-amplified from cDNAs isolated from the frontal lobe of a human brain cerebrum (BioChain, Hayward, CA) with a sense primer (CGGGATCCATGGCTGCAATCCGAAAGAAGC) and an antisense primer (GGAATTCTCAGAGAATGGGACAGCCCC).

Leave a Reply