A Rac1/Phosphatidylinositol 3-Kinase/Akt3 Anti-apoptotic Pathway, Triggered by AlsinLF, the Product of the ALS2 Gene, Antagonizes Cu/Zn-superoxide Dismutase (SOD1) Mutant-induced Motoneuronal Cell Death

Kohsuke Kanekura, Yuichi Hashimoto, Yoshiko Kita, Jumpei Sasabe, Sadakazu Aiso, Ikuo Nishimoto, Masaaki Matsuoka
Biol. Chem. Feb 1, 2005
… cDNA was PCR-amplified from cDNAs isolated from the frontal lobe of a human brain cerebrum (BioChain, Hayward, CA) with a sense primer (CGGGATCCATGGCTGCAATCCGAAAGAAGC) and an antisense primer (GGAATTCTCAGAGAATGGGACAGCCCC). …_x000D_
… A human RhoG cDNA was obtained from a human frontal lobe cDNA library (BioChain) by PCR with a sense primer (CGGGATCCATGCAGAGCATCAAGTGCGTG) and an antisense primer (GGAATTCTCACAAGAGGATGCAGGACC). cDNAs for RhoB, …

Leave a Reply