United States
Have a question or just need help?
Contact us for Service and Support

 

Q: Can this 96 well plate be used for 96 well robot high through put analysis?

A: We have not tested our 96 Well Plate on a robot system.

 

Q: Can the ADP/ATP Ratio Assay Kit be used in tissue lysis?

A: We have not validated the EnzyLightT ADP/ATP Ratio Assay Kit for the use with tissue lysates. I think however that it should be possible to determine the ADP/ATP ratio of tissue samples with this assay. Please find attached two papers, as an example on how to prepare tissue samples for the assay.

 

Q: Is it necessary to add levamisole to the "Alkaline Phosphatase buffer in order to block the endogenous phosphatase activity when preparing colour solution (NBT/BCIP)?

A: The customer can purchase the levamisole separately from Sigma and add it to the buffer, but we don’t want to do this simple work in our end.

 

Q: Do the antibodies product contain thimerosal or sodium azide?

A: Most of our antibodies should be dissolved in buffer with sodium azide.

 

Q: Do the antibodies product contain thimerosal or sodium azide?

A: Most of our antibodies should be dissolved in buffer with sodium azide.

 

Q: Has this been IHC tested on frozen section and or paraffin section?

A: We only performed test by western blot for cell lysate but didn't try IHC for either frozen or paraffin sections.

 

 

Q: Has this been IHC tested on frozen section and or paraffin section?

A: We only performed test by western blot for cell lysate but didn't try IHC for either frozen or paraffin sections.

 

 

Q: Has this been IHC tested on frozen section and or paraffin section?

A: We only performed test by western blot for cell lysate but didn't try IHC for either frozen or paraffin sections.

 

 

Q: Has this been IHC tested on frozen section and or paraffin section?

A: We only performed test by western blot for cell lysate but didn't try IHC for either frozen or paraffin sections.

 

 

Q: What is the epitope of your HIV antibody?

A:

 

Q: What is the epitope of your HIV antibody?

A:

 

Q: We have a question regarding one of your products: reference Y3322HISH1.  Could you please send the list of species this was tested agains in western blotting? I see on your datasheet this note: "Western blot shows single band of Histone H1 in major organ

A: The image can be viewed from the manual of our CNM kit.

 

Q: Please send image which we stated in our datasheet:" Protein Specificity: Western blot shows single band of Histone H1 in major organs of a broad range of mammalian species."

A:

 

Q: Do you have any data for cross-reactivity with rat samples, or a prediction of the potential for cross-reactivity based on homology of the immunogen sequence with rat histone H1?

A: No.  Data for cross-reactivity has only been done for human so far.

 

Q: Is the species of the arabidopsis thaliana or lyrata?

A:

 

Q: The customer will send rat tissues in blocks.  There are 56 tissues, each type of tissue from 3 rats, and the customer will send 168 blocks.  Can BioChain offer array blocks for these 168 blocks?   What would be the cost?

A: Yes, we can offer array blocks.  The minimum number of array blocks would be 2.  There are 2 options.  Option 1:  The customer provides BioChain with blocks and H.E. stained slide for each block.  The price for this would be $6,000.00 for 2 array blocks.  Option 2:  The customer will only provide BioChain with blocks and BioChain will cut one section from each block and do the H.E. staining.  The price for the 2 blocks is $6,000.00 plus $2,000 for sectionings and h.e. staining.  Total of $8,000.00.

 

Q: Phosphate assay kit, iron assay kit, copper assay kit, ethanol assay kit, and magnesium assay kit all apply to serum and urine sample.  Can these kits be used on plant leaf sample?  If yes, does the plant sample need any special extraction procedure?

 

A: We have not validated these assays in plant leaf samples, but believe they should work. In general, plant leaves can be homogenized in distilled water followed by centrifugation. Use clear supernatants for assays with the phosphate and ethanol kits. Assays using the other kits will give free iron, copper and magnesium data. For total iron, copper and magnesium, the leaves should be digested with HNO3/HCl, neutralized to pH 6 to 8 and perform the assay.

 

Q: Is the 96 well plate valid for Multiple well Plate 96-well .Flat Bottom with lid (Sarstedt ref 82.1581.001) and Microtest Plate 96-well Round bottom (Sarstedt ref 82.1582)?  The buffer in which you recommend to dilute the samples, the customer has urine s

A: Any clear, flat bottom plate can be used.  The plate MUST have a clear bottom.  Water can be used for the dilution.  Simply tapping the plate or gently shaking is fine.  There is no specific method required.

 

Q: Our customer wants to measure albumin in cell cultured samples. 

Q1. Which kit is better for the customer's Albumin assay ?

Q2. What sample preparation is needed for cell cultured samples ?

Q3. Please let me know the amount of cultured samples is needed

A: Both kits will work for cell cultures supernatants and both methods are widely used. The BCG kit is more sensitive with a detection range of 0.01 g/dL (1.5μM) to 5 g/dL (750μM) albumin in 96-well plate assay. The BCP kit with a detection range of 0.3 g/dL (45μM) to 5 g/dL (750μM) albumin in 96-well plate assay, gives results that agree more closely with chromatographic methods.  Albumin is usually present at high concentrations in cell culture media, so minimum sample volumes should be sufficient. The BCG kit uses as little as 5μl sample, whereas the BCP kit uses as little 20μl sample.

 

Q: I see that BESTBio gDNA page states that “RNase treatment to ensure the RNA contamination is eliminated and confirmed by 2% agarose gel”

Is this only done for BESTBio material?

 

A: We will run 2 ug genomic DNA on the agarose gel, if there is no smear bands in the 200-500 bp area, that means no RNA contamination.

 

Q: According to your mail, the product in your stock were made 6 month ago, however their expiration date is half year upon receipt under proper condition. Then it could not be a fresh product, isn’t it? If the client ask you to make the products newly, then

A: We can cut the sections from fresh tissues.  It will take betweeen 1 - 2 weeks.  There's a $50.00 extra charge for cutting fresh.

 

Q: Can BioChain's beta-actin primer control be used for human, bovine, and mouse.

A: Yes.

 

Q: Is the Bilirubin Assay Kit ideal for use on rat serum?

A: This kit is not species-specific and works with other mammalian species as well. It has been used successfully with rodent serum, albeit mostly mice

 

Q: What's the species of your bovine?

A: We don’t know the bovine species (also referred to as breed).  We did check with the vendor regarding this issue for other customers, but the vendor was not able to give a clear answer: The bovine could be from any breed that is rased in the United States.  A few of these breeds are Hereford, Brahma, Charlois, Black Angus, Simmental, Limousin, Holstein mix.  They could be any of these breeds or crosses of any breed.  We have no way to know exact breed of the animals.

 

Q: What's the species of your bovine?

A: We don’t know the bovine species (also referred to as breed).  We did check with the vendor regarding this issue for other customers, but the vendor was not able to give a clear answer: The bovine could be from any breed that is rased in the United States.  A few of these breeds are Hereford, Brahma, Charlois, Black Angus, Simmental, Limousin, Holstein mix.  They could be any of these breeds or crosses of any breed.  We have no way to know exact breed of the animals.

 

Q: Does BioChain have a kit that's suitable for determining the protein concentration in cell culture?

A: The Bradford Protein Assay Kit should work.

 

Q: The customer is looking for Brain Tumor Tissue Array for Glia cells and Neuronal Cells in Frozen or Paraffin.  Which of your products would you recommend?

A: We recommend either Z5070003 or Z5070004.

 

Q: What's the detail sequence(s) of the primer pair, specificity, length, optimal ratio of AT and GC, secondary structure, stability and Tm.

A:

 

Q: Would BioChain provide just the cDNA positive control for this product?

A:

 

Q: Would BioChain provide just the cDNA positive control for this product?

A:

 

Q: What's the expected yield of Total RNA from Solid tissues Tissue 0.5 – 200 mg and culture cells 100 – 1x 107 respectively.

A: The yield depends on what kind of tissues or cells.  The yield is from 10 ng to 200 ug – A very large range.  For example, adipose has very low yield, and liver has very high yield.

 

Q: Is the Broad Range Total RNA Isolation Kit suitable for the described cells and application?  Cells that have been obtained from human nasal polyps, they are in suspension, and the samples have between 20.000 and 40.000 cells; after the isolation, the cel

A: The kit should work for this purpose.  Since the customer is doing qRT-PCR, so I would like to recommend our one step qRT-PCR kit, it may save the customer time.

 

Q: A customer is regularly using the FDA slides BT6234701 and they do have a general question: are they cut fresh upon ordering or do the provider have a large number of slides in store for a longer period of time?

What is the production date of the curren

A: Usually we assemble a frozen TMA block first, and every array from this block is with the same lot#.  We cut arrays enough for 2-3 month supply each time.  If your customer wants to have fresh cut, we can do it with extra $100-$300 depends on how many arrays they want.

 

Q: Can mouse serum be detected by the Calcium Assay Kit?

A: Yes.

 

Q: With regards to the calcium assay kit, it could directly detect Ca level, free of interference from lipid, protein and minerals such as Mg, Fe and Zn.  One lab wonders the principle of phenolsulphonephthalein dye complexing specifically with Ca.  Besides,

A: Our formulation allows the phenolsulphonephthalein dye to form a very stable blue colored complex specifically with free calcium. Bivalent cations that could interfere with the assay are removed by forming complexes with chelating agents that have a low affinity for Ca2+ ions.

 

Q: Is it necessary to decompose the sample first and run it for the testing, if the purpose is solid testing samples such as muscles, human hair or solid food?

A:

 

Q: What's the method of sample preparation of "Cultured cells" for the detection by the kit?  Should we homogenize sample in a water?

A: If one wants to measure the Ca2+ in the medium (i.e. extracellular Ca++), the protocol is the same as described.  If one wishes to measure Ca2+ in cells. The following is the recommended method of cell lysate preparation:  1. Collect ~10e6-10e7 cells by centrifugation (i.e., 1,000-2,000 x g for 10 minutes at 4°C). For adherent cells, do not harvest using proteolytic enzymes; rather use a rubber policeman.  2. Cells are lysed by homogenization or sonication in 1-2 ml of distilled water.  3. Centrifuge at 10,000 x g for 15 minutes at 4°C.  4. Transfer supernatant for assay.

 

Q: What should be the pH of the sample before we use the assay kit?

A: The DICA kit is heavily bufferred for a pH near 10 and the sample is quite small in relation to the working reagent, so unless the sample is extremely acidic there is no need to adjust the pH.

 

Q: Is the calcium assay kit suitable for use in mouse serum?

A:

 

Q: When the customer wants to use it for solid testing samples such as

muscles, human hair or solid food, do they need to decompose the sample

first and run it for the testing, just like atomic absorption analysis, do they

need to decompose it with acid firs

A: Yes, solid samples need to be digested chemically before being used in the assay. For example, to measure total calcium, the protocol following protocol can be used (Laboratory guide for conducting soil tests and plant analysis, J. Benton Jones.): 

Wet Ash Method for Ca, Mg and K Using Nitric Acid and 30% Hydrogen Peroxide.

   1. Weigh +/- 500mg dried (80C) and ground (0.84 mm, 20-mesh screened) plant tissue into a beaker or a digestion tube.

   2. Add 5ml of concentrated nitric acid (HNO3). Cover with watch glass or place funnel in digestion tube. Let it stand overnight.

   3. Place covered beaker on a hot plate or digestion tube in a dry-block and digest at 125C for one hour. Remove and let cool.

   4. Add 3ml 30% hydrogen peroxide (H2O2) to beaker or digestion tube and digest at 125C. Repeat the additions of 30% hydrogen peroxide until the digest is colorless. Add HNO3 as needed to prevent digest from going to dryness.

   5. When digest is clear, remove watch glass or funnel and reduce temperature to 80C. Take nearly to dryness. Residue should be colorless, if not repeat step 4.

   6. Add 1:10 HNO3 or HCL to a final volume of 10 mL..

Please note that this protocol has not been tested with our assay. However, we know that our calcium assay is compatible with up to 0.5 M HCl (pH 0.3).

Therefore I would recommend adjusting the pH if necessary to >= 0.3.

 

 

Q: The customer likes to purchase many types of cancer cells and he will extract DNA or RNA from the cells.  We are not sure what cancer cells he really wants but we just need to know if you can supply many kinds of cancer cells like cDNA human tumor cell li

A: We can supply CCL-134 (Lung tumor), NCI-H520 (Lung tumor), NCI-H358 (Lung tumor), NCI-H838 (Lung tumor), NCI-H1229 (Lung tumor), A549-ATCC (Lung tumor), HT29 (Colon tumor), TIB-161 (Lymphoma), CRL-11386 (Leukemia), HL60 (Leukemia), LNCap (Prostate tumor), K562 (Leukemia), MCF7 (Human Breast Adenocarcinima), Hela (Cervix Adenocarcinoma), Jurkat (Human Acute T cell Leukemia), A431 (Human Epidermoid Carcinoma), Raji (Human Chronic Myelogenous Leukemia; Bone Marrow)

 

Q: Can you tell me how much total RNA I can get from per 100mg cartilage from human  knee or ankle before I place an order for K2031010.  I tried to use Trizol, but the RNA output were always too low.

A: The RNA yield from cartilage is very low, usually from 1 gram cartilage tissue, the RNA yield range from 1 ug to 10 ug.

 

Q: Prepare northern blot with 5 ug mRNA (poly A+) isolated from human cartilage …. Isolate 20 ug mRNA (poly A+) from human cartilage

A: The RNA yield from cartilage is extremely low, and we don’t have large amount of human cartilage tissue available, so we currently are not able to make mRNA from cartilage.  Besides, we are selling 10 ug cartilage total RNA at $399 as custom made product, the mRNA price will be very expensive if we are able to get.  RNA from bone is also custom made product, but we are able to get some mRNA, the price will be high as well because RNA yield from bone is also very low.  Anyway, since we only have 13 ug cartilage total RNA available, my suggestion is:

Make two lane total RNA blot, one lane 10 ug of total RNA.  We always label the RNA marker on our blot.  We show you the total RNA image before they are transferred to the membrane.  The price will be $999

Just purchase 10 ug bone total RNA at $299 and 10 ug total RNA at $399.  Then perform RT-PCR study instead of northern blot analysis.  Or you can make your own blot.

 

 

Q: How is cartilage isolated from rat articular?  2) What makes your Cartilage RNA Extraction Kit superior to other suppliers?

A: Cartilage can be extracted using BioChain's cartilage RNA Isolation Kit.  We can only assume that compare to the other vendors, our kit is easier to use, rate of isolation being a success is higher, and quality of total rna isolated is higher.  Also,  we compete by price.

 

Q: Do the following components contain any hazardous materials?  If yes, please indicate concentration.  1) Solution 1, 3) Solution 2, 4) Solution 3, 5) Solution 4, 6) DEPC H2O/0.1 mM EDT

A: 1) Solution 1 Guanidine Thiocyanate (4M), 3) Solution 2 No hazardous, 4) Solution 3 No hazardous, 5) Solution 4 No hazardous,  6) DEPC H2O/0.1 mM EDTA  DEPC itself is harzdous (0.1%); solution 1 also has 2-mercaptoethanol 0.1M

 

Q: Is this for human gene?

A:

 

Q: What is the concentration of your cDNA?

A: Our cDNA is PCR ready cDNA, 1 ul is good for 1 PCR reaction, since 11 ug Total RNA was used to produce 40 ul cDNAs, the concentration of the cDNA should be about 2.5 ng/ul

 

Q: If I use the same amount of cDNA for different volume of PCR reaction. Will I get different amount or concentration of PCR products ?

A: Therotically, the PCR product amount should be the same amount but the concentration should vary depend on the PCR volume. If a very faint band from the first round PCR was obtained, then a sharper band should be obtained with a second round PCR using the first round PCR product as templates.

 

Q: Are all your current dog cDNAs from total RNAs that have gone through DNase I digestion?

A: Yes.

 

Q: Is BioChain's first strand cDNA single strand DNA or double strand DNA?

A: Single strand.

 

Q: With regards to the PCR Ready First Strand cDNA, is it linear or inserted in plasmids?  Does it contain any 3'/5' consensus sequences? Is it possible to clone the entire library in to a vector?

A:

 

Q: a.  Can these products be used as reference for qPCR?  b.  What is the variability between lots?  c.  How many qPCR reactions can be done for each product ? What amount of product should be used for each reaction?  d.  What reaction was done to obtain the

A: a.  Yes.  b. We have a QC standard for any of our cDNA and this is shown on our certificate of analysis (COA).  We assure that every lot of cDNA pass our QC standard.  c. 40 rxn.  d. Oligo dT primer was used to ensure the entire 3' end of cDNA is present.  e. 1 ul is good for 1 PCR reaction, since 11 ug Total RNA was used to produce 40 ul cDNAs, the concentration of the cDNA should be about 2.5 ng/ul.  f.  It will be available unless we discontinue.  We can't guarantee that it will always come from the same donor as tissue amount does run out.

 

Q: I am searching for a positive cDNA chondrogenic control, but this tissue is not provided in any list of mouse cDNA's.  Is the cDNA skeletal tissue applicable for a positive control for chondrogenic tissue?

A: I wonder if cartilage cDNA will be the best for you as control, because we can custom make this product.

 

Q: The customer needs cDNA which has been produced from random primers not from oligo dT primer

A: We can generate 6 kb cDNAs due to our 5’ selection.  So conservatively speaking, we would say 6 kb should be a maximum size, though we did get some even larger size cDNA from some individual cDNA before.  If the customer prefer a cDNA using random hexamer, he can use our universal cDNA which has both oligo dT primed and random hexamer primed.  If it is for a specific cDNA, then we can custom make the cDNA with random hexamer.

 

Q: Since we are screening for gene expression using gene-specific primers, I would like to be assured the cDNA is an accurate representation of the mRNA of the tissue it was derived from.  Has the material been shown to be completely free of genomic DNA, and

A: Yes, the cDNA is genomic DNA free because we did DNase I treatment for the RNA before the cDNA synthesis.

 

Q: Is BioChain's cDNA suitable for array analysis?

A: No, it's not suitable to the traditional cDNA microarray such as from Affymetrix b/c it's necessary to label the cDNA during cDNA synthesis, and our cDNA is not labeled.  And the labeling must happen in cDNA synthesis procedure, so you must start from RNA.

 

Q: The CoA states that the estimated concentration is about 2.5ng/uL. Could I ask what method is used to evaluate this concentration?

A: 40 ul is from 10 ug total RNA, assume 2% mRNA within the total RNA, so there are 200 ng mRNA, and assume 50% mRNA transcribed to cDNA, so cDNA amount should be 100 ng.  100ng/40ul=2.5ng/ul.

 

Q: I used your cDNA as template to amplify my target gene, and while I did get good signal of a house keeping gene, I couldn't get the signal.  What's the problem?

A: It is possible that the gene of your interest is a GC rich gene.  Enhance your PCR condition by adding enhancing agents 0.5 M betaine or dimethyl sulfoxide (DMSO).

 

Q: Is the library from tissue mRNA or from a skin keratinozyte cell culture?

A: It is just first strand cDNA but not cDNA library.  The cDNA was made through reverse transcribing of skin total RNA.  The cDNA is just from a piece of skin tissue.

 

Q: Does it contain any 3'/5' consensus sequences?

A: It is just first strand cDNA but not cDNA library.  You can buy more cDNA (200 rxn) then do the second strand synthesis, add linkers, etc and do a library construction by yourself if you have a vector system, that will be tons of work, also it might be better to start from skin mRNA.

 

Q: Is there dermatological examinations?

A: No.

 

Q: Will I find cDNA form all kind of maturation stages of the skin or only selected areas?

A: No.

 

Q: Is the origin from one individual or several individuals?

A: Single individual

 

Q: What kind of documentation has been done for this cDNA library?

A: The normal skin was provided by tissue vendors according to clinical information.

 

Q: Is it possible to clone the entire library in to a vector?

A: You can buy more cDNA (200 rxn) then do the second strand synthesis, add linkers, etc and do a library construction by yourself if you have a vector system, that will be tons of work, also it might be better to start from skin mRNA.

 

Q: Is the PCR Ready First Strand cDNA linear or inserted in plasmids?

A: It is just first strand cDNA but not cDNA library.  It's linear fragment.  No vector issue.

 

Q: Is the library from tissue mRNA or from a skin keratinozyte cell culture?

A: It is just first strand cDNA but not cDNA library.  The cDNA was made through reverse transcribing of skin total RNA.  The cDNA is just from a piece of skin tissue.

 

Q: Does it contain any 3'/5' consensus sequences?

A: It is just first strand cDNA but not cDNA library.  You can buy more cDNA (200 rxn) then do the second strand synthesis, add linkers, etc and do a library construction by yourself if you have a vector system, that will be tons of work, also it might be better to start from skin mRNA.

 

Q: Is there dermatological examinations?

A: No.

 

Q: Will I find cDNA form all kind of maturation stages of the skin or only selected areas?

A: No.

 

Q: Is the origin from one individual or several individuals?

A: Single individual

 

Q: What kind of documentation has been done for this cDNA library?

A: The normal skin was provided by tissue vendors according to clinical information.

 

Q: Is it possible to clone the entire library in to a vector?

A: You can buy more cDNA (200 rxn) then do the second strand synthesis, add linkers, etc and do a library construction by yourself if you have a vector system, that will be tons of work, also it might be better to start from skin mRNA.

 

Q: 1) Did the soybean raw material contain seed coat?

2) Do you know the picking season of the soybean? Do you know how long had it passed after blossoming?

3) How was the storage condition of the soybean? For example, dry or no?

4) Is there any differentiat

A: 1.The soy bean is not actually the real bean but the plant itself, most of it is the leaves of the plant.

2. It is not even picking season, it is the plant leaves at the time without even having a bean, yet.

3. -80C

4. No.  Currently we are using all the same batch of tissues.

 

Q: Which of your products cDNA, total rna, or genomic is suitable for gene cloning?  Or are all 3 suitable for gene cloning?

A: cDNA and total rna (after it has been reversed transcribed to cDNA)

 

Q: 1. What primer was used to synthesize your cDNA, random or oligo dT?

2. What quality control method do you use to make sure your total RNA is good? Do you run bioanalyzer or northern?

3. If I can't get any product from the cDNA OR RNA, do I get another

A: 1. Oligo dT primer was used to ensure the entire 3' end of cDNA is present.  2.  The integrity of the RNA is examined by visual inspection for the presence of intact bands of 18s and 28s ribosomal RNA when electrophoreses on a denaturing agarose gel. The quality and purity of total RNA were tested by spectrophotometer. A260/280 is between 1.8 and 2.0 (detected in 10 mM Tris-Cl, pH 7.5).  The RNA is treated by DNase I, and is tested as DNA free RNA by PCR.  However, please be advised that total  RNA from some tissues may not be treated by DNase I.  Biochain is not using Agilent Bioanalyzer as a standard QC method, if customers request RNA tested on Agilent Bioanalyzer, additional fee will be applied for each sample.  To visualize the RNA images on agarose gel, we recommend the same gel system be used as Biochain’s (1% agarose gel in 1xMOPS buffer with formaldehyde).  Biochain is not responsible for customer’s getting degraded RNA images from other gel systems, such as TAE gel, TBE gel, Urea gel, etc.  We had run Agilent Bioanalyzer for several of our total RNA products but not all, and our production people feel most of Agilent image match the gel image, so we don’t run Agilent for each total RNA.  3.  Yes, we provide a different lot as replacement, however only for special cases.  One such cases is if our control primer doesn't work.  This is very rare.  We need to look at the case deeply before we agree to send a different lot.  We don't and can't guarantee that you will be able to amplify your gene of interest.  In fact, I don't know of any other company who can.  The probability of you successfully amplifying your gene lies on several factors.  One factor is whether or not your gene of interest is high in abundace?  In other words, is your gene scientifically known to be highly expressed in cynomolgus skin?  Please be advised that all of our cDNAs were reverse transcribed from total RNA and not mRNA.  If they are very low abundant genes, then I will suggest you get some mRNA first, and use the mRNA as template to synthesis cDNA, this will increase the chance to clone low abundant genes.  Several of my customers were successful in cloning low abundant gene by using mRNAs.  However, please keep in mind that we don't and can't guarantee that you will be able to amplify your gene in the end.  By starting from mRNA it just increases your chances of amplification but doesn't guarantee.  Did you check the GC content of these two genes?  If they are high GC content, then you should add either Betaine or DMSO in your PCR reaction, this will help you a great deal in amplifying the genes.  Again, no guarantee.

 

Q: What's the difference between cDNA Library a.k.a. primary cDNA library and cDNA Library (Normarlized)?  What is normalized cDNA Library and why is it important?

A: The differential expression of genes in cells is regulated through vast networks of hormone signal transduction systems that result in 20,000 to 60,000 primary mRNA transcripts.  The expression pattern of any specific gene can vary from 250,000 copies to 1 copy per cell at any given time.  Genes fall into three categories based upon the number of mRNA copies found in the cell at any time: 1) highly abundant expressed genes, 2) moderately abundant genes, and 3) low abundant or rare genes.  This dramatic range of gene representation as mRNA in living cells, or the molecular complexity of a cell, makes analysis of primary cDNA libraries problematic, especially if sequence determination is being applied for gene discovery efforts.  Normalization is a complex molecular process where the cDNA copies of a primary library are equalized so that each original mRNA transcript is represented in the normalized library to the same extent as all the rest of the clones.  This means that the number of copies of the high and moderately abundant genes are reduced in the library to the levels of the rare genes.  Now, with a normalized cDNA library, sequence analysis does not repeatedly pick up the same gene and the rare transcripts become more accessible.

 

Q: What kind of documentation is available for the cDNA library?  Is there documenation of dermatological examinations?  Is the library from tissue mRNA or from a skin keratinozyte cell culture?  Will I find cDNA from all kind of maturation stages of the ski

A:

 

Q: Only the minimum number is mentioned.  What’s the number of primary clones?

A: 2.7x10e6

 

Q: Besides restriction analysis, are the inserts also sequenced for quality control?

A: No.

 

Q: Do you know from which brain tissues the cDNA is derived?

A: No.

 

Q: Does BioChain have references for who have used the B1234035N, cDNA Library (Normalized): Human Adult Normal Tissue: Brain?

A: Not yet as it's a fairly new product.

 

Q: In which direction the cDNAs are cloned into the vector?   Does the insert “start” at the EcoR1 site and “end” at the Not1 site, or is it the other way around?

A: Start at Not I and ends at EcoR V.

 

Q: Only the minimum number is mentioned.  What’s the number of primary clones?

A: 2.7x10e6

 

Q: Besides restriction analysis, are the inserts also sequenced for quality control?

A: No.

 

Q: Do you know from which brain tissues the cDNA is derived?

A: No.

 

Q: Does BioChain have references for who have used the B1234035N, cDNA Library (Normalized): Human Adult Normal Tissue: Brain?

A: Not yet as it's a fairly new product.

 

Q: In which direction the cDNAs are cloned into the vector?   Does the insert “start” at the EcoR1 site and “end” at the Not1 site, or is it the other way around?

A: Start at Not I and ends at EcoR V.

 

Q: What's the vector map or sequence of BioExpress vestor?

A:

 

Q: I need to isolate open reading frames for a small group of cDNAs.  Would it be possible to do so by PCR amplification of your library or would it be necessary to screen the library using colony blots?

A: If the target gene's sequence is known, then it will be easier to design the primers to "fish" out the target gene by PCR.  It's not necessary for you to screen the library by colony blots.  Now I think fewer people are doing screening library work unless their target gene is unknown, and they only have partial sequence of the target gene, and they have to use it as probe to screen the library.

 

Q: one of our customers bought your wheat cDNA (Cat# C1634390, Lot# A710176).  He'd like to know which species/cultivate?  Which part of the wheat (endosperm etc.-…).

A: Winter red.  Leaves of very young plant.

 

Q: What homology does your Human Beta Actin cDNA probe have with rat?

A: The human beta actin cDNA probe we have share 89% homology with rat

 

Q: Can the optimax c-DNA synthesis kit be used as direct tissue to c-DNA synthesis,or direct cell to c-DNA synthesis?

A: No. It has to be started from total RNA or mRNA.

 

 

Q: Does BioChain sell the following cell lines: He La, MCF1-Breast Cancer cell line, Mouse fibroblast, and MCL Mantle cell lymphoma cell lines?

 

A: We don't sell the cell line.  Instead, we sell the isolated components (gdna, protein lysates, mRNA, total rna).  Instead of MCF1, we sell gdna, protein lysate, mRNA, total rna, cDNA Cell Line: MCF 7.  No, we don't have materials from mouse fibroblast.  However, we have mouse skeletal muscle.  We don't have MCL Mantle cell lymphoma cell lines.

 

Q: Can this be used for measurement of the exact number of cells?

 

A: Our cell viability kits could be potentially used to measure the number of cells; however, this would require generating a standard curve by diluting a cell sample of the same type of cells whose exact viable cell number is known.  If the cell samples is large, it might be worth while to do.

 

 

Q: Does BioChain sell the supercoiled DNA marker separately?

A: We don't sell the supercoiled DNA marker separately.

 

Q: What QC method did you use to prove that your compartmental proteins were well separated?

A: A western analysis with GAPDH (a cytoplasmic protein) antibody shows very strong signal in cytoplasmic protein, but very low signal in nuclear and membrane protein. Also EGFR is only shown in the membrane protein but not in cytoplasmic and nuclear proteins.

 

Q: The customer needs proteins to make immunoprecipitation.  If the customer uses either K3013010 or K3012010 to extract the proteins, will the protein structure still be intact or will they be denatured?  In other words, will the proteins lose their charact

A: The protein isolated by this kit is native and not denatured, except the cytoskeletal protein.

 

Q: Regarding the CNM compartment protein isolation kit, the manual indicates to use for example 2ml buffer to fractionate 20 million cells.  It should be possible to adapt the volume of buffer to use when you for example have only 5 million cells, i.e. 0.5ml

A: The volume of the buffer can be adjusted absolutely.  It doesn’t have to be the volume mentioned in the manual.

 

Q: Regarding BioChain's CNM isolation kit, what is the performance of the kit with regard to separation of membrane fraction and nuclei in cardiac tissue (mouse). We find with several other protocols that it is VERY difficult to get rid of myofilaments - the

A: We have not specifically tested the kit performance for getting rid of myofilaments.  We do use our kit isolate mouse heart nuclear protein, membrane protein as standard protein lysate product, and customers have not had any problems for that.  Since we don’t have any experience for the myofilaments issue, so we can not guarantee it should work.  The mechanism for the kit is using hepatonic buffer to release the cytosol protein first, then using high salt buffer to release the nuclear protein, then using buffer with detergent to release membrane protein.

 

Q: Using BioChain's CNM Compartmental Protein Extraction Kit, can the CNM fractionation be followed by micro BCA protein assay kit (pierce)?  The user is concernced that the EDTA in buffers of CNM may affect the performance of the BCA.  Is the [EDTA] in CNM’

A: The EDTA concentration is lower than 20 mM in our CNM kit.  So your customer should be able to use it for BCA protein assay.

 

Q: Is BioChain's CNM Compartmental Protein Extraction Kit suitable for extraction of human neutrophi cells?

A: Theoretically our kit should work for neutrophi cells because the kit is suitable for all kind of animal tissues and cells.  But we really don’t have any data and reference to give.

 

Q: Is the CNM suitable for standard isoelectric focusing and subsequently 2-D electrophoresis?

A: The protein lysates extracted by our CNM kit or membrane protein extraction kit is no different from total protein lysates, except of course they are specific compartmental proteins. Thus we presume it is suitable for standard isoelectric focusing and subsequently 2-D electrophoresis. And this is confirmed by some customer of ours who used CNM kit-extracted protein lysates to run 2-D SDS PAGE. But since their data has not been published yet, we are not at liberty to release any info about that. However, Nick has found this published paper, I suggest that he contact the author and find out about their detailed procedure.

 

Q: I used the CNM kit to extract protein from cultured cells yesterday. I just followed the protocol with the kit. Finally, I measured the protein concentration as the following: Cytoplasmic protein almost nothing, Nuclear protein about 0.5 microgram per mic

A: Try using the syringe with needle 30 to break the cell membrane.

 

Q: Regarding the CNM Kit, as we know some viruses might be enveloped into a layer of membrane. Our customer would like to get the native proteins from membrane fraction and to treat cells with these extracted proteins. Can the CNM kit be used to isolate memb

A: The CNM kit can only be applied for tissue and cells; it is very unlikely it can be applied for virus.  And we never tried this kit for virus protein extraction.   We are not sure if buffer C is powerful enough to break the virus, if it can, then theoretically, you can skip the N step and go to M buffer fraction directly.

 

Q: Can the CNM kit be used to isolate membrane proteins together with membrane associated proteins?

A: Yes.

 

Q: Are all proteins obtained by this kit in native conditions or in denatured forms?

 

A: It is in native conditions.

 

Q: I am studying mitochondrial proteins, and I would like to know by using your CNM kit, which fraction contains mitochondrial proteins.

A: It is membrane fraction.

 

Q: Can your CNM kit separate the membrane proteins from different organells?

A: It is very hard for us to separate the membrane proteins from different organells, at current situation we don't have any answers for that

 

Q: Do you have any idea in which fraction the microsome proteins is?

A: We believe the microsome proteins should be in the cytoplasmic protein fraction since the centrifugation speed is not high enough to precipitate the microsome during that preparation.

 

 

Q: What is the components of each buffer in the kit?

A: We currently have not list the buffer components in our manual, yet.  But customers can check the certificate of analysis of our compartmental proteins, the information can be obtained there.

 

Q: Do you know if the membrane fraction contains every membrane proteins?

A: Yes it does.

 

Q: I would like to know whether the different extractions resulting from these kits

are adequate for analysis by immuno precipitation?  Are the complexes of macro molecules kept

for this analysis?

 

A: Yes, all the proteins extracted by these kits should be ok for i.p analysis.  The complexes of macro molecules should be kept.

 

Q: What is the concentration of MgCl2 and KCl in buffer C (component K3013010-1) of your CNMCS Compartmental Protein Extraction Kit?  If this information is proprietary, can you simply tell me if the buffer has high or low stringency.

A: The concentration of MgCl2 in buffer C is within 1-10 mM, while 5-40 mM for KCl

 

Q: Have you ever tested your Compartmental Protein Extraction Kit, catalog # K3013010, with immunoprecipitation?  Can you provide more information about the buffer formulation?  Specifically, what is the detergent % in buffer M, and are the cytoskeletal sepa

A: We have not tested the extracted protein from the kit with immunoprecipitation, though theoretically it should work.  Some of our customer were successful in doing the IP with the protein isolated from this kit, but we don't have protocol from them.  The concentration of the buffer is proprietary.

 

Q: A customer  would like to use the Total Protein Extraction kit in plant samples (cassava).  Do you know if it has ever been tested in non-mammalian tissue?  Or, could you tell me which protease inhibitors are included in the cocktail (plants tend to conta

A: The kit cannot be used for plant samples because the buffer is not strong enough to break the wall of plant cells

 

Q: What are the components of the membrane extraction?  Do they include plasma membrane and all intercellular membrane such as ER, mitochondira, etc.? Or they are just plasma membrane?

A: The kit isn't specifically described for specific membrane proteins.  Presumably it is comprised of all types of membrane proteins including plasma membrane proteins, intracellular membrane proteins, etc.

 

Q: Could you tell me if this kit has been tested for subsequent use of the sample for immunoprecipitation experiments

A: Yes, the protein isolated from the kit had been tested for immunoprecipitation, and it worked.

 

 

Q: Can our CNMCS Compartmental Protein Extraction Kit be used to isolate protein from microsome?

 

A: Microsome is already a kind of subcellular component.  Our cat# K3013010 can't be used to isolate protein from it.

 

Q: A customer would like to use the CNMCS kit for cell culture.  He has several samples that will not be ready for prep at the same time, but he would prefer to do the fractionation of all samples in parallel.  What is the best way to store the cells before

A: We recommend for the customer to collect all the cell pellet and keep in the -80c freezer, then start to extract until all the pellets are ready.

 

Q: I am using your CNMCS kit (K3013010) isolating proteins from different cell fractions of beta cells (Langerhans Islets). I was wondering whether you know in which fraction I should expect vesicle proteins (intravesicular or vesicle membrane proteins). Fur

A: Since our kit doesn’t separate organell protein very much, the vesicle proteins, ER, and Golgi proteins are all in membrane fraction.

 

Q: The customer would like to know the role of the composition in the kit buffer.

A: MgCl2 is there to maintain the cellular enzyme activity. NaCl forms high salt buffer to release the nuclear protein. KCl is more versatile and also yes, to maintain the stability of proteins.

 

Q: BioCat -Elke Gamer

A: WE don't have it.

 

Q: Why is the placenta a positive control for cat# T823579d?

A: We indicate: Human placenta is included as an inter-array control in every array for comparison between different arrays among different users. To be precise, we cannot say it is a positive control, though many proteins can be detected in placenta.  When we put it in the array, the positive control is named relatively to the negative paraffin control.

 

Q: Are BioChain's compartmental proteins suitable for immuno precipitation.  If yes, is dialysis or buffer exchange needed?

A: Yes, BioChain's compartmental proteins are suitable for immuno precipitation (IP).  No dialysis or buffer exchange needed.

 

Q: In which compartmental proteins is the centrosome? Nuclear or cytosolic fraction?

A:

 

Q: Where are the control genomic DNAs isolated from?

A:

 

Q: Was it from a normal colon or a normal cancer?

A: Normal colon not adjacent normal.

 

Q: Can the copper assay kit be used on Serum, Plasma and Soil samples?

A: The copper assay kit can be used for serum and plasma samples. We have not validated it for the use with soil samples, but believe it should work, too, as long as the copper concentration in soil extracts is within the linear detection range of the assay.

 

Q: Can the creatinine assay kit be used for direct assay in mouse urine, serum, plasma?

A: Yes.

 

Q: The user accidentally stored the buffer in -20 degree C, and it freezed.  Would freezing affect the performance?

A: The CS buffer includes SDS, when it is cold, the SDS will be precipitate, but when temperature goes up, the SDS will be dissolved, again.  So basically there is no problem for your customers.  The concentration difference from your customer is just a variation of different preparation, so I would not consider it as a big deal.

 

Q: I would like to ask if it is possible to order plasmid preparations of specific Arabidopsis genes from you?

A: We might be able to offer such kind of service, but we would like to know the gene access code, and other information, such as abundance, which part of the gene you want to clone, the gene size, etc, of your target genes, then we will evaluate if we are able to do the work.  If yes, then we will discuss the cost.

 

Q: Do you provide custom made FISH probes?

A: We can't provide this service at this time.

 

Q: Are your cytoplasmic lysates devoid of nuclei?

 

A: Yes, the cytoplasmic lysates are devoid of nuclei.

 

Q: Are these lysates prepared from regular HeLa cells or HeLa S3?

A:

 

Q: Is the Cytoskeleton Protein - Rat Normal Tissue: Liver derived from normal or tumurogenic tissue?

A: Normal

 

Q: Hi there I have a customer looking to source genomic DNA specifically from human peripheral blood mononuclear cells…(For methylation studies)

How are your PBLs used for gDNA extracted? I seem to remember they are from buffy coat fraction – is that better

A: Dear William,

Yes, our PBL is actually buffy coat fraction, which include not only monnuclear cells but other cells.  But I have no idea if this gDNA is better or worse than Mononuclear cell gDNA.

Sincerely,

Dong

 

 

Q: Is that correct the solvent is sterile, deionized water pH 7.0 as indicated in CofA ?

A: Yes.

 

Q: What are products relating to diagnosis research?

A: ELISA kits, QPCR and qRT-PCR products, and BioAssay kits.

 

Q: How does one use DNA biomarker?

A: They are just some special primer pairs for detecttion of specific gene.  The primer pair manual can be reviewed from our website.

 

Q: We're going to be performing DNA Isolation from Fresh Frozen slides. Do you have an uber robust extraction kit I could try out? Perhaps something compatible with the Qiacube?

A: I’ve gone online and looked up Qiagen’s QIAcube.  We have a similar kit called the Blood and Serum DNA Isolation Kit, cat# K5017100.  I noted that it’s spin-column.  Ours is spin-column as well.  Qiagen’s Starter Pack, QIAcube is $486.00.  Our kit is $299.00.  Since you’ll be working with frozen tissue section already mounted onto slide, what you’ll need to do is scrape off the section from the slide, place into a tube, and proceed with following the user’s manual protocol. 

 

 

Q: What is the minimum amount of bisulfite treated DNA that can be recovered after treatment?  Since the metabisulfite used in the reaction is highly unstable, what is the shelf life of the kit, once in use?

A:

 

Q: What's the expiration date of the kit?

A: The kit should be stable for at least 6 months after receipt.

 

Q: How much you can do with this kit?

A: Enough for 50 preparations for bisulfite treatment

 

Q: How many CpG regions can this kit detect?

A: There is no limitation. If customer designs PCR primers for a single CpG it can be used for a single sit. The PCR product can be sequenced from both of the ends and all of the CpG can be detected.

 

Q: 1. Is the solvent (buffer) sterile, deionized water pH 7.0?  2. You mention as the concentration is 100mM.  Does this mean 100 mM  per each tube x 4 tube ? or 1 tube containing mixture of dATP/dGTP/dCTP/dTTP in 100mM x 4 tubes?  I think the former assumpt

A: 1.  Yes.  2.  First assumption is right.

 

Q: What is the spieces of your dog products

A: Beagal

 

Q: I have a question for Dr. P.  1. The protein that I get from Dr. P, is that the total protein?  2. Can I extract DNA/RNA/Protein from mammalian cell using Dr. P?  If so, can you send me the protocol.

A: 1. Yes, it's total protein.  2.  Yes, it can be used to extract all 3 components from mammalian cell.  You should have received a manual with the sample.  If not, it's available on our website. According, to my supervisor, Dr. Zhongdong Liu, the manual on our website should provide you with the information you need.  There's a section called Recommended Protocol. Here's the link to save you time.  http://www.biochain.com/biochain/ProtocolManuals/DrPKitManual.pdf

 

Q: When the customer measured the concentration of the nucleic acid (DNA or RNA), he obtained various concentrations from the spectrometer.  Is it normal to obtain various concentrations?  What would cause variances in concentrations?

A: The concentration can vary in certain range. Please ask customer dissolve the RNA or DNA completely in 10 mM Tris buffer, pH 7.5. This will help.

 

Q: Can the Dr. P kit be used for any animal tissue?

A: Yes.

 

Q: Can the Dr. P kit be used to extract from fresh blood?  How?

A: The customer should still follow the user's manual except doesn’t need to homogenize the blood sample because the solution can lysis the sample directly.

 

 

Q: How does BioChain ensure that there is no protease or phosphostase presence in the extracted sample.

A: The protein lysate from Dr. P kit is denatured protein and from previous steps for RNA/DNA isolation all the protease are “killed.”  The protein lysate is dissolved in high SDS concentration buffer.  SDS can inhibit any other protease and therefore there is no need to add any other protease inhibitors in the buffer.

 

Q: Are the ionic channels present in the protein fraction?  The customer needs at least 100 µg of proteins.  What's the quantity of cells required?

A: The protein isolated from Dr. P kit is total protein .  Theoretically ionic channel protein should be present in the fraction as well.  But all the protein isolated from Dr. P kit is denatured and inactive.  The protein is only good for western blot analysis but not good for any activity assays.

 

Q: Is DTT or 2-mercaptoethanolcontained in any buffer?

A: Solution 1 contains 2-mercaptoethanol

 

Q: What's the minimum quantity of cells or tissue you would need to isolate DNA, RNA and protein with your kit ref. K2021010, Dr. P.?

A: The minimal amount really depends on tissue type.  For example, for the high yield tissue liver, 50 mg should be ok, and you can reduce the reagent amount proportionally.  But for low yield tissue, such as adipose, I think you may have to use 500 mg.

 

Q: The customer will work with cells.  The manual indicates ….0.5 ml Solution 2 per gram cells …. How many cells would you recommend as starting material (10 to the 6  or 10 to the 7)?

A: 10 to the 7

 

Q: 1)Regarding the protein extraction, is the extracted protein biased to a some specific protein(e.g. DNA binding protein etc)?   The customer would like to refer to the comparison data with  usual protein extraction reagent like RIPA.  2)Please let us know

A: 1) No.  2)  Yes.  Unfortunately we don’t have any citation for this kit, yet.  3) When DNA and RNA extraction, is there a possibility that  the protein is lost?

 

Q: What is the difference between Dr. P genomic DNA and general genomic DNA?

A: General genomic DNA was isolated from tissues or cells only while no RNA and protein were isolated at the same time.  The quality of general genomic DNA is the best.  Dr. P genomic DNA was isolated while RNA and protein were also isolated.  There are some difference in the isolation methods.

 

Q: I'd like to detect the level of phospho protein level after extracting the protein lysate.  If I use BioChain's Dr. P Kit, will the phospho protein still be maintained?

A: Isolation of Protein Lysate to be used for detection of phospho protein level for later.

 

Q: Which kit was used to isolate the total RNA?

A: We use Dr.P kit, a patent pending technology, to isolate the RNA.  The isolated RNA can be used for mRNA isolation, probe generation, RT-PCR, Northern blot analysis, primer extension, RNA protection assay, and In vitro translation.

 

Q: Please elaborate on step 12 of the protocol.  How can the RNA and DNA concentration be adjusted to 0.6µg/µl as they are measured separately? Should this be ‘at least 0.6 µg/µl’? And what if e.g. DNA concentration is high and RNA concentration low?Or how i

A: At this step, the solution is a mixture of DNA and RNA, but you can still determine the concentration by UV260 using the RNA concentration formula which is 1OD=40ug/ml.  The solution 3 is specifically for RNA precipitation, and we optimize the best RNA concentration is around 0.3 ug/ul, since the solution we got from step 12 is a mixture, we can only assume DNA and RNA is half and half, so we set 0.6 ug/ul, which means there are about 0.3ug/ul is RNA while the other 0.3ug/ul should be DNA.  So 0.6 ug/ul doesn’t have to be exactly, a little bit more and less should be fine.

 

 

Q: What's the buffer?

A: Guarnidine lysis buffer

 

Q: What's the buffer?

A: Sodium Acetate buffer

 

Q: What's the buffer?

A: Sodium Chloride buffer

 

Q: What is Dr. P set product?

A: Dr. P set include 50 ug RNA, 10 ug genomic DNA, and 100 ug total protein.  All these 3 items are isolated from the same piece of biomaterial simultaneously.

 

Q: The shelf life wasn't mentioned on the Easy mRNA Purification Kit or in the manual.  I would like to know, if all components are supposed to be still working? Please be aware that the 2 oligo dT buffers showed some precipitations! How can this be overcome

A: The kit’s real shelf life should be much longer than a year, though we will put “one year” shelf life in the kit manual.  So the customer can continue to use it.  The precipitation of the oligo dT buffer is normal because of SDS.  Put the buffer in 65C for 10 minutes, then the precipitation should be gone.  (But it is our fault not mention this in the kit manual)  All the oligo dT should be “oligo dT cellulose”

 

Q: Which of your ELISA Assay Kits are for infectious diseases?

A: KO31001096, KO31002096, KO31003096, KO31004096, KO31005096, KO31006096, KO31007096, KO31008096, KO31009096, Z7010002, Z7010003, Z7010008, Z7010009

 

Q: I'm going to run your Elisa Kit for HIV.  For that I have one question.  Before I add the controls and the Serum I have to put concentrated wash buffer onto each well? And the Patients Serum should not be diluted?

A: yes, you should wash the wells with concentrated wash solution first before use. No, the patients' serum should not be diluted.

 

Q: Can you tell me if this ELISA kit comes with strip wells? Thank you.

 

A: The plate doesn't come with strip wells.

 

Q: ELISA - KO31008096 is it a strip well plate so that the customer doesn't have to use the entire plate when it's used for the first time

A: The plate is not strip plate, so he may have to take the whole plate with him.

 

Q: Which kind of antibodies (IgG, IgM...or all) can be detected with this kit.

 

A: Any anti-HBc antibody including IgG, IgM, etc.

 

 

Q: I have a question to your ELISA Kit for Hepatitis A IgM Antibody (K031008096).  Do you recommend to test in duplo or even triplo? And do you recommend to make a calibration curve? (in other words, is the test semi-quantitative?)  Is it possible to use hal

A: Generally, protein of each lane on the blot is from a single donor.  However, the protein from rare tissues might be pooled.

 

Q: The positive control read OD =1, and his samples only read around 0.2. He would like to know how much HBsAg is in the positive control so he can roughly know how much antigen is in his samples.

A: The kit was used for diagnosis in Chinese diagnostic Marketing.  It only gives positive and negative.  The kit can't do quantitation.  So I am not able to give the antigen amount.  I know some customer is trying to modify the kit by themselves for quantitation, but I don’t know any details.

 

Q: What is the antigen concentration in the positive control serum?

A:

 

Q: What subtypes are detected with the ELISA Kit for Hepatitis B Surface Antigen?

A: The kit can detect the following subtype: Adr, adw and ayw.

 

Q: Are the positive and negative control serum from HepC antibody ELISA KO31002096 sold separately?

A: No.

 

Q: An acute infection (e.g. malaria) can lead to non-specific antibody formation, often IgM, which can lead to non-specific reactions in diagnostic tests. A possible unwanted reaction depends on the test that is used; if the test is specific (ie the antigen

A: We don't have any data to show how specific our HAVAg is and how pure it is.  The only thing I can tell you is the kit has been approved by Chinese FDA, and they have been used in Chinese diagnostic market.  If the customer doubt the specificity, they can try to test acute infection with the kit and see if the kit will give false positive.

 

Q: Can you please let me know what should be used as blank (e.g., water or dilute solution) for the HCV-ELISA kit KO31002096?

A: dilute solution

 

Q: Regarding invalid positive control (< 0.8) is this OD minus blank?

A: You need to set blank as zero

 

Q: Our customer has an OD slightly above subtraction of blank OD (0.014) the value is below 0.8. Should they regard the data as invalid?

A: When you measure something, you must set a zero, so if your blank is 0.014, then what is the zero solution well?

 

Q: Could the customer process in one first experiment only part of the plate, some wells and after process the rest of the plate?

A: Yes.  But the  customer should use the rest of  the wells within a week.  Make sure no reagents splash to the used wells during testing partial wells.  After partial use, store the plate in 4C with the used wells sealed.

 

Q: We have a question about the kits Z7010008, Z7010009, Z7040001 and Z7010003.

In MSDS files, it doesn’t show any hazardous ingredients.

However, as I know, stop solution usually has one acidic component (etc HCl).

Is there any similar ingredient in the

A: Thanks for your inquiry. For the ELISA kits you have mentioned, we do have H2SO4 in the stop solutions.

Since the component information in such solution is proprietary, it is very difficult for me to disclose it. However, I am formative that the concentration of this acid in stop solution is at such a low range that the handling, storage and disposal does not demand any special care.

We do not have the preservative information for these kits currently.

 

 

Q: Is the 96 well plate valid for Multiple well Plate 96-well .Flat Bottom with lid (Sarstedt ref 82.1581.001) and Microtest Plate 96-well Round bottom (Sarstedt ref 82.1582)?  The buffer in which you recommend to dilute the samples, the customer has urine s

A: Any clear, flat bottom plate can be used.  The plate MUST have a clear bottom.  Water can be used for the dilution.  Simply tapping the plate or gently shaking is fine.  There is no specific method required.

 

Q: Is the Enzyme Ethanol Assay Kit of animal origin?

A: It is an EtOH assay kit, I am not sure if I understand your inquiry.  Do you mean if this kit can detect Ethanol from animal?

 

Q: Donor information for lots B205115 and B112057

A:

 

Q: Please confirm that EPOC, which is outgrowth, has proliferating but EPC, which is not outgrowth, doesn't have proliferating.  Also,  figure 1 in the EPC manual shows Morphology of CD133+EPC in culture. "Passage"7, 400x.  Does the word "passage" mean subcu

A: EPOC: attached cells outgrowth from single clone, tend to be mature endothelium cells after proliferating

EPC: floating cells at very early stage with CD133, CD34 and KDR markers, be capable of differentiating into a variety of mature endothelial cell types. With little proliferating.

"passage" means change medium by spin down floating cells.

 

Q: When did you change the product name from EPC to EPOC and release new EPC cell?

A: We changed EPC to EPOC in April 2009.  We released Cryopreserved hEPC, CD 133+ around May or June 2009.

 

Q: Why did you change the product manual (removing the expression data of CD133 and adding of description of CD133-)?  Because you released early stage EPC expressed CD133 richly.

A: Please understand that we offer Endothelial Progenitor Cell (EPC) and Endothelial Progenitor Outgrowth Cell (EPOC).  EPC and EPOC are different cells.  Endothelial Progenitor Cell EPC) is CD 133 positive and that the majority of Endothelial Progenitor Outgrowth Cell (EPOC) should be CD 133 negative.   I indicate that the majority of EPOC, and not all, should be CD 133 negative b/c we've had lots that showed up slightly positive for CD 133  (see 2008 - 2009 product catalog) which is due to lot variation.  However, the slight indication of EPOC being CD 133 positive doesn't make it EPC.  Note that Endothelial Progenitor Outgrowth Cell (EPOC) is attached cell while Endothelial Progenitor Cell (EPC) is floating cell.  In other words, EPC and EPOC are different cells.  Although EPC is CD 133 positive, it will be lost or marker will be very weak after 1 week of culture.

 

Q: We would like to confirm that EPOC production method does not change.  Is it right?

A: Yes, I confirm that EPOC production method does not change.

 

Q: The customer would like to get lot specific data of lot B205113 (PO 00003657) and lot B205115 (PO 00005797) about expression marker.  Because she worry about lot difference of them.  If you have the data, could you send us?

A: We don't have the requested data for these 2 lots.

 

Q: Does the EPC Basal Medium, cat# Z7030004 contain phenol Z?

A:

 

Q: Is the human recombinant growth factors in the medium from baculovirus expression system?

A: No.

 

Q: What's the difference between EPC Growth Medium, EPC Growth Medium Supplement, and EPC Basal Medium.

A: EPC growth medium (Cat# Z7030003) includes two components: EPC basal medium (Cat# Z7030004) and EPC growth medium supplement (Cat# Z7030005).  In other words, EPC growth medium = basal medium + EPC growth medium supplement.  EPC growth medium supplement is dry ice shipment and EPC basal medium is blue ice shipment.  The basal medium is stored at 2 - 8°C.  The EPC growth medium supplement is stored at -20°C.  Shelf life of EPC basal medium is 6 months from the date of receipt under proper storage condition and shelf life of EPC growth medium supplement is at least 1 year from the date of receipt under proper storage condition.

 

Q: Has this been validated on human plasma samples?

A: Yes.

 

Q: Does glucose interfere with the Ethanol Assay Kit, cat# Z5030029?

A: Please be advised that glucose does interfere with the Ethanol Assay Kit, cat# Z5030029.  We recommend for your customer to purchase the Enzyme Ethanol Assay Kit, cat# Z5030040, which is not affected by glucose and is a more sensitive assay.

 

Q: I'm interested in acquiring the ethanol quantification kit, but I need to know if I can use it to quantify ethanol in culture medias like YPD, and if there is restrictions about journal's publications when I use this kit in my experiments. I'm asking thes

A: We have two different ethanol assay kits.  Ethanol Assay Kit, catalog Z5030029, has a detection range of 0.04v% - 4 v% and Enzyme Ethanol Assay Kit, catalog Z5030040, which is linear from 0.0003-0.1 v%.  Ethanol Assay Kit is a chemical based kit and Enzyme Ethanol Assay Kit is enzyme based. Both kits should be fine with YPD media.

I am not sure what you mean by journal restrictions.  The basis for both of these kits has been published before.

 

 

Q: If Eva QPCR SiperMix kit is applicable to instrument of Roche, could the end user just follow the protocol on your manual?

 

A: In the manual it indicates that for instruments that do not allow excitation near 584 nm, such as Roche LightCyclerTM Real-time PCR, begin optimization using .5 ul undiluted ROX reference dye in 25 ul qRT-PCR Reaction.  Tell your customer do not dillute the Rox. 

 

 

Q: Our client inquires if your product, Eva QPCR SuperMix kit( Cat#k5052200), is applicable to Roche LightCyclerTM Real-time PCR. I have downloaded the user's manual from your website but there is only protocols for instruments of Stratagene and ABI. If Eva

A: In the manual it indicates that for instruments that do not allow excitation near 584 nm, such as Roche LightCyclerTM Real-time PCR, beging optimization using .5 ul undiluted ROX reference dye in 25 ul qRT-PCR Reaction.  Do not dillute the Rox if using this instrument.

 

Q: Could you help us have the excitation and emission length of your Eva dye? And tell us why undiluted ROX can overcome the problem of instruments which are not allow excitation near 584 nm?

A: The spectral property of the Eva Green: λex/λem = 500/530 nm (DNA bound); λex = 471 nm (without DNA). Our customer discovered through testing that undiluted ROX can overcome the problem of instruments which are not allow excitation near 584 nm. We do not know why undiluted ROX can overcome the problem since we do not have this instrument to conduct the experiment.

 

 

Q: A customer who tried high resolution melting curve would like to know whether or not Eva dye (qPCR) is small enough to intercalate between each nucleotide during qPCR.

A: Others have used EvaGreen to do melting curve analysis in their qPCR routinely. Someone tried high resolution melting curve and it worked fine.

 

Q: Will BioChain's Eva QPCR Supermix work on Eppendrop thermal cycler?

A: We never tried our Eva QPCR supermix on Eppendrop thermal cycler, but therotically our Eva QPCR Supermix is compatible with any real time thermal cycler.

 

Q: Is the Eva QPCR SuperMix Kit and Pro QPCR SuperMix Kit compatible with Applied Biosystems 7500 Fast qPCR machine?

A:

 

Q: Does this product contain any materials that from baculovirus expression system?

A: No.

 

Q: The client would like to sell "expressed proteins" by using his or her choice of gene as commercial item into the market. Does the customer need permit?

A: The cDNA is sold for research purpose, customers can clone genes from the cDNA and express recombinant proteins, this still belong to research.  When they sell the expressed proteins, I don’t think they need to ask for permit.  However, if they want to re-sell this cDNA as a component together with their proteins, they need to ask for permit.

 

Q: Does the solution contain salmon sperm as block?

A: No.

 

Q: I need to isolate genomic dna from FFPE.  The FFPE DNA Extraction Kit seems to isolate nucleic acids in general.  Is this indeed the case?

A: The kit isolates nucleic acid in general but in favor of genomic DNA due to the temperature setting in the isolation procedure.

 

Q: Is the FFPE RNA Extraction Kit suitable for isolating small RNA?

A: Theoretically, the small RNA should be isolated by our FFPE RNA extraction kit as well, but currently we don’t have data to support this, yet.

 

Q: Regarding BioChain's paraffin and frozen tissue section mouse normal tissue brain, what axis was the section made (longitudinal, transversal)?  Do all the entire brain is used for the section? If not what part of the brain?

A: Our mouse brain section is coronal section to include the tissue mouse whole brain panel.  Here's a link to explain  http://books.google.com/books?id=d7DfI52k2CUC&pg=PA6&lpg=PA6&dq=brain+section+cut+direction&source=bl&ots=5x7m9vOpXw&sig=9_z9SwCsAR-cGKYz1NH3-l01YU4&hl=en&ei=3doCS-OTLYfWsgO3jvi_Dg&sa=X&oi=book_result&ct=result&resnum=1&ved=0CAgQ6AEwAA#v=onepage&q=brain%20section%20cut%20direction&f=false

 

Q: Do you usually use OCT embedded tissue block as starting material or frozen tissue block without OCT to make frozen tissue sections?

A: We usually use OCT embedded tissue block as starting material to make frozen tissue sections.

 

Q: Regarding your catalogs T6234700-2 and T6234700-5, is there an issue with the core sizes being sufficient to be representative of the entire tissue with respect to expression of a particular antigen, particularly if the antigen expression is focal or rare

A:

 

Q: Your frozen single tissue section slides (eg. T1234086) are aceton fixed and the frozen Tissue arrays (eg T6234700) are not fixed (or is there a fixative in the OCT medium?

A: Our frozen tissue array are also acetone fixed.

 

Q: After it is mounted on the slide, is it fixed?  In another word, is it on the slide under naked statement?

A: But when we cut the section from OCT block and put the section in slide, we did fix the section in cold acetone.

 

Q: I checked COA and found that 'Tissues were snap frozen in liquid nitrogen after excision, and embedded in OCT.  According to this sentence, after cutting, it is embedded in OCT.  So isn't this sample fixed?

A: The tissue is not fixed before and after it is embedded in OCT.

 

Q: Which kind of nerve are sectioned on BioChain's human FDA Standard Frozen Tissue Arrays (cat # T62344701-1, lot # B203071, positions E4, E5 and E6).

A: I have checked with our lab and the information for these 3 spots are not  very informative, because E4 and E5 are just indicated as peripheral nerve, while E6 is more specific as Trigeminal nerve.

 

Q: On the datasheet it say that the tissue arrays are 5-8 μm in thickness, mounted on positively charged glass slides, and fixed by cold acetone.  Can you please inform me about the protocol that is used for this aceton fixation?  For how long have the tissu

A:

 

Q: which percentage of acetone are you using for fixation?

A: Our standard protocol uses 100% acetone to fix the frozen tissue product for 20 minutes, followed by  4-5 hour evaporation, before -80C storage. No pathogen would survive in such condition.

 

Q: I saw your frozen section was fixed by aceton.  Can I get frozen section without fixation?

A: Yes, you can if you mention this request specifically.

 

Q: T1235149 - Frozen Tissue Section Human Adult Tumor Liver - Could you please let me know the IC value?  IC(immuno complex) value means complex of antigen, antibody and complement.  This value is used in diagnostic for many diseases.  For example, malignanc

A: We don't know the IC value for the frozen tissue section tumor liver.

 

Q: How do you check the quality of the RNA on your frozen tissue sections? Do you perform in situ hybridization test for each of your blocs?

A: BioChain doesn't isolate total rna from frozen tissue sections.  Instead, total rna is isolated from frozen tissues prior to sectioning.  We don't check the quality of the total RNA in our frozen tissue sections. We used to do ISH with beta actin probe and it always showed positive result and stopped doing this for almost 8 years.  Our COA indicates we only check h.e.  At least one of the tissue slides from each lot was stained with H & E to ensure the quality.

 

Q: The customer would like to know the fixation time when your facilities did fix the section in cold acetone.

A: 5 min at -20C

 

Q: What's the diameter of a single tissue section mounted onto a slide?

A: between 0.8 cm x 0.8 cm and 1.0 cm x 1.0 cm

 

Q: What's BioChain's protocol for fixation in acetone.

A: Merged the section in -20C code acetone for 5 seconds, then move to temperature to evaporate the acetone for one hour, then put into -80C freezer.

 

Q: What's the diameter of each section?

A: The diameter of each section is about 0.4 cm x 0.5 cm.

 

Q: Is the frozen tissue embedded by OCT "after" or "before" freezing of tissue by liquid nitrogen?

 

A: After liquid nitrogen frozen.

 

Q: Do you store Fresh frozen tissue without OCT for your long term storing and embed by OCT when you make a frozen section? or OCT embedded frozen tissue is for your storage?

A: Fresh frozen tissue is usually stored in -80C without OCT.  When a piece of tissue embedded in OCT as an OCT block, this block will be used for making frozen tissue section only, it can be stored in -80C freezer the same long term as frozen tissues without OCT.

 

Q: Are your samples from surgery or death donors? Do you provide information about sex, age and about the surgery/post-mortem time elapsed before processing the tissue?

A: The normal tissues are from death donors.  We do provide sex and age information. The post-mortem is about 4-6 hours.  The tumor tissues are from surgery, and they are snap frozen with liquid nitrogen right after disected from the body.

 

Q: Should Genomic DNA be stored in 4C?

A: Store genomic DNA in TE buffer at 2-8ºC

 

Q: Does your genomic DNA (cat# D4231035 and D4234246) show the native methylation pattern?

A: We don’t know what should be major aspect to affect the native methylation pattern, and we don’t do any QC test for methylation pattern of our genomic DNAs.  So if the customer can point out what specific treatment during the genomic DNA isolation, then according to our genomic DNA isolation protocol, just the same as Dr. P kit protocol http://www.biochain.com/biochain/ProtocolManuals/DrPKitManual.pdf we can tell if there is any change for the native methylation pattern.

 

Q: What is the concentration of genomic DNA?

A: The concentration varies from lot to lot.  In general, the concentration for 10 ug is between .5-3 ug/ul.

 

Q: Is it possible to have the genomic dna made up in PCR grade water rather than TE buffer?

 

A: Yes.  There's a $100.00 charge per genomic dna b/c we need to precipitate the DNA first and redissolve it in PCR grade water.

 

Q: I have a question. I just got Genomic DNA from Liver Tumor and PCR ready DNA from foetal liver. In description you state that you check it with PCR on B-actin. I did PCR on two sequences and none of them worked so I want to ask you what primers did you us

A: The customer received Genomic DNA - Human Tumor Tissue: Liver Tumor and PCR-Ready Genomic DNA - Human Fetal Normal Tissue: Liver.  The customer is correct in that we do check the genomic dna with PCR on beta-actin.  First, I'd like to establish whether or not the customer obtained good signal for the house keeping gene?  By the way, BioChain doesn’t guarantee that the customer will be able to amplify his or her gene of interest.  The probability of the customer successfully amplifying his or her gene lies on several factors.  One factor is whether or not the gene of interest is high in abundance?  In other words, is the gene scientifically known to be highly expressed in the choice of tissue? In the case of the customer, it’s the liver.  Second factor is whether or not the gene of interest is with high GC content.  If they are high GC content, then the customer could have enhanced his or her PCR condition by adding enhancing either betaine or dimethyl sulfoxide (DMSO).  Third factor relates to the size of the gene.  If the size is 3 KB or greater, then it's too big.  If smaller size, then the chances of successfully amplifying increases but no guarantee.  In case your customer is wondering, we don't provide primer sequence.  It's proprietary.  By the way, BioChain uses PCR SuperPCR premix.

 

Q: Are the Genomic DNA suitable for methylation study?

A: Yes.

 

Q: “We are performing real-time PCR for the detection of copy number variations of the CYP2D6 gene (cytochrome P450 2D6). I would like to know if somebody could provide us with DNA samples containing duplications of this gene. What we would need are human ge

A: We can provide various human tissue gDNAs but the customer will need to identify the organ and donor numbers.  This is the best help we can offer.

 

Q: Can BioChain's genomic dna be used to study CpG island methlation in human genome ((i.e. methylation sites are still present in the DNA)?

A: Yes.

 

Q: I have routinely bought your normal esophagus DNA (No A712262) to use as a negative control when I look for expression of specific markers in disease tissue.  I would like to know exactly the kind of tissue from which your esophagus DNA was extracted; is

A: The tissue contains everything including submucosa, epithelia, etc.

 

Q: I have routinely bought your normal esophagus DNA (No A712262) to use as a negative control when I look for expression of specific markers in disease tissue.  I would like to know exactly the kind of tissue from which your esophagus DNA was extracted; is

A: The tissue contains everything including submucosa, epithelia, etc.

 

Q: We would like to know if your genomic DNA is total genomic DNA(No.1~22 full length chromosome).

A: Our genomic DNA is the whole genomic DNA from specific organ.

 

Q: The customer would like to extract genomic DNA from a certain chromosome. Is it possible with your genomic dna?

A: We can not do the separation of chromosome DNA.

 

Q: Our customer would like to know if your following two items have trisomy at 13, 18 and 21 chromosomes. If yes, please let us know which chromosome has trisomy.

A: We never tested it before.  However, I think the customer should be able to determine it by literature search since both cell lines are very popular cell lines, and our cell lines have no difference from those publications.

 

Q: Why the price has gone up?

A: Our QC test system had changed last year.  From our record, Bio-Rad used to buy it at $399/”100ug”, but it was with the nanodrop measurement, actually it was less than 10 ug with the current pico green measurement, and for some reason Bio-Rad is asking us to continue to sell UV measured Arabidopsis DNA for quite a while. So actually Bio-rad was paying $399/10ug in the past, and the price for Bio-Rad is not increased.  In other words, our vendor increase the material price for 10 times.

 

 

Q: I am wondering if you test for specific markers to verify that the cell line hasn't mutated. Do you sequence the DNA to verify that certain targets are present?

A: We have not done any tests for specific markers.  We just obtained the cell line from ATCC, grew it and isolated DNA/RNA/protein from it.

 

Q: The customer is analyzing methylation patterns and methylation varies/changes depending on the passage number.  The customer would like to know whether the passage the cell line is in is considered when preparing the genomic DNA?

A: Though we know there are some variations between cell line passages, we don’t feel the variation can be very significant, so we don’t really count the passage number for this product and we don’t provide this information.

 

Q: If isolating from plant using genomic dna extraction kit, how much starting tissues does the customer need and what would be the yield?

A: If extracting from 1 gram of plant tissue, it's estimated that about 100ug - 200ug of genomic dna can be extracted.

 

Q: Can the genomic dna extraction kit be used on plant?

A: Yes, genomic dna extraction kit can be used on plant.

 

Q: Can the Genomic DNA extraction kit be used to isolate DNA from paraffin embedded tissues?

A: Yes, but customer need to deparafinize the tissue section first.  Also, the quality of the DNA is very poor. (100-1000 times poorer than from fresh tissue)

 

Q: How much minimum amount of tissue and cell can be used to isolate total RNA using our extraction kits.

A: Using total rna isolation kit to extract total rna leukocy from 50ml will yield maximum of 500 ug, which is = to 10 ug per 1 ml

Using total rna isolation kit to extract total rna bone marrow from 1 ml will yield between 1 - 10 ug.  Variation may result depending if red or yellow bone marrow.

Using Dr. P Kit will result in about the same yield as above.

 

Q: Is BioChain's Genomic DNA Extraction Kit suitable for extracting from Alcaligenes eutrophus?

A: Theoretically, our genomic dna extraction kit is ideal for any kind of bacteria genomic DNA isolation.  Although we don't have experience performing the isolation particularly from Alcaligenes eutrophus.

 

Q: Is the genomic dna extraction kit suitable for use on mosquito?

A: It should be but have not tested.

 

Q: Can BioChain's genomic dna isolation kit be used on insect and earth worm?

A: Yes.

 

Q: What's the minimum sample required per reaction of blood cells, tumor cells and tissues for this kit?

A: You can use 0.1 gram of blood or tumor cells and reduce the reagent amount proportionally.  For tissues, it really depends, for example, for the high yield tissue such as liver, you may start from 0.05 g and reduce reagent amount proportionally.  But for low yield tissue, such as adipose, you may start from at least 0.5.

 

 

Q: 1) Can these products be used beyond their expiry date? Is there any way to test if the product has been compromised? Are the expiry dates binding?

A: The genomic DNA can be stable for many years if you aliquot them and store in -80C.  Just use beta actin primer to test the DNA by PCR.  The genomic DNA is very stable.

 

Q: If we need concentration of 300 - 1000 ng/ul, would BioChain be able to provide DNA with this concentration?

A: Yes.

 

Q: Is the Glucose Assay Kit suitable for quantifiying glucose from whole body homogeneates from Daphnids (freshwater zooplankton)?

A: Yes.

 

Q: Is the kit suitable for measuring GSH in wine (I expect levels to be between 0 and 10ppm).

A: We tested some wine (red and white) samples with our DIGT kit.  Unfortunately, the wine gave too high of a background at 412 nm and the glutathione levels are too low in wine for dilution of the sample to work.  Therefore, we cannot recommend using our kit for gluthione determination in wine.

 

Q: Could you please let me know detailed composition of Reagent A(25ml) and B (25ml)?

A: Phosphoric acid, Sulfuric acid, Sodium tungstate, Ethanol, 5,5'-Dithiobis(2-nitrobenzoic acid)

 

Q: According to the product data, this kit can be used for plasma, serum.  How about rat plasma and serum?  Moreover could you please confirm application for rat brain tissue?

A: Glutathione Assay Kit  can measure glutathione in all plasma and serum including rat. For brain tissues, we believe it will work but we have not validated it ourselves.

 

Q: What's the concentration of the reagent?  Is it 5mg/ml the same as cat# Z5060005-1?

A: The concentration of Z506000 is 5 mg/ml.

 

Q: Can the heme assay kit be used to detect heme in murine liver samples?  If yes, could you please provide further information, how to treat the samples? Would cell lysate be sufficient?

 

A: Yes, Heme Assay Kit can used to detect heme in murine liver samples. You need to homogenize the liver cells in PBS to release heme or hemoglobin from cells. Centrifuge to obtain supernatant. Assay supernatant for heme content  Please be advised that our kit detects the total heme content: that is hemoglobin and free heme (the latter being present anyway at very low concentrations under physiological conditions).

 

 

Q: Can it be used on cell culture?

A: The Heme assay kit can be used to measure heme in cell cultures.  However, if the supernatant (cell media) of the culture is what is being assayed, one should know that phenol red has about 10% interference and media should be used for the sample blank.  If intracellular heme is being measured, we recommend the following:

 

1. Pellet and wash your cells. 

2. Homogenize cells with the DIHM reagent which contains NaOH and detergent which will effectively lyse the cells.

3. Let incubate for 5 min for the color to develop then centrifuge to pellet any debris

4. Transfer supernatant to titer plate or cuvette and measure the absorbance at 400 nm.

As for the sample size, follow the protocol as written and dilute the sample if necessary (sample has higher than 125 uM Heme).

 

 

Q: Is the Heme Assay kit suitable for measuring protoporphyrin IX in cell culture?

A: No.

 

Q: Can the hemoglobin assay kit be used on mouse serum or blood.

A: Though test have not be done, it should be ok to use on mouse serum or blood.

 

Q: 1.  What's the difference between Hemoglobin Assay Kit and Heme Assay Kit?  Short and simple explanation would be good.  2.  In the past, you indicated in your e-mail that heme assay kit can be used in murine.  Can hemoglobin assay kit be used for mouse?

A: 1.  The reagent and calibrator are the same for both kits.  2.  Yes, both kits can be used for any species including mouse, rat, human etc.  3.  No. The calibrator is a stable chemical dye that absorbs at the same wavelength as the reaction product. Hemoglobin itself is not stable and therefore we can not provide hemoglobin itself as a standard or calibrator.

 

Q: Regarding cat# Z5030026, is the standard really a recombinant protein or a coloured substance to perform standard curve?

A: In the hemoglobin kit, the calibrator is a dye that has been formulated to give the same absorbance as a specific concentration of hemoglobin (100 mg/dL).  You are not intended to and, moreover, cannot perform a standard curve with this calibrator since it will not behave the same as hemoglobin at different dilutions. 

The standard curve depicted in the protocol was performed with actual hemoglobin.  However since hemoglobin is not very stable in solution we stopped including it with the kit.

 

 

Q: Regarding the standard curve in the data sheet, please advise what animal the sample is from.

A: The standard curve is made from pure hemoglobin but not from animal samples.  It means we bought pure hemoglobin from a company, such as Sigma, then freshly dissolved it in water and dilute it into different concentration and then measured it.

 

Q: Sensitivity: What is the minimum limit of virus DNA/RNA needed to have PCR products? Do you have any internal resources about this?

A: The sensitivity is not depend on the primer but depend on PCR technology.  So I will say if you have very good PCR reagent, you can pick up at least 5 copies of the gene in the solution. No, we don’t have any internal resources.

 

Q: Does this item include corresponding positive control?

A: No, we don’t have positive control.

 

Q: If available, may our customer have the QC data for this primer pairs?

A: Since we have “No” answer to the 2nd question, so answer to this question is also “no”.

 

Q: (1) Is this kit approved by WHO or any appropriate agency?  (2) What is the Sensitivity and shelf life of the kit?  (3) Do we have Yeast Cytocine deaminase cDNA?

A: 1. The kit is for research use only, so it doesn’t get WHO approval.  (2) Shelf life is 12 month.  (3). No

 

Q: Which of your housekeeping gene primer pairs (beta actin, alpha actin, GAPDH, ubiquitin, 18S rRNA and 28S rRNA) produces PCR products of the same length with genomic DNA and cDNA.

A:

 

Q: Does the HSV primer set include a positive control or not?

A: This primer set doesn’t include positive control.

 

Q: Would you please let me know exactly which part of the HSV-1 virus amplify these primers?

A:

 

Q: What PCR product size can be obtained with this primer?

A: 132 base pairs

 

Q: What is the expected band size?

A:

 

Q: Which beta-actin is found in cat# C15340040-Cy?

A: Cat# I3210004

 

Q: What's the PCR size and what's the concentration of the control.

A: The PCR size is 838 bp.  Concentration is 5uM.

 

Q: We have a customer that is interested in human cell lines for to be employed like control, positive and negative, in experiments of stem cell differentiation, they need fibroblasts and osteoblasts, perhaps it could be possible that you have those cell lin

A: I think you may recommend the customer try to get these cell lines from ATCC.

 

 

Q: What's the PCR product size of the GAPDH?

A: 410 bp

 

Q: What is the expected band size?

A:

 

Q: What is this against, what specific HSP will be amplified. Will it work for E.Coli too?

A:

 

Q: Where's the sequence position of the primer binding sites ?

A: This is proprietary information.

 

Q: What's the size of PCR product that can be obtained using this primer pair?

A: The PCR product size is 496 bp.  The primer was designed according to genbank access code M26880.

 

Q: They should work after the protein lysate is low dyalized against 0.01 percent SDS.

A:

 

Q: How many slides can be stained with your Poly-HRP IHC Amplification Kit?

A: 150 slides

 

Q: I wish to perform immunohistochemistry for detection of CB2 receptor in paraffinized sections of mouse skin. I will be ordering the

CB2 receptor antibody which is a rabbit polyclonal antibody (from Cayman Chemicals). I wish to know if you have a kit that

A: Poly-HRP IHC Amplification Kit

 

 

Q: I need some technical advice regarding the use of an appropriate assay kit. I wish to perform immunohistochemistry for detection of CB2

receptor in paraffinized sections of mouse skin. I will be ordering the CB2 receptor antibody which is a rabbit polyclo

A: You may use our Poly HRP IHC amplification kit (K3184015) to detect CB2 receptor in paraffinized sections of mouse skin. Here is the web link for more detail info about this Kit:

http://www.biochain.com/biochain/ProtocolManuals/PolyHRPManual.pdf

You may have to make sure that you use anti rabbit HRP secondary antibody in the IHC.

 

 

Q: I would like to ask you for information concerning the histology/immunohistochemistry services available from your company.

 

We would need immunohistochemistry staining performed on frozen or paraffin sections of organotypic cultures - 3D skin equivalen

A: If you can provide all the antibodies and slides, we can definitely do this service for you.  If the antibody IHC condition is given, then for each antibody, there is $150 set up fee, and $3.00/slide for the first 10 slides.  $15.00/slide from 11th slide

If the antibody IHC condition is unknown, then for each antibody, it will be $2000 for each antibody's IHC condition optimization, later on $3 per stain.  For other fee details, you can get it from http://www.biochain.com//biochain/Products%20and%20Services/CustomService/IHC.htm

 

 

Q: What dillution should be used with the buffer?

A: DPC water

 

Q: Is the in-situ hybridization kit, cat# K2191050, suitable for detection of virus genome with RNA?

A: Theoretically, there is no problem for this kit to detect the pestvirus RNA, though we did not have any experience in doing the ISH in detecting such specific genomic RNA.  I believe the crucial part in doing ISH is having a good probe.  Testing the probe with positive RNA dot blot first to make sure the probe is working is very important.

 

 

Q: Can the iron assay kit be used to detect iron in rat urine and stool sample?

A: We have not validated the iron assay kit in urine and stool samples, but believe that it should work. While urine samples can be assayed directly without pretreatment, stool samples would need extraction for iron and filtration or centrifugation prior to assays.

 

Q: Is the Iron assay kit suitable for use in hepatic and splenic samples?

A: Yes, our iron assay kit can be used to measure iron content in liver tissue.  However, sample preparation will be different from that with the cells. A recommended procedure for sample treatment is as follows:

Tissue samples were dried overnight at 106°C and weighed.  Samples were then solubilized in 6 mol/L HNO3 by heating at 100°C to release protein-associated iron.  The solution is neutralized with NaOH, diluted in deionized water as necessary, and assayed for iron concentration using the DIFE-250 kits.

 

Q: Could you please tell me if the Iron Assay Kit (cat# Z5030022) could work on cell lysate (from cell culture).

A: In the manual http://www.biochain.com/biochain/ProtocolManuals/Z5030022.pdf it states Direct Assays: iron in biological samples (e.g. serum).   Assuming that cell lyate (from cell cuture) is considered biological samples, then I would say that our kit could work on this.  Though we have not tested the cell lysate ourselves but only serum, the kit should work for it theoretically.

 

Q: For a certain nanoparticle composed of Iron can such sample be detected by this kit?

A: Our iron kit only measures soluble ionic Fe (Fe2+ & Fe3+).

 

Q: The user's manual states that mineralized sample can be used.  What kind of mineralized sample can be used?

A: We do not have experience with nanoparticles of Fe2O3. Typically Fe2O3 can be solubilized in dilute (e.g. 0.1 N) HCl to form FeCl3. The customer may need to heat the solution to ensure complete dissolution. Then the solution is neutralized with the same amount of NaOH. The neutral sample can be assayed directly with our kit. For your information, we can provide analytical services for the customer, if they like it.

 

Q: For a nanoparticle composed of Iron, what's the method of sample preparation?

A: Solid iron would need to be solublized with strong acid and neutralized before measuring with our kit.

 

Q: Please provide details of ISH and IHC service.

A:

 

Q: Are probes included with the ISH Kit?

A: No.

 

Q: The protocol says to use 4% paraformaldehyde, would formalin be sufficient to use for fixation?

 

A: Formalin is the name of 4% formaldehyde, so she could use formalin. 

 

 

Q: If I am targeting DNA is the pre-hybridization step sufficient for denaturing?  I am not sure if I have correct thinking bc I am very new to this technique. If I were to use a double stranded DNA probe, would I need to add an additional step to denature t

A: For DIG labeling, if you are using PCR method, denaturation is required to generate single strand DNA probe before hybridization. You may heat up the double stranded DIG-DNA to 65C and chill it quickly on ice.

If you are using T3/T7 RNA polymerase to label DIG onto RNA probe, you do not need denature DIG-RNA before hybridization.

 

 

Q: What does BioChain recommend as a kit to label RNA probes for its ISH kit?

A: The kit, AmbioMAXIscript® SP6/T7 Kit, which we have been using is from Ambion and Dig is purchased from Roche.

 

Q: I would like to know your pricing for ISH service (RNA hybridization) for one gene.  What method do you use, S35 or digoxigenin?  What type of report do you do after ISH?

A: We use digoxigenin for ISH service.  The price structure can be viewed from http://www.biochain.com//biochain/Products%20and%20Services/CustomService/ISH.htm

 

Q: What animal did the anti-DIG come from?

A: sheep, conjugated with alkaline phosphatase

 

Q: Cartilage RNA Isolation Kit-What would you suggest as starting amount (1g tissue?)

What is the expected amount of RNA one can isolate using this kit (per g tissue?) by BioCat

 

A: 1 g, 1-10ug, the kit is designed for a total amount of 5g.

 

Q: For Total protein extraction kit, we notice that there are DNA and RNA extraction kits for FFPE samples. Do you advise this protein extraction kit be used in FFPE samples

A: No.

 

Q: May we know have you tested the efficiency of gDNA extraction kit ? The customer would like to know how much gDNA could be extracted.

A: The kit yield is pretty high, and usually higher than the column based kit.  It is hard to say how much gDNA can be extracted because this varies a lot from tissue to tissue, I will say you may get around 2 to 3 mg DNA from liver tissue.

 

Q: We have a customer interested in Mitochondria Activity Assay Kit. They would like to measure mitochondria activity in mouse tissue. They would like to know, if they should isolate mitochondria from tissue in order to this? In the protocol there is only me

A: Mitochondria need to be isolated first in order to use this kit to measure. The recommended mitochondria isolation kit is KC010100. This kit can be used for all mammals including human and mouse tissue.

 

Q: Are all proteins obtained by this CNMCS kit in native conditions or in denatured forms?

A: Cytoplasmic, nuclear, and membrane proteins are in native conditions, but cytoskeleton protein is in denatured form.

 

Q: I am studying mitochondrial proteins, and I would like to know by using your CNM kit, which fraction contains mitochondrial proteins.

A: It is membrane fraction.

 

Q: Can your CNM kit separate the membrane proteins from different organells?

A: It is very hard for us to separate the membrane proteins from different organells, at current situation we don't have any answers for that.

 

Q: What homology does your Human Beta Actin cDNA probe have with rat?

A: The human beta actin cDNA probe we have share 89% homology with rat

 

Q: What is the components of each buffer in CNM and CNMCS kit?

A: The information can be obtained from the kit manual.

 

Q: Do you have any idea in which fraction the microsome proteins is when you use your CNM or CNMCS kits?

A: We believe the microsome proteins should be in the cytoplasmic protein fraction since the centrifugation speed is not high enough to precipitate the microsome during that preparation.

 

Q: Do you know if the membrane fraction contains every membrane proteins when you use your CNMCS or CNM kits?

A: Yes it does.

 

Q: I would like to know whether the different extractions resulting from CNM kit

are adequate for analysis by immuno precipitation?  Are the complexes of macro molecules kept for this analysis?

A: Yes, all the proteins extracted by the kit should be ok for i.p analysis.  The complexes of macro molecules should be kept.

 

Q: Are all proteins obtained by this CNMCS kit in native conditions or in denatured forms?

A: Cytoplasmic, nuclear, and membrane proteins are in native conditions, but cytoskeleton protein is in denatured form.

 

Q: I am studying mitochondrial proteins, and I would like to know by using your CNM kit, which fraction contains mitochondrial proteins.

A: It is membrane fraction.

 

Q: Can your CNM kit separate the membrane proteins from different organells?

A: It is very hard for us to separate the membrane proteins from different organells, at current situation we don't have any answers for that.

 

Q: What homology does your Human Beta Actin cDNA probe have with rat?

A: The human beta actin cDNA probe we have share 89% homology with rat

 

Q: What is the components of each buffer in CNM and CNMCS kit?

A: The information can be obtained from the kit manual.

 

Q: Do you have any idea in which fraction the microsome proteins is when you use your CNM or CNMCS kits?

A: We believe the microsome proteins should be in the cytoplasmic protein fraction since the centrifugation speed is not high enough to precipitate the microsome during that preparation.

 

Q: I used your CNM kit isolating compartmental protein, and the protein concentration was measured by UV spectrum.  The quantity of the membrane protein was 10 times more than the cytoplasmic protein, is this normal?

A: No, it is not normal.  Usually the relative yield of Cytoplasmic and membrane fractions, it's about 2-3:1.  I would suggest you run your protein on SDS-PAGE gel and see if the protein intensity matched the concentration you have measured from UV specturm.  If the protein intensity from SDS-PAGE gel is consistent with the quantity measured from UV spectrum,  then the tissues or the cells probably were not homogenized  very well in the first step.  Increasing the speed setting of the homogenizer for tissues, and increasing the repetition of homogenization up to 5 times (normally 3 times).  will help. For  cells, I suggest pipette enough times to make sure the cells are completely lysed.

 

 

Q: I saw your manual that the enhancer works on PVDF membrane, but does the enhancer work for nitrocellulous membrane?

A: Yes

 

Q: Are the proteins isolated by CNM kit good for 2D

A: Yes, but nuclear fractions need to be dialyzed before using it for 2D experiment

 

Q: My membrane was dried after the protein transfer.  Will the enhancer still work on my dried membrane?

A: Yes, it does.  However, we would recommend you extend the enhancer incubation time from 2 minutes to 5-10 minutes.

 

Q: I used your CNM kit isolating compartmental protein, and the protein concentration was measured by UV spectrum.  The quantity of the membrane protein was 10 times more than the cytoplasmic protein, is this normal?

A: No, it is not normal.  Usually the relative yield of Cytoplasmic and membrane fractions, it's about 2-3:1.  I would suggest you run your protein on SDS-PAGE gel and see if the protein intensity matched the concentration you have measured from UV specturm.  If the protein intensity from SDS-PAGE gel is consistent with the quantity measured from UV spectrum,  then the tissues or the cells probably were not homogenized  very well in the first step.  Increasing the speed setting of the homogenizer for tissues, and increasing the repetition of homogenization up to 5 times (normally 3 times).  will help. For  cells, I suggest pipette enough times to make sure the cells are completely lysed.

 

 

Q: What is the difference between CNM and CNMCS kit?

A: These two kits are exactly the same except CNMCS kit has one more buffer, which is CS buffer for isolation of cytoskeleton proteins

 

Q: Let us know the yield for cat# KS341025. It’s not on the data sheet. We’d like to know the yield for each sample type.-Daemyung

A: different tissues will have different yields

 

Q: What is the yield of total RNA and miRNA

A: The yield of total/micro RNA from blood is relatively low as a general concept.

Our miRNA isolation kit could achieve up to 15 ng miRNA/ml blood.

 

Q: Is this kit applicable for chicken material?

A: Therotically the kit should work for chicken sample as well, however we did not test it.

 

Q: Is dilution step still required to be done on BioChain loading buffer before adding to protein lysate?

A: Our loading buffer is ready to use and therefore no dilution step is necessary before adding to the lysate.  Let me know if you have additional questions.

 

Q: Currently, I want to test the concentration of magnesium in the fermentation broth and I've found that one of your products Magnesium Assay Kit can possibly do this. But I'm not sure of it. Can you tell me more about it? Additionally, in the introduction

A: We have not tested the kit with fermentation broth, but see no reason why it would not work.  For best results the broth should probably be deproteinated as described in the protocol.

 

Q: According to the product detail, this kit is for "Quantitative Colorimetric Magnesium Determination at 500 nm".  May I use 490nm detector in place of 500nm detector?

A: We performed spectrum for the Mg kit.  The deltaOD using 490 nm is 25% lower than that at 500 nm.  So while the customer can use 490 nm, they need to be aware that the measured ODs will be significantly lower and the detection limit will be higher.

 

Q: Does the Malachite Green reagent reacts with phosphate group in phospholipids or is it more likely to be free phosphate contamination in asolectin reagent?

A: Our malachite green kit only detects free phosphate.  It's likely that your asolectin reagent has free phosphate contamination.

 

Q: How does the pathologist determines which is primary tumor and which is adjacent normal?

A: When the surgeons did the operation, they always cut tumors together with the adjacent normal tissue.

The adjacent normal tissues will be separated from the tumor after the surgery.

Pathologist will look at both tumor and adjacent normal tissues from H.E. staining

Usually 70%-90% of the tumor tissues are claimed as tumors, and it is normal the adjacent normal tissues have more and less tumor cells in it, and we consider the adjacent normal tissue with less than 10% cancer cells to be sold as matched pair’s normal part (it should be common sense if the normal part has too many cancer cells, then it has to be considered as tumor).

 

Q: What is the thinkness of your a single tissue section?

A: Thickness: 5 µm thickness

 

Q: What is the size of your tissue section?

A: Tissue section size: about 5 mm x 5 mm

 

Q: Each item contains 5x2 slides in one package.  Does this mean 5 slides of Primary tumor and 5 slides of normal tissue(metastatic tumor), total 10 slides?

A: Yes

 

Q: Please explain that why cavernous hemangioma is not good for making the product. It should spread out to adjacent normal area and it can not used for normal tissue ?

 

A: Yumiko, I've just asked your question to Dr. Liu.  He said, "It's can't be considered a real tumor even though it's located in the liver," or words to these effect. 

A cavernous hepatic hemangioma is the most common non-cancerous tumor of the liver. It is believed to be a congenital defect, and is usually not discovered until medical pictures are taken of the liver for some other reason.  Here's the direct link where I got it from

http://www.nlm.nih.gov/medlineplus/ency/article/000243.htm

 

 

Q: Does BioChain have Matched Pair - Total RNA - Human Primary and Metastatic Tumor Tissue: Breast: infiltrating ductal carcinoma type of cancer?

 

A: All of our cat# R8235086-PM, Matched Pair - Total RNA - Human Primary and Metastatic Tumor Tissue: Breast, are infiltrating ductal carcinoma.  However, we used invasive ductal carcinoma instead of infiltrating ductal carcinoma, but  I did a google search and read that these are synonymous.  Please see http://www.healthcentral.com/breast-cancer/types-36003-5.html.

 

Q: How many matched pairs do you have for each tumor type?

A: We usually have more than 10 different donors.

 

Q: How are the fractions transferred to the nylon membrane?

A: We use an "arrayer" that punches the fractions onto the nylon membrane.

 

Q: How are the recovered protein fractions printed on modified nitrocellulose membranes.

A: Using vaccum transferring system

 

Q: Molecular size of Na+K+ATPase of membrane protein marker.

 

A:

 

Q: Provide further details regarding the protocol used to isolate the membrane fraction for Membrane Protein

A:

 

Q: Is it possible to stip the membrane and reuse it developing with enhanced chemiiluminescent (ECL)?

A: Yes.

 

Q: The customer will use the membrane protein for NMR detection.  The customer is concerned that the NP-40 and cocktail of protease inhibitors may interface with the result.  Therefore, he wants to remove (for example buffer exchange) them before detection.

 

A: 1. We can recommend methods, but we won't guarantee the methods will work.  Because the protein lysate is mainly used for western blot, IP, enzyme activity assay, and we don't have experience if the protein can be used for NMR.

2. Dialysis might be able to get rid of the NP-40 but I doubt if it can remove the protease inhibitors, since lot of the inhibitors are also proteins, it might be difficult to separate them.  I only know our high salt nuclear protein can be dialysed then used for gel shift assay, but I don't know what will happen for the membrane protein.

3. Run the protein lysate through Sephadex may also separate different molecular weight proteins.

 

 

Q: I couldn't get good results in SDS-PAGE using our membrane proteins.

A: Membrane proteins tend to aggregate in SDS specially in the heating step. So don't use the heating step. When you add membrane proteins in sample buffer, let it stay for a few minutes in RM. You may dilute membrane proteins in a series of concentration with 2% SDS. You then load it in the gel.

 

Q: How to remove EDTA?

A: Three methods to remove EDTA by replacing buffer: 1) centrifugation filtration; 2) NHSO or Acetone precipitation; 3) gel filtration

 

Q: What's the % of EDTA that's found in the membrane proteins?

A: 1 mM

 

Q: 1. How many pancreata are used to make the lysis? 2. Are the rats fasted prior to harvesting the pancreas? 3. I know you won't be able to give me exact details with regards to the exact components of the lysis buffer; but it would be helpful to understand

A: 1.  We use the whole pancreas from one rat to make a batch of membrane proteins.  2. The rats are not fasted prior to harvesting the pancreas.  3.  Our protein lysate buffer includes Hepes, MgCl2, KCl, EDTA, Glycerol, sodium deoxycholate, sucrose, NP-40, and cocktail of protease inhibitors.  I would say that it is hypontonic lysis since it contains both NP-40 and sodium deoxycholate.

 

Q: The customer would like to purify a neuraminidase protein of Influenza A virus (Htaya strain) which was cloned in the pET 28 (a) vector and expressed as a membrane protein in E-coli BL21 host cells.  Furthermore, the customer would like to do the Ni-NTA c

A:

 

Q: You have a primer set for miR-24 and miR-16. Why you choose these kind of miRNAs for the kits.  Does it have to do with miR-24 and miR-16 being key to analyzing miRNA functions?

 

A: These two miRNAs are like house keeping genes in micro RNA family, so we choose them as initial kits.  Though we have the capability of making other miRNA detection kits, we don’t want to launch too many in our current situation.

 

Q: "BioChain’s microRNA qRT-PCR primer sets were uniquely designed and optimized for detecting mature miRNA with high specificity and sensitivity at low PCR annealing temperature.  I am confused by "low PCR annealing temperature" in this description.  Is thi

A: Usually if the annealing temperature is low, then the specificity will drop.  But biochain can still keep the high specificity with low temperature.

 

Q: How many primers do your kit contain?  Describe what each primer is for.

 

A: We have two primesr.  One primer is used as RT primer and also reverse primer for PCR.  Another is used as forward primer for PCR.

 

Q: Could you let me know composition of buffer used in each component ?

A: 1. MicroRNA 5x qRT-PCR Reaction Mixture (containing Evagreen Dye): KCl, Tris-HCl, MgCl2, DMSO, dNTP, EvaGreen dye, Taq polymerase.  2. MicroRNA qRT-PCR Enzyme Mix: RNase Inhibitor, reverse transcriptase, Tris-HCl, 1 mM DTT, Triton X-100, Na2EDTA, NaCl, glycerol.  3. ROX Reference Dye 100 µl : ROX dye.  4. miR-24 qRT-PCR Primer Set (25x) 200 µl: oligo nucleotide.  5. Human Placenta Total RNA (25ng/µl) 100 µl: Total RNA.

 

Q: Is your microRNA isolation kit's column silica membrane base?  Ambion uses a glass fiber filter and Ambion say using silica membrane will lose more small RNAs. I would like to know a recovery rate of your kit compared to Ambion kit (AM1560 mirVana™ miRNA

A: Ours is special membrane based, we did not calculate the recovery rate, but we got the same yield and same real time PCR comparing with Ambion's AM1560 mirVana™ miRNA Isolation Kit.

 

Q: Q1: Process time, BioChain: Process time: <30 min, Ambion: Process time: >45min

Previsouly, you informed me of the above comparison feature of microRNA isolation kit with corresponding Ambion Kit.  Accodring to Ambion's protocol, Ambion kit uses almost sa

A: Q1: The 35 min just roughly estimated time from the protocol, we might calculate the time too ideally that each step is followed immediately.  So I would not say we have big time saving advantage.  I think Ambion may use a modest way to calculate the time.

Q2: We did some site by site comparison, regarding the yield and real time PCR test, and we got similar result.

Q3: Don't know.  Qiagen may have one.

 

Q: 1. Can you use your miRNA One-Step qRT-PCR Detection Kit for Roche real time PCR for capillary type (LightCycle)?  2. Have you ever use Ambion primer set with your detection kit?

A: 1. Yes, the miRNA One-Step qRT-PCR Detection Kit can be used with Roche's Light cycler.  However, if you read the Rox dye usage in the manual, Roche's light cycler belong to the instrument that do not allow excitation near 584 nm (such as ABI PRISM®/GENEAmp® 5700 instrument), begin optimization using 0.5 µl undiluted ROX reference dye in 25 µl qRT-PCR reaction, this means you need to use 10 times of the ROX dye when you use Light Cycler.  2. Biochain's one step qRT-PCR detection kit primer has special design, so the primer is definitely different from Ambion's.  We did not try Ambion's primers, theoretically their primers won't work the same as ours (should be worse) in using our reagent.  But some of their primer pairs might work, the chance is about 50%.

 

Q: If starting from total RNA, what's the recommended amount of total RNA to start with to extract microRNA using MicroRNA Isolation Kit?

A: Start with 50 ug of total rna

 

Q: How are we able to retain some of the microRNA in the total rna?

A: It is just the column binding capacity, under certain buffer conditions, the column can hold small molecular RNA tightly, then the small molecule RNA can be eluted by other buffer system.

 

Q: How are we able to retain some of the microRNA in the total rna?

A: It is just the column binding capacity, under certain buffer conditions, the column can hold small molecular RNA tightly, then the small molecule RNA can be eluted by other buffer system.

 

Q: Does BioChain's total rna contain miRNA?

A: Yes.

 

Q: Can BioChain's "Pre-made Multiple Tissue Northern Blots" be used for micro RNA detection?  Do you have any product for micro RNA?

A: Our total RNA has been proven to contain microRNA by PCR detection.  However, we have not tested whether or not microRNA can be detected in Northern Blot.  It might be possible to detect microRNA from total RNA northern blot but we doubt if microRNA can be detected in mRNA northern blot b/c we believe the microRNA might have been lost during oligo dT mRNA purification.

 

Q: I am very interested in your miRNA prodcut:

miR-24 One-Step qRT-PCR Detection Kit.  But I am not very sure on its effect,can you email me some published papers used it to detect miRNAs?

 

A: Thank you for your interest in this miRNA detection kit.  We launched this product not too long, ago.  So we currently don't have any published papers as reference for this product, yet.  The kit's manual can be downloaded from the website.

 

Q: Can our microRNA extraction kit be used to isolate microRNA from mouse plasma?  If yes, what's the amount of plasma required as starting material and what's the average yield obtained?

A: We have not tried extracting microRNA from mouse plasma using our microRNA extraction kit.  We believe that the microRNA amount in plasma might be minimum, and I doubt if they can get anything from the plasma.

 

Q: Is the microRNA isolation kit suitable for use in cell culture supernatant?

A: Our kit is suitable for use in blood and serum.  Since blood and serum refers to cell culture supernatant, then the answer to your question is "yes."

 

Q: What's the yield using BioChain's microRNA isolation kit?

A: The microRNA yield is very low and depends on tissue types.  For the high yield tissue such as liver, the estimated microRNA yield is around 1-5 ug per gram tissue.

 

Q: Is the microRNA isolation kit suitable for rice seed.

A:

 

Q: What's the concentration of Chloloform and Acidified Phenol?  Regarding Acidified Phenol:Chloloform, is Phenol: Chloroform: Iso-amyl alcohol(25:24:1)?

A: 70% phenol and 30% chloroform

 

Q: 1)The customer would like to use this kit for blood sample.  Please inform us of the citation or any information if you know.

A: No any citation yet since the kit was just upgraded for blood sample microRNA isolation

 

Q: How is the disproportionate rate of yield of miRNA from the same sample (e.g. same tissue of the same individual)?  If you have any data, please let us know it.

A: microRNA yield is very low, and usually is not measurable or quantitative by UV, from 1 ml blood, the microRNA yield is about 1-15 ng.

 

Q: The customer would like to know the recommended internal standard gene for real-time PCR of blood sample miRNA.

A: I think mi24 and mi16 should be ok

 

Q: "BioChain’s microRNA qRT-PCR primer sets were uniquely designed and optimized for detecting mature miRNA with high specificity and sensitivity at low PCR annealing temperature.  I am confused by "low PCR annealing temperature" in this description.  Is thi

A: Usually if the annealing temperature is low, then the specificity will drop.  But biochain can still keep the high specificity with low temperature.

 

Q: Could the Millennium Enhancer be used as a Last step during a western blot process to enhance the signal? Instead of using it first during the Western blot? I raised this question because one customer was saying that he have an enhancer which could be use

A: Our enhancer is effective on the protein-antibody binding step, so the enhancing effect is only on the first step, and I don’t see it will have enhancing effect on the last step.

 

 

Q: You have a primer set for miR-24 and miR-16. Why you choose these kind of miRNAs for the kits.  Does it have to do with miR-24 and miR-16 being key to analyzing miRNA functions?

 

A: These two miRNAs are like house keeping genes in micro RNA family, so we choose them as initial kits.  Though we have the capability of making other miRNA detection kits, we don’t want to launch too many in our current situation.

 

Q: The customer would like to measure COX activity of mouse soleus muscle  with this kit.  If you have any information about recommend sample preparetion method (e.g. homogenate), please let us know it.

A: Try our mitochondria isolation kit.

 

Q: I am now trying to use this kit but this is not working well even by positive control(including this kit).  Can you tell me actual A/min when using positive control? Because enzyme activity I calculated was very small.  And I also want to know if I can pu

A: The positive control Xia has right now is probably too old (about ~2 years old) and loose the orIiginal activity. I am suggesting the production department to make a new batch of cytochrome c positive control.

 

For positive control, firstly 1:10 dilute the positive control, then add 50ul of the diluted positive control sample to the assay, the actual A/min is between 0.05-0.06. The activity of the positive control is about 0.5-0.6 unit/ml.

 

As to the purity of the mitochondria, it is about 90% purity. It may have some contamination of the ER.

 

Q: Lot A810233 - I used the included control but didn´t get a change in absorption. OD was the same after 5, 10, 20 and 30 seconds.  I added the corresponding reagents and started directly the reading.

A: The customer should mix the sample within 5 sec and start the reading right away. Starting the reading at the time point of 20sec is too late.  The cytochrome C oxidase reactions is a second-order reaction and usually occur very quickly in the first 15-20sec, then slow down.

 

Q: Can the Mitochondrial Activity Assay Kit be used on sheep oocytes?  How small a sample it can work with, in terms of amount of tissue?  My customer would like to analyze individual oocytes separately - is the kit *that* sensitive?

A: We have not tested the mitochondria activity assay kit on sheep occytes.  However, we assume it's applicable since it states in the user's manual, "Mitochondria can be prepared from a variety of mammalian cultured cells and tissues by differential centrifugation."  The user's manual doesn't indicate exactly how much starting material the customer should use but it does state "Assay various amount of samples to find a linear range for the sample."  For optimal preparation of mitochondria, it is recommended to use the BioChain’s Mitochondria Isolation Kit (Catalog # KC010100).

 

 

Q: What is 0.1 to 0.2 mg protein/ml?

A: Total protein in suspension.

 

Q: What is 1 – 2 micro grams of protein?

A: Total protein in suspension.

 

Q: Is the mitochondria activity assay kit suitable for use by microplate?

A: We have no protocol to show that our kit can be applied to microplate.  Please ask the customer to modify it own their own.

 

Q: I would like to know the purity of the mitochondria that we purify with this kit (KC010100: Mitochondria Isolation Kit for Tissue and Cultured Cells). We want to do an activity test assay of a mitochondria membrane protein, but we do not want any contamin

A: The positive control Xia has right now is probably too old (about ~2 years old) and loose the orIiginal activity. I am suggesting the production department to make a new batch of cytochrome c positive control.

 

For positive control, firstly 1:10 dilute the positive control, then add 50ul of the diluted positive control sample to the assay, the actual A/min is between 0.05-0.06. The activity of the positive control is about 0.5-0.6 unit/ml.

 

As to the purity of the mitochondria, it is about 90% purity. It may have some contamination of the ER.

 

Q: How long will the mitochondria stay alive after extraction?

A:

 

Q: Is BSA (Bovine serum albumin) included in any component of the mitochondria isolation kit?

A: No.

 

Q: How much concentration of sodium is included in the Lysis Buffer?

A: The sodium concentration is very low in the buffer (less than 1 mM).

 

Q: Can the mitochondria isolation kit be used on plant?

A: No, the mitochondria isolation kit is not suitable for plant.

 

Q: What is the smallest amount of sample she'll need to be able to isolate DNA from mitochondria using our mitochondria isolation kit?

A: Our protocol recommends customers to use 100-200mg tissues. However downscaling the tissue samples to 10mg should work too.

 

 

Q: Which reagent does she need to extract DNA from mitochondria and is it? Does this reagent come with the mitochondria kit?

A: The mitochondria kit doesn't come with DNA extraction reagents.  The customer will need to work out the mitochondria DNA extraction  protocol.  Refer to the website for mitochondria DNA isolation http://wheat.pw.usda.gov/~lazo/methods/lazo/dnaplmit.html

 

Q: For how long can the mitochondria be stored after extraction.

A: The stability of the mitochondria isolated from different tissues varies.  I can tell the mitochondria isolated from human kidney can still keep 80% of the activity after 6 months frozen in -75C

 

Q: Is BioChain's mitochondria isolation kit suitable for use in White Blood Cells (WBCs)?

A: Yes.

 

Q: Is the Mitochondria Isolation kit suitable for use with cryo preserved tissue?

A: Yes.

 

Q: Can peroxisomes be isolated from tissue or cells?

A: We don't have data.

 

Q: Is it possible to obtain the citosolic fraction of the cells after any of the centrifugations in the protocol?

A: The kit can be modified for cytoplasmic isolation.

 

Q: I would like also to know if it is possible to use the RNA of the extracted mitocondrias to perform RT-PCR?

A: If you can isolate RNA from the extracted mitochondria, then you can use the RNA for RT-PCR with random hexmer for RT (oligo dT might not work because mitochondria RNA may not have poly A region in the 3' tail)

 

Q: Is the mitochondria isolation kit suitable for isolating mitochondrial from human primary blood monocytes?

A: Though we did not have experience using this kit for blood monocytes, theoretically the kit should work.

 

Q: After collection of blood sample, how many days we can store the blood for mitochondrial isolation and activity assay.  Please provide me the storage conditions and time of the sample.

A: If stored in -80C, at least one year.

 

Q: For the customer it is crucial that the mitochondria are still intact after isolation, i.e. the citrate cycle should still be functional.  The customer says that e.g. cytochrome c still being detectable inside isn’t really an indicator for intact mitos be

A: Ask the customer to test membrane integrity which is also included in the kit.

 

Q: Is the mitochondria isolation kit suitable for isolation of mitochondria from human hair sample and mouse tissue.

A: Technically it should be but this experiments have not been performed by us.

 

Q: Can other membrane proteins be isolated with this kit?  In the user's manual it reads, “Mitochondria can be frozen at -80°C until use.”   How long can they be stored without being damaged/losing performance?  When you store them at -80°C, do they keep the

A: No, other membrane proteins cannot be isolated with this kit.  It's best to use CNM for other membrane proteins.  The longest we tested was after a month, the activity lost about 10%.

 

Q: Using both Mitochondria Isolation Kit & Genomic DNA Extraction Kit, is it possible to isolate mitochondrial dna?

A: I confirm that by using both BioChain’s Mitochondria isolation kit and genomic dna extraction kit, it's possible to isolate mitochondrial dna.  Though I should note that the yield will not be very high as I believe only 1% of mitochondrial dna makes up the total genomic dna.  To give an example, let say the customer has 1 gram of tissue and from this tissue is able to isolate about 100 ug of genomic dna.  Then, the expected yield is about 5 ug of mitochondrial dna.

 

Q: I have a customer interested in the Mitochondria Activity Assay Kit but he wants to know if he also needs to get the Mitochondria Isolation kit or if he can simply lyse the cells and run the Activity assay?  This information was not clear by reading the p

A: If the method of lysating the cell is for total protein extration, then the customer doesn't need to purchase the mitochondria isolation kit.  However, if for the purpose of mitochondria isolation, then it will not work to only purchase the mitochondria activity assay kit.  For this purpose, it's necessary to purchase the mitochondria isolation kit as well.

 

Q: With reference to Cat No: KC01100 (Mitochondrial DNA Extraction Kit), Cat No: K5082100 (DNA Methylation Detection Kit) although the kit mentions that DNA can be extracted form various tissues and cultured cells, whether we could extract mitochondrial DNA

A: First of all, you have to read carefully of the kit name, it is mitochondria isolation but not mitochondrial DNA isolation.  You can isolate mitochondria from sperm cells but not mitochondrial DNA from sperm cell.  But I think when you get the mitochondria, you can use other kit for the DNA isolation.  You can always use our DNA methylation detection kit to detect any DNA methylation.

 

Q: I use fresh hepatic tissue for mitchondria isolation to measure cytochrome C oxidase activity. If I would like to measure the mitochondria protein concentration, what steps I should take. On your User’s Manual and Instructions’ protocol, you mentioned “Re

A: If you need to measure Cytochrom C activity, then you need to resuspend the pellet in mitochondrial storage buffer.  If you need to have mitochrondrial protein lysate, then you need to resuspend the pellet in the lysis buffer with protease inhibitor.  If your experiment is just for mitochondrial protein, such as using the mitochondrial protein lysate to do Western Blot, then you can skip the storage buffer and resuspend the pellet in the lysis buffer directly.  If you want to do both, then I recommend you split the solution after step 3, then after spin down in step 4, you should get two pellets, you resupend one pellet into storage buffer, and resuspend another pellet into lysis buffer.

 

Q: Cosmo-Michikazu

1)Concerning Isolation Kit, he would like to know whether this kit can be used for myxomycetes sample.

2)If your kit can isolate mitochondria of myxomycetes sample, could these mitochondrial activity can be measured by KC310100?

A: Ke replied immediately: The KC010100  kit (Mitochondria Isolation Kit for Tissue and Cultured Cells) will work for myxomycetes sample only if the first step of homogenization changed from polytron tissue disruptor/dounce tissue grinder to glass beads vortex. The reason is fungi need much more shearing force to break the cells up.

Once the mitochondria has been isolated using modified protocol above, they can be measured using the Mitochondria Activity Assay Kit as same as mitochondria from other source.

 

 

Q: Regarding the whole cytosolic component, not the mitochondrial cytosol, how do I process the cytosolic bit which is the supernatant to get the proteins? Do I  have to spin again the supernatant? and if i do, and what speed?

A: The supernatant from the 12,000 g centrifuge can be treated as cytosol, and you don't need to spin it again.  You can measure the protein concentration from the supernatant and see how much protein there.

 

Q: According to CoA on your website, you use MMLV reverse transcriptase cDNA synthesis.

Can you let me know maker name and product # of this MMLV reverse transcriptase as the customer wants to know.

A:

 

Q: What is spieces of your monkey products

A: We have Rhesus (Macaca Mulatta) and Cynomolgus monkey.  There is suffix "cy" in the end of catalog numbers of Cynomolgus monkey products

 

Q: Regarding cat# Z5010042, we have received an enquiry regarding Lysozyme antibody [NYRHEL].  On which part of the protein this antibody recognizes, for example the N or C terminus?

A: Since the antibody was generated by injecting the whole protein, but not N-terminal or C-terminal peptitde, so we don’t have idea which part of the protein the antibody can recognize.

 

Q: Which subunit of the IL2R this antibody recognises (alpha, beta or gamma chains) or if it was the whole receptor?

A: Alpha sub unit.

 

Q: Does cat# Z5010086, Mouse Monoclonal Anti Human TGF-beta, have a blocking activity on TGFß?

A: We did not check it directly but as far as we know from other customer’s feedback it does block the activity.

 

 

Q: What is the species of your mouse products?

A: Balb/C

 

Q: Is there any difference between Clontech's Poly A+ RNA and BioChain's mRNA ?

A:

 

Q: Is there any difference between clontech poly A+ RNA and your mRNA?

A: Same

 

Q: How much total rna is needed to isolate 5 ug of mRNA?

A: 300-500 ug total RNA to get 5 ug mRNA

 

Q: How much of mRNA would be in the total RNA (50 µg)?

A: Only 50-100 ng mRNA can be obtained from 50 ug total RNA.  Sometimes, it might end up nothing.

 

Q: Do you sell purified mRNA from Human kidney tissue?

A: The mRNA is purified by affinity chromatography using oligo dT culumns. The integrity of our mRNA is checked on a denaturing agarose gel followed by Northern analysis using a human ß-actin cDNA probe. BioChain's mRNA is Poly A+ RNA.  We do sell mRNA - Human Adult Normal Tissue: Kidney

 

Q: How much mRNA are used for each spot on the mRAN Array?

A: approximately 6 ng

 

Q: Is the cat# H3235713 labelled?  If not, how does the customer go about labelling it?

A:

 

Q: What is the physical size of the blots (in cm or mm or  inches).  How many lines are on the blot?  What is the line geometry (i.e. approximate line width, length)?  I am going to use a fluorescent scanner which only takes narrow strips and would have to c

A: The physical size of the blot is 4 x 7 cm.  There  are 5 lines in this blot.  Each line is about 5 mm wide and 6 cm alone.  You can cut the blot into strip. I suggest that you cut the blot under UV light box. Then you can see the RNA in Red color and you can cut the membrane between the RNA lane.

 

Q: BioCat-Monika Haas

A: BioChain Only has brain and liver

 

Q: Is this kit suitable for assaying NADP / NADPH directly from blood or plasma or serum?

A: Yes, but not without testing the conditions

 

Q: Regarding "mix of 129svj/sv, C57BL/6 and CD1", does it mean that the cells crossbred with these three strains?  If so, please let us know the rate of the each strain.  Or it means that the cells were collected from the strains, and then, mixed.  In this c

A: The Neo MEF cells are made from embryos that were from breeding 129xC57BL6 male mice with CD1 female mice. If the customer really wants to know the ratio of each strain, it is reasonable to say that 50% is CD1 background and 50% is 129 (sv/svj) and C57BL6 mixed.

 

Q: Do you sell this?

A: To prepare Neo MEF in CD1 only background, we need to start from making transgenic mice.  It will take ~ good 6 months up to a year for this work, and the cost would be ~ $12,000 at a rough estimate.

 

Q: What's the mouse strain?

A: The Neo MEF is a mix of 129svj/sv, C57BL/6 and CD1.

 

Q: On the MSDS, the materials Cupric sulfate and Sodium hydroxide are contained in Reagent.  Which component contains each material?

A: Cupric sulfate is in the 3X Activation Buffer.  Sodium Hydroxide is in the 30X NaOH.  NaOH is also used to adjust the pH of the Glycine Buffer and Activation buffer.

 

Q: What % of NaOH is contained in Glycine Buffer and Activation buffer respectively?

A: The NaOH is quite low since it is only used to adjust the pH.  In fact, the NaOH gets converted to NaCl during this process.  The amount of NaOH used is below 1%.  We do not keep accurate records on the amount since we are more concerned with the pH.

 

Q: How many times can your northern blots be stripped?

A: The house keeping gene can still be detected after stripping the blot 10 times, but we can't guarantee customers can detect the gene of their interest after 10 times stripping. Usually the blot can be reused about 5 times if over stripping does not happen each time.

 

Q: What sizes of mRNAs on your northern blots?

A: The size mRNAs on our northern blots can reach over 10 kb

 

Q: Do you have specific hybridization buffer for your northern blots?

A: Yes, we do have FastHyb hybridization solution (Cat# L1031250) which is perfect for hybridizing our northern blot.  However, BioChain's northern blots are almost compatible with any kinds of hybridization buffer, though the background might be increased in some cases.

 

Q: What quantity control does BioChain use to ensure that it's nuclear extraction and not something else?

 

A: Biochain's use Histon antibody, a nuclear protein marker to detect nuclear fraction by western analysis.

 

 

Q: I'm interested in the mouse skeletal muscle nuclear protein extraction.  How can BioChain ensure that it is of the mouse skeletal muscle?

A: view our CNMCS kit manual, and it is easy to understand how we extract subcellular proteins and how we detemine the fractions.

 

 

Q: Did BioChain run positive and negative controls on the nuclear protein lysate to determine that it's pure nuclear lysate?  How was the nuclear protein lysate purified?

A:

 

Q: Can RNA transcription assay be performed using nuclear fraction?

A: We have not done it.

 

Q: How were the cells lysed for the Fetal Liver Nuclear Lysate?  Are the proteins native and ideal to do a gel shift assay?

A: We used our CNMCS Compartmental Protein Extraction Kit to isolate the nuclear protein.  The protein isolated by this kit is native and not denatured, except the cytoskeletal protein.  BTW, the nuclear protein has high salt, if the gel shift assay doesn't work, then we will recommend to dialysis the protein before the experiment.

 

Q: Could you please confirm whether this product always contains the following buffer?

"2% SDS, 10% glycerol, 0.1% bromophenol blue, protease inhibitor, sodium chloride, EDTA, magnesium chloride, HEPES,and  0.15M mercaptoethanol"

 

A:

 

Q: Are the primers anchored?  What are the primers contained in the kit?  What are the sequence?

A: Yes, the primers are anchored.  There are 3 sets of primers contained in the kit:  (1) Downstream and upstream primers, (2) hexamer primer, and (3) oligo primer.  Sequence is proprietary info.

 

Q: Can our optimax cDNA synthesis kit be use as direct tissue to cDNA synthesis, or direct cell to c-DNA synthesis?

A: No. It has to be started from total RNA or mRNA.

 

Q: A customer contacted us and believes that the concentration is much lower based on a Western blot for beta actin. Could you tell me how the lysates are prepared, and how the protein concentration is measured? Are the lysates boiled?

A: We used our total protein extraction kit for the extraction, the manual can be reviewed at http://www.biochain.com/biochain/ProtocolManuals/TotalProteinExtractionManual.pdf and we used Bio-Rad’s DC kit for the protein measurement. To have low expression with beta actin doesn’t mean the protein is with low concentration because from our experience actin’s expression is not even among different tissues even it is a house keeping gene, that is why we use GAPDH to test because GAPDH expression is better. We did not boil the protein.

 

Q: The customer would like to confirm whether PDX1(Pancreatic and duodenal homeobox 1) is included in P1236188Dia

A: Our only QC is GAPDH for Western, and we have no idea about the PDX1 expression in any of our lysate.  Please understand that we can’t QC any of the protein of all of our lysate.  As long as we have GAPDH, it is good product from our QC.

 

Q: Type of sample:Serum

Disease type:Pancreatic cancer

Stage:Early stage (Stage I and II)

Regarding the stages, please refer following website.

http://www.cancer.gov/cancertopics/pdq/treatment/pancreatic/Patient/page2

The product must have CA19-9 information

A: Unfortunately we currently don't have such kind of source since pancreatic tumor patients are belong to very rare source for us.

 

 

Q: Panels and Arrays

A: Can the same IHC protocol used for tissue sections be used for tissue panels and arrays?  Or does it need to be modified, (like more amount of reagent should be used for panel or array)?

 

Q: Was the heart which is used to make tissue section perfused?

A: No, it was not.

 

Q: How many spots are on each of you tissue array? What is the size of each spot?

A: There are 60 to 96 spots in our tissue arrays, generally most of tissue arrays are 66 spot format.  The spot size is 1.5 mm diameter

 

Q: Are your paraffin arrays applicable for FISH?  Is it fixed homogenously on the slide?

A: When we claim the tissue array is suitable for ISH, that means it fits FISH as well.  All the tissues are fixed homogenously

 

Q: Which of your colon tumor array is suitable for MSI test?

A: Some of our colon tumor arrays should be MSI positive. However, we don't know which one.  If the customer has the antibody, he/shee can try the IHC and he/she should be able to tell which tumor is MSI positive or negative.

 

Q: Could you please let us know the thickness of the section of each product in your current inventory?

A: ~ 5 um; it could be thinner or thicker

 

Q: how long were tissue fixed after harvest from the body, either through biopsy or autopsy?

A: At least 48 hours

 

Q: What did you use to fix the tissue?

A: Formalin

 

Q: what have the sections have been coated with? for example, do you use 3-aminopropyltriethoxysilane?

A: The sections have not been coated with any thing.

 

Q: Regarding the Paraffin Tissue Section - Human Prostate Tumor Adenocarcinoma, how many patient samples are on each slide and is there a clinical history associated with each sample?

A: Each slide comes with one section.  Each section is from on donor.  The minimum amount of information we provide our customers are the age, gender, and lot.  Other information must be requested.  Some of our tissues have more clinical history than others.

 

Q: Is the paraffin tissue section suitable for RNA in situ hybridization?

A: Yes

 

Q: We have a question regarding catalog T2235201-1, Adenocarcinoma.  1.  What’s the grade of adenocarcinoma?  2.  What area of prostate tissue is contained on the slides?

A: We don't know the grade nor the area of the prostate.

 

Q: Does it harm paraffin tissue section slides if they are stored for 2 days at -20C

A: No harm.

 

Q: Are the paraffin tissue sections fixed in normal formalin (10% NBF – neutral buffered formalin which is 4% formaldehyde) or 4% paraformaldehyde?

A: Yes, it's fixed in normal formalin.

 

Q: Do you have FFPE for connective tissue section?

A: WE don't have it.

 

Q: Regarding the brain tumors tissue slide products of T2235035-1,T2235035-2 and T2235035-3, which brain region you removed of the three products?

A:

 

Q: Will these paraffin-embedded sections stay on the slides with a Heat-induced epitope retrieval (HIER) system using steam (pressure cooker style)device?

A: Yes.

 

Q: The phaeochromocytoma adrenal tumour slides.........any idea of the mutation? eg SDHB, Fumarate hydratase?

 

A:

 

Q: Do the sections include the different regions of the heart including valve, ventricle, etc?

A: It's just heart in general and we don't know the exact location.  We don't homogenize the whole heart.

 

Q: It states that these tissue slides are suitable for use in in situ hybridization. Are they suitable for use in RNA in situ hybridization?

A:

 

Q: Was the donor treated by hormono-therapy?

A:

 

Q: One of our customers is concerned about these items may have any zoonotic infection pathogen.  Do you perform pathogen test?  How do you certify the safety of these tissue materials?

A: We don't perform any pathogen test for this tissue.  We just bought the nude mice from Harlan and kill the animal and dissect the tissues.  I think the customer can check with Harlan and see if they do any pathogen tests.

 

Q: Are the three regions of brain cerebellum, straitum and hipocammpus in one slide?

A: Hippocampus is in the left bottom part.  Cerebellum is in the right bottom part.  It is difficult to identify the straitum part.

 

Q: How did you treat the tissue to make paraffin tissue section

A: The tissue was fixed in formalin immediately after harvest, then dehydrate and embedded in paraffin

 

Q: What's your recommendation for preventing paraffin sections from falling off the slides?

A: To avoid tissue's dropping off, let the customer avoid using any solutions with detergent such as Triton X100, or Tween 20.  These detergents very easily cause tissue drop off.

 

Q: Is information on survival (overall and/or relapse-free survival) for donors on this array – or any of the other breast cancer arrays available from BioChain.

A: No.

 

Q: I have virus in mosquitoes.  Please inform me how I can peserve and prepare these viruses for pcr.  What type of solution to put the mosquito in?

A: For your intended purpose, I'd like to recommend our EasyXpress Viral Nucleic Acid Release Kit.

 

Q: Does BioChain sells forward and reverse primers separately?

A: No.

 

Q: Do you have protocol for Fluorescent detection?

A: The primer we designed is not for Fluorescent detection (real time PCR), so we don’t know if our primer set work for real time PCR or not.

 

Q: In the protocol, BioChain recommends using its own primers.  Which of your primers do your recommend the customer use?

A: We recommend for customer to use their own protocols.  What we really meant is sometimes, the customer may design their own primers according to 16s sequence, then they have their own PCR program.  So we have nothing to provide.

 

Q: It's not indicated but is there a RNase inhibitor in the lysis buffer?  Or should we add this ourselves if we think its necessary?

A: With regards to the RNase inhibitor, there is no RNase in the components and you should not require it.  All the components are RNase-free and tested before release.

 

Q: Is the lysis buffer sold separately?

A: No.

 

Q: 1. what primer you used in your kit or what is the primer sequence ?

2. what is the expected size range of the product ?

3. what is the expected Tm value?

A: 1.  Proprietary information.  Not allowed to release.  2.  The tc oligo is the substrate for telomerase to add repeat sequence onto.  That is pcr amplified by the primer oligos. The pcr primers are on the ends of that substrate oligo. It would start being a 50 bp product.  What is amplified is 50 bp- or bigger if telo added repeats on the ends.  3.  We do not have easy access to the Tm. When the assay was set up we analyzed everything by thermal dissociation and found that the primer dimmer was only a fractional component and not normally observed when the assay is run as per our standard conditions. The assay was built around these parameters.

 

Q: How many rxn can be performed with 2.5 ml PCR Mix?

A: At least 100 rxn if using 25ul/PCR reaction.

 

Q: 1.  What's the difference between Genomic DNAs and PCR ready Genomic DNAs?  I guess PCR ready Genomic DNAs are ever treated with enzyme. Is it right?  

 

A: The Genomic DNA is good for every thing, use Motar and pestle to grind the tissue, genomic DNA is with larger size.  Unlike the Genomic DNA, PCR Genomic DNA is not good for “Southern Analysis.”  They are both good for PCR.  The PCR Genomic DNA is genomic DNA that was homogenized or mechanically broken down into smaller pieces.

 

Q: Can you get an expression test data of PR (progesterone receptor), ER

(estrogen receptor), and HER2 on your breast tumor tissues?

A: Yes, but not for general breast tumor slides.

 

Q: Can you separate B cells, T cells &/or monocytes from peripheral blood leukocyte?

A:

 

Q: Regarding the phosphate assay kit, if the sample to be used contains alcohol, then is this kit suitable for use on this sample?

A: Theoretically our kit should work on samples with alcohol.  However we never did this test by ourselves.  The customer may do some test first, if it works, then go large numbers of samples.

 

Q: We don’t have the 620nm in our plate reader.  Can can use any wavelength between 600 and 660?

A: Yes any wavelength between 600-660 nm can be used.  However, the peak is at 620 nm so while another wavelength in this range can be used, the ODs will be a little lower and the sensitivity of the kit will be a bit lower.

 

Q: The customer would like to compare the difference between GMO and non-GMO.  Are your plants non-GMO or GMO?

A: Unfortunately, we are not able to provide such kind of information as we don't have it available. However, in the future, if we ever want to purchase some plant tissues, we will definitely ask for this information. 

 

 

Q: What anticoagulant is used?

A: We don't exactly know which particular anticoagulant our vendor uses.  We think it might be EDTA.  It's best to ask the customer if he or she has a preference?

 

Q: I had recently placed an order for the Poly HRP IHC kit Catalogue no. (K3184015). Since your product mentions that Anti mouse/anti-rabbit IgG is supplied I assumed that both the antibodies are supplied in the kit. I have received the kit with the anti mou

A: It is unfortunate that we have sold out the anti-rabbit IgG, and since the vendor was merged by a big company, we can not get better price from them so we just recently discontinued this product after selling you this one kit.  Though the kit we sold you still worth a lot, I can understand it is no use for you.  And we won’t charge you anything for it.

Conclusion:

1. We can provide you another modified IHC kit, but we will change the biotinlyted anti-mouse IgG to biotinlyted anti-rabbit IgG.  Our own IHC kit is cheaper than the poly HPR IHC kit, catalog K3181100-II.

 

Q: Please let me know which component (Reagent A, Reagent B: or 10% TCA) contains each of the above material.

A: Potassium dichromate (CAS #: 7778-50-9) and Sulfuric acid (CAS #: 7664-93-9) is for Reagent A, Sodium hydroxide (CAS #: 1310-73-2) is for Reagent B, Trichloroacetic acid (CAS #: 76-03-9) is for TCA.

 

Q: From BioTech

A: WE don't have it.

 

Q: We are interested in the miRNA detection kit. However there are too many kinds of miRNAs and you only provide two kits for miRNA detection(miR-16 and miR-24). I read the manual and know that Biochain also provide primer custom design service. Could you pl

A: Your customer will need to let us know the miRNA sequence of their gene of interest.  We will evaluate it after designing the primers.  The price for designing the primers is $399.00.  This will take about 3 days.  The price of $399 covers designing and providing sequence only.   We don't know whether or not the primer set will work.  No, we cannot guarantee.  If you customer ask us to confirm the design.  He/she will need to provide positive template.  We will purchase the primers and confirm the result.  The price is $1,199.00.  This will take two weeks.  Positive control should be either a cDNA fragment or a plasmid with the cDNA fragment, or a cDNA pool such as human liver cDNA.  We will provide a whole kit enough for 250 (25 ul) real time PCR, the kit should include primers and qRT-PCR reagent.   We will provide a similar detection kit manual as our current one, of course the qPCR data will be included.  But we don’t provide very much detail of the primer itself, except we will give the concentration of the primers.

 

Q: Can primer pair, cat# I4210006, be used with an old Roche light cycler (i.e. capillary based)?  Which human house keeping genes are represented (do you have primer pair for HPRT)?

A: Our primer pair was designed for regular PCR, though most of them can be used for sybrgreen based real time PCR, we did not really test them before.  No, we don’t have HPRT primer pairs.

 

Q: What is this against, what specific HSP will be amplified. Will it work for E.Coli too?

A:

 

Q: Is a positive control included cat# I1210011, Immunodeficiency Virus, HIV-I, Env Primer Pair 25test, cat# I1210002, Hepatitis B Virus (HBV), Core Antigen Primer Pair 25test, cat# I1210006, Hepatitis C (HCV), Unknown Coding Region Primer Pair 25test

A: No.

 

Q: Can protein extraction be done on paraffin embedded tissues?

A: We have not done it.

 

Q: I would like to know which detergent is used for protein extraction? SDS? Triton? Percentage.  I would be interested by several total protein extract, but the extraction of my protein of interest necessite strong extraction conditions.

 

A: The detergent we used is NP-40.  However the percentage is proprietary.  If you want to isolate the protein lysate the same as our protein lysate, you can get the total protein isolation kit from us.

 

Q: Is it diluted prior to being added to the lysate?

A: No dilution step in necessary.

 

Q: Does the extraction buffer contain phosphatase inhibitors?  Also, are the lysate appropriate for use with antibodies specific to phosphorylated isoforms?

A: Yes, the buffer does contain phosphatase inhibitors and therefore those antibodies might not work.

 

Q: Customer raised a complaint about the no HSP90 wb band using pancreatic lysates.

A: Our only QC is GAPDH for Western, and we have no idea about the HSP90 expression in any of our lysate.  Please understand that we can’t QC any of the protein of all of our lysate.  As long as we have GAPDH, it is good product from our QC.

 

Q: I need to purify my annealed product (DNA).  I'd like to know about gel extraction from acrylamide gel products.  Could you submit some information(if you have this product) to me?

A: We don't have such extraction product.  I think Bio-Rad, Qiagen, Invitrogen might have such kind of kit.

 

Q: Have you tested CHO cells on your MTT based Cell Viability Assay Kit (Dehydrogenase Maesurement, Colorimetric), Cat#: Z5030006. If not, do you think this kit will work with those cells?

A: We have tested this kit in HEK293 cells but not CHO cells.  However, we believe CHO cells should work too.  Let me know if you have other questions.

 

Q: (1) Could QBlue be used in fluorescence and optical density.  (2) Is there the same formula in QBlue for users to calculate the percent reduction of alamarBlue using OD value?

A: Alamar Blue is the trade name for the dye we use in the CQBL kit.  You can use our kit the same as Serotec.

 

Q: Is the QBlue Cell Viability Assay Kit suitable for the use with bacteria?

A: The QBlue Cell Viability Assay Kit are in principle suitable for the use with bacteria. However, we have not tested them with bacteria and your customer would need to do some pilot experiments to establish the conditions. In general I would recommend starting with about 1 x 10E09 cells per mL medium, add 10 uL assay reagent to 90 uL bacteria suspension and do a time course for about an hour, measuring the fluorescence every 15 minutes. Hope this helps.

 

Q: Let me know the currenct QC tests for membrane protein.

 

A: We use ATPase to QC our membrane protein now. We did not do EGFR anymore.

 

Q: What's the method of current test for the followings:

(1) Total Protein, (2) Nuclear Protein, (3) Cytoplasmic Protein, (4) Membrane protein

2. For total protein items, if our customer wants you to do QC test as EGFR marker(175 kda), is that possible for t

A: 1.  Total Protein: GAPDH, Nuclear Protein: Histone, Cytoplasmic Protein: GAPDH, Membrane protein: Na+K+ATPase

2.  We currently did do EGFR QC becuase Na+K+ATPase is better QC.

 

Q: QC test for the followings:  (1) Total Protein, (2) Nuclear Protein, (3) Cytoplasmic Protein, (4) Membrane protein

A:

 

Q: For the Cell Lysis protocol in the EVA qRT-PCR Kit, is there an easier way to extract cells from the wells without having to count them?  (assuming the fact that I know how many cells I plated per well?)  If the cell extraction step could be done in the 4

A: Use a house-keeping gene such as B-actin or GAPDH as reference for each well and then normalize the data with the mRNA levels of the house-keeping gene, in addition to accurately, uniformly plating cells into each well.

 

Q: Have you tested CHO cells on your MTT based Cell Viability Assay Kit (Dehydrogenase Maesurement, Colorimetric), Cat#: Z5030006?  If not, do you think this kit will work with those cells?

A: We have tested this kit in HEK293 cells but not CHO cells.  However, we believe CHO cells should work too.  Let me know if you have other questions.

 

Q: Is the QMTT Cell Viability Assay Kit suitable to use on bacterial cells?

A: Yes.

 

Q: Can this kit be used on yeast cell?

A: Yes and with any other cells.

 

Q: What is the mechanism for hot start inhibition of your product?

A: It's chemical modification inhibited, not antibody or nucleic acid based inhibition.

 

Q: Does qPCR SuperMix work on a fast block?

A: Yes, if given enough activation time (95 C, 10 min), our SuperMix works on both fast and standard blocks.

 

Q: Is this kit compatible with Roche LightCycler1.5 or 480?

A: Yes.

 

Q: What the difference is for product line L505xxxx and K505xxxx?

A: The PCR mix is used for general PCR purposes where the customer will run the product out on an agarose gel, ie. screening, sample verification, etc.  The K505XXXX set of products are for real-time PCR.  These kits allow the PCR's progress to be monitored as the reaction is happening and also allows to determine quantitatively how much starting material the samples had, along with a host of other purposes.  The PCR Mix (L505XXX) also uses regular taq, while our K505 line uses hot start taq.

 

Q: Why there is no amplification result at all for the Eva Green qPCR product?

A: Our chemically modified Taq polymerase requires 10 min activation time at 95 C prior to the cycles.

 

Q: Are they compatible with PikoReal Time PCR System from Thermo?

A: Yes.

 

Q: Would your R&D scientist see any problem with purifying the RNA by ethanol precipitation directly following RNA fragmentation.  I realize that you have said it is not necessary but for my purposes I would like to do it and I just want to make sure it will

A: You should have 50-100 ng purified mRNA to start

Fragment mRNA buy mixing 2 ul 10X T4 PNK buffer with 16 ul mRNA (total 18 ul) heat at 94C for 5 min, then place the tube on ice.  Then immediately add 2 ul 100 mM EDTA to the reaction mix tube

PNK Treatment: Add 2 ul PNK, 2ul ATP (10 mM), 1 ul RNase Inhibitor to the above tube (should be a thin-wall 200 ul PCR tube) 37C for 60 minutes, then hold at 4C in PCR machine.

Purify PNK treated mRNA:It could be different method, but we have not finalized which one do we need.

But in your case, since you are family with your current procedure of PNK treatment and know how to get PNK treated mRNA purified, so you can just start with your purified PNK treated mRNA with our RapidSeq kit.  Then when you finish the library construction, you can omit the gel purification step, and use you beads method to purify the library and go for sequencing. 

 

 

Q: How to make longer reads and how to tweek protocol so fragment is not so small?

Running more PCR cycles - If increase cycle, will it increase the library amount with increasing bias significatly?

A: Make fragmentation time short will definitely help to increase large size there, for example you can shorter the time from 60 min to 45 min. 30 min.  Another suggestion is you can even skip the fragmentation step and do the ligation directly if your RNA quality is not very good (such as from FFPE or degraded RNA).

Our expert did have some experience on the increasing the PCR cycles on the library, and actually increase 1-3 more cycles did not increase the bias significantly in RNA sequencing while this bias can be very large in DNA sequencing.  So I think it is probably worth for you to increase couple of cycles for your purpose.

 

Q: We are making the libraries today but had a question on the gel purification.  Can you tell us how to pool the libraries prior to loading on the gel?  What volumes should we pool together and how much do we load on the gel and how much gel loading buffer

A: This is Danny.  I am your technical support for microRNA.  If your are making 2 samples with different aligners, then you will need to pool 25ul of each reaction for a total of 50ul. If you are making 4 samples with 4 different aligners, then you will need to pool 12.5ul of each sample for a total of 50ul. The goal is maintain a final volume of 50ul because you will need to add 10ul of loading buffer.  Finally, you will load 25ul of the pooled sample with loading buffer to one well and another 25ul to a different well.  You will have 10ul left over, but that is okay because you should have plenty to sequence.

 

Q: Assuming the libraries work we will probably sequence them next week.  For the data analysis we need to trim the adapter sequences.  Thus we will need to know the sequence of the primers we used.  Also, we usually quantify our libraries using the KAPA QPC

A: Here are the sequences you need:

3' adapter sequence: ATGGAATTCTCGGGTGCCAAGGT Aligner sequence: CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA

5' adapter sequence: GUUCAGAGUUCUACAGUCCGACGAUC Universal Primer: AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA

Regards,

Dan

 

 

Q: One of our customers is concerned about these items may have any zoonotic infection pathogen.  Do you perform pathogen test?  How do you certify the safety of these tissue materials?

A: We don't perform any pathogen test for this tissue.  We just bought the nude mice from Harlan and kill the animal and dissect the tissues.  I think the customer can check with Harlan and see if they do any pathogen tests.

 

Q: Were the mouse and rats on a standard diet.

A: Yes.

 

Q: What is the spieces of your rat products?

A: Sprague Dawley, Wistar

 

Q: What's the strain?

A: Sprague Dawley, Wistar

 

Q: What's the strain?

A:

 

Q: What real-time PCR instruments are BioChain's real-time qPCR kits suitable to use on?

A: We don't have any formal instruments list for our QPCR kit. However, to my best knowledge, our QPCR kit will can be used in any QPCR instruments. Our Pro QPCR may replace TaqMan reagents while our Eva QPCR may replace SybroGreen QPCR reagents.

 

Q: What is the price per 1000KU.

A: Our LDH recombinant protein is sold at 3 mg per package level.  From the Spec sheet, you can tell 1mg is equal to 200uints.  So if you want to buy 1000KU, then you need to buy 5,000 mg which is equal to 1667 package of our standard size.

 

Q: Recombinant Human Fatty Acid Binding Protein (Z5010336).  1. Please give me amino-acid sequence of this product.  2. Please let me know if it contains some subtypes of FABP(like mix of FABP1 and FABP2...) or only single subtype.

A:

 

Q: I wonder about the binding capacity of rabbit-IgG to rProtein A-Sepharose. I could only find information about human and mouse IgG.

 

A: We have only tested the binding capacity of both human and mouse IgG, so we don’t have direct data for the rabbit IgG capacity.  We have many customers using it for rabbit polyclonal antibody purification.  So it should definitely work well, but we just never know the capacity.

 

 

Q: You indicate bacterial expression systems.  Does this involve any other bacterial species than E. coli?

A: Yes, all the bacterial species are E. coli.

 

Q: This is expressed by Sf9 insect cells.  Is Baculovirus System used with insect cells expression?

A: Yes.

 

Q: This is expressed by Sf9 insect cells.  Is Baculovirus System used with insect cells expression?

A: Yes.

 

Q: This is expressed by Sf9 insect cells.  Is Baculovirus System used with insect cells expression?

A: Yes.

 

Q: From which country are your Rhesus monkey sold from?

A: China

 

Q: How does one use RNA biomarker?

A: They are just some special primer pairs for detecttion of specific gene.  The primer pair manual can be reviewed from our website.

 

Q: Is the reagent in Z5100022 cationic lipid?

A: Yes.

 

Q: Is this reagent cationic lipid?

A: Yes, the reagent is cationic lipid.

 

Q: From BST

A: WE don't have it.

 

Q: Is the serum DNA isolation kit suitable for use in semen?

A: Yes, the serum DNA isolation kit is suitable for use in semen.

 

Q: Mirror blocks is common usage in the tissue business. Its where a tissue is remove, split in two, and one part is say flash frozen and another is put into FFPE at the same instant.  Was there mirror blocks put into FFPE when this material was taken?

A:

 

Q: How is the Small Size Genomic DNA produced and what size has it (how is the larger sized genomic DNA removed or is it sheared to become smaller or….). What is the QC? Would you please send more detailed information?

 

A: The difference between Small Size Genomic DNAs and Genomic DNAs: Method of isolation: Homogenization is used for Small Size Genomic DNAs, the harsh homogenization breaks the DNAs into smaller pieces mechanically, the DNA might not be good for southern analysis, but it is still good for using as PCR template, especially for performing digital PCR successfully because it will be better even and randomly distributed.  The genomic DNA is good for every thing, use Motar and pestle to grind the tissue, genomic DNA is with larger size.

 

Q: What is the fragment size of small size genomic DNA? How do you guarantee that the fragment size and amount are the same in different lots so that similar amounts are PCR amplified every time? What exactly is the QC performed for small size genomic DNA?

A:

 

Q: Which of BioChain's products are sperm related?

A: Sperm can be considered as tissue or cells (like blood leukocyte or cell culture), so I think any of our extraction kits can be used for sperm.  We have cDNA Library: Mouse Normal Tissue: Oocyte.  Certain custom services using sperm.

 

Q: I have a customer who would like to have further information about your normal human tissue arrays and skin tumor/normal arrays.   How do you QC your tissue to prove that it will be immunoreactive? What process do you use for patient consent and IRB appro

A: Tissues are collected from different tissue vendors but not from Biochain directly.  All tissue vendors claimed they collect tissues under IRB or something similar to IRB regulation: i) Donors’ consent form must be signed by either the patient or donors’ relatives; ii) Serological test of HIV, HBV, HCV, negative; iii) postmortem 4-12 hours; iv) snap frozen in liquid nitrogen for frozen tissues (less than 10 minutes after the tissue was cut from the body); v) immediately put in formalin after the tissue is cut from the body for paraffin embedded tissues.

 

Q: How do you lyse the tissue after you crushed tissue by hammer-so what is solution1?

 

A: Solution 1 is a guanidine based solution, very similar to Trizol, it almost can lyse any kind of tissue.

 

Q:

A:

 

Q: Do cerebellum tissue sections contain the following structures: external granular layer, internal granular layer, molecular layer, purkinje layer and deep cerebellar nuclei?

A: Yes.

 

Q: With regards to the tissue section products, are these all pathologically diagnosed?

A: Yes, all tissue section products including frozen and paraffin sections, arrays, and panels are all pathologically diagnosed.  Once the tissue becomes sections, our pathologist automatically diagnoses and confirms the clinical report.

 

Q: How and for how long was tissue processed in the various steps from time of resection up until and including the assembly of samples in one frozen TMA?

A: We can only provide the following information:  Collected tissues are from postmortem 6-12 hours.  Immediately liquid nitrogen snap frozen, then store in -80C freezer.  When we receive the order, we will do the assembly.

 

Q: With regards to tissue section products, was an informed consent form given by the donor with regards to the collection of the material?

A: Yes.

 

Q: How and for how long was tissue processed in the various steps from time of resection up until and including the assembly of samples in one frozen TMA?

A: We can only provide the following information:  Collected tissues are from postmortem 6-12 hours.  Immediately liquid nitrogen snap frozen, then store in -80C freezer.  When we receive the order, we will do the assembly.

 

Q: With regards to tissue section products, was an informed consent form given by the donor with regards to the collection of the material?

A: Yes.

 

Q: Does the informed consent form given by the donor cover the use of the biological material of human origin for biomedical research in Europe?

A: Yes.

 

Q: Has the collection of the biological material of human origin been approved by an independent local or National ethical committee?

A: Yes.

 

Q: Are all the information that were linked to the biological material of human origin and that can be traced back to the individual donor irrevocable deleted?

A: Yes.

 

Q: What's the procedure and timing that will be involved in creating the block?

A: We can't release our "know how" information.

 

Q: Are the tissues excised 6-12 hours after post-mortem?

A: Yes.

 

Q: You don't mention OCT embedding (mnetnioned in CoA) - should that be added after snap-freezing?

A:

 

Q: Is the TM Buffer stable at room temp?  If I shipped it with ice packs and the ice packs thawed for about 1 day, will it still be good?

A: Yes.

 

Q: What are your protein panels like?

A: A protein panel is a series of tubes each containing 0.1 mg of BioChain's high quality total proteins.  Each panel contains 5 tubes of total protein from 5 different tissues.

 

Q: What are the components of the total protein lysate buffer? And what is the concentration?

A: The protein lysate buffer includes Hepes, MgCl2, KCl, EDTA, Glycerol, sodium deoxycholate, sucrose, NP-40, and cocktail of protease inhibitors.  However the concentrations of the components are properitary.

 

Q: How did you measure your protein concentration?

A: We Use Bio-Rad DC protein determination kit to measure the concentration of our protein.

 

Q: What method did you use for total protein and compartmental proteins isolation?

A: We used Total protein extraction kit (Cat# K3011010) for total protein isolation, and CNM (K3012010) or CNMCS kit (K3013010) for compartmental protein isolation.  Compartmental protein isolation is a patent technology.

 

Q: Can I have one kind of protein from different donors?

A: Yes, we can custom make one kind of protein from multiple donors

 

Q: I need to use trypsin to treat the protein before doing my experiment, since you have protease inhibitor cocktail, I wonder if those inhibitors will inhibit the activity of trypsin?

A: Yes, you need to get rid of the protease inhibitors before doing your experiment in such case.

 

Q: What are your protein panels like?

A: A protein panel is a series of tubes each containing 0.1 mg of BioChain's high quality total proteins.  Each panel contains 5 tubes of total protein from 5 different tissues.

 

Q: What are the components of the total protein lysate buffer? And what is the concentration?

A: The protein lysate buffer includes Hepes, MgCl2, KCl, EDTA, Glycerol, sodium deoxycholate, sucrose, NP-40, and cocktail of protease inhibitors.  However the concentrations of the components are properitary.

 

Q: How did you measure your protein concentration?

A: We Use Bio-Rad DC protein determination kit to measure the concentration of our protein.

 

Q: What method did you use for total protein and compartmental proteins isolation?

A: We used Total protein extraction kit (Cat# K3011010) for total protein isolation, and CNM (K3012010) or CNMCS kit (K3013010) for compartmental protein isolation.  Compartmental protein isolation is a patent technology.

 

Q: Can I have one kind of protein from different donors?

A: Yes, we can custom make one kind of protein from multiple donors

 

Q: I need to use trypsin to treat the protein before doing my experiment, since you have protease inhibitor cocktail, I wonder if those inhibitors will inhibit the activity of trypsin?

A: Yes, you need to get rid of the protease inhibitors before doing your experiment in such case.

 

Q: Is your total protein ready-to-use?  Can I load the protein directly on SDS-PAGE gel?

A: No.  The protein need to be mixed with protein loading dye and heat at 95ºC for 5 minutes, then transferred on ice before loading on the gel.

 

Q: I'm using your products, P1234171, P4234171, and P3234171. i have couple questions concerning your products:

1. were they freshly obtained? i mean was the tissue from a dead body? if so, how long from dead to get the tissue?

2. can you extract protein u

A: 1. Yes, the tissue is from post mortem body, and the post mortem is about 4-8 hours

2. Yes, we can.  But this belong to custom made product, when you let us know how much protein lysate you need, we can generate a quotation for you

 

Q: How does BioChain detect nuclear fraction?

A: Biochain's use Histon antibody, a nuclear protein marker to detect nuclear fraction by western analysis.

 

Q: Does the customer still need to dilute the protein lysate with sample buffer and boil before SDS-PAGE?

A:

 

Q: Can BioChain provide protein lysate that doesn't storage buffer containing Mercaptoethanol?

A:

 

Q: Do you have a Total Protein kit for use in Cartilage?

A: BioChain's Total Protein Extraction Kit can be used to extract total proteins from any tissue and cells, including cartilage.

 

Q: Are the total protein lysates tested screened for HIV and hepatitis?

A:

 

Q: Do all the protein lysates consist of 2% SDS, 10% glycerol, 0.1% bromophenol blue, protease inhibitor, sodium chloride, EDTA, magnesium chloride, HEPES,and  0.15M mercaptoethanol?

A:

 

Q: Has the Total Protein - Bovine been screened for  mad cow disease?

A:

 

Q: Are nucleic acids (DNA and RNA) present in the protein lysate?

A:

 

Q: How does BioChain measure the amount of protein in your protein lysate?

A: We determine the protein amount by using Bio-rad's Kc kit.  Sometimes the protein intensity on the gel is not correspondent of the protein amount very accurately, this is because of the following reasons:

1. The protein need to be resuspended very well every time before loading on the gel, because the protein may not be distributed evenly in the solution.  2. The freeze and thaw may result the protein degradation.  3. Some lysate may have large amount of small molecule proteins, and the small molecule protein may run out from the gel, that will result showing less protein on the gel.  The best way to do is normalize the protein with GAPDH antibody.

 

Q: For P1235218A (Tissue, Total Protein, Human Tumor, Melanoma), is the protein extract derived entirely from a primary melanoma, or are metastases included as well?  How much normal surrounding tissue is included in the sample for total protein extraction?

A: The melanoma is primary melanoma.  The tumor cell percentage of the tissue is about 80%.  So there should be about 20% adjacent normal tissue.

 

Q: How is the total Protein - Mouse Normal Tissue: 11-day Embryo, catalog P1334XI, extracted?  Which anti-protease was used.

A: The protein is extracted by our total protein isolation kit.  Unfortunately we don't release our protease inhibitor cocktail information.

 

Q: About total proteins, are you doing a micro-dissection before the extraction or some normal cells around the tumor could be extract with the tumor?

 

A: We don't do any micro-dissection, and it is very likely some normal cells around are included during the preparation.

 

Q: Do you have all your total proteins available as non-reduced?

A: All of total protein lysates are native and non-reduced.

 

Q: Does your total protein contain nucleoprotein?  If so or not, could you please show us data that present rate of content?

A: The total protein contains very minimum amount of nuclear protein and we don't know the portion of the nuclear protein in the total protein, but we know it is very few.  If the customer specifically interested in nuclear protein, we recommend for the customer to buy nuclear protein instead.

 

Q: Are nuclear proteins isolated from total proteins the same way microRNA can be isolated from total RNA?

A: No.

 

Q: BioChain total protein preparations are stored in a buffered protease inhibitor cocktail.  However, you also write that these preparations can be used for enzymatic activity analysis.  Can your whole tissue homogenates be used for screening protease activ

A: Our whole tissue homogenates can not be used for screening protease activity in specific human tissue samples since the lysis buffer contains the protease inhibitors which inhibit most of the protease activity.  The homogenates can be used for some other enzyme assays, but not for proteases.

 

Q: With regards to the total protein lysate isolated with the Dr. P Kit, are the ionic channels present in the protein fraction?  The customer needs 100 ug of proteins.  Do you know the quantity of cells required?

A: The protein isolated from Dr. P kit is total protein .  Theoretically ionic channel protein should be present in the fraction as well.  But all the protein isolated from Dr. P kit is denatured and inactive.  The protein is only good for western blot analysis but not good for any activity assays .

 

Q: The customer is asking for Protein from CSF. Not for raw CSF. Are you able to extract protein from this product ? Which price for 1 mg protein ?

A: CSF is a clear fluid.  It can be considered as a protein lysate because you can just measure the protein concentration directly with protein assay kit, and CSF protein amount is usually 15 mg/ml.  If you want to dilute the protein, you can use the TM buffer from our total protein extraction kit.

 

Q: Is BioChain's total protein suitable for enzymatic activity assay.

A: Yes, our total protein is suitable for enzymatic activity assay since our protein lysate was prepared in native method,

 

Q: What was the wet (or dry) weight of lung tissue that yields 1 mg total protein?

A: The yield of protein lysate from 1 g lung tissue is 55-70 mg.

 

Q: Were the epithelial cells (facing the intestinal lumen) removed prior to isolation of the proteins from the "whole" tissue homogenate?

A: No.

 

Q: Was the cell membrane removed before isolating the proteins from the "whole" tissue homegenate?

A: No.

 

Q: Would you recommend this lysate with Nupage (Invitrogen) system?

A: We ourselves haven’t used Invitrogen NuPage system to test our protein lysates. But it should be ok because the pH is largely determined by the running buffer instead of the lysate itself. To be on safer side try a pilot experiment with small amount of lysates. If using 4xLDS sample buffer, heat the samples to 70 degrees for 10 minutes before loading.

 

Q: Can the Total Protein Extraction Kit (K3011010), or any other, be used with plant cells or tissue? Is there a specific protocol for plants?

A: Yes.

 

Q: Does BioChain's Total Protein contain RNA?

A: Our protein lysates are extracted using our total protein extraction kit, which contains two components, TM buffer and protease inhibitor. So my answer would be no, it’s unlikely that our protein lysates would have RNA in it.

 

Q: May I ask what GAPDH antibody do you use? I ask because I haven't found one reactive with plant samples.

A: We used mouse anti pig GAPDH antibody which cross reacted with human GAPDH. Our data shows this antibody does not cross react with plant GAPDH.

 

Q: What apparatus was used to homogenize the protein lysate?

A: Ultra turrox T25 homogenizer

 

Q: How is this protein lysate prepared?  Which lysis buffer was used ? Was it RIPA buffer?

 

A: We don't use RIPA buffer, which I understand is sold by Pierce.  What we use is Buffer M which includes two ingredients found in RIPA buffer and they are NP-40 and Sodium deoxycholate.  Our Buffer M doesn't include Tris-HCl, sodium chloride, and SDS.  In addition to NP-40 and Sodium deoxycholate, our buffer includes HEPES (pH 7.9), KCl, EDTA, Sucrose, Glycerol, Sodium Ortho Vanadate, and MgCl2

 

Q: Is P1236201Lcs from a normal prostate?

A: The prostate is from a donor diagnosed with Liver Cirrhosis.  As you know, liver cirrhosis is a whole body disease which effects organs and tissues throughout the body.  Since we can't be sure that the prostate has not been effected, we can't sell as normal.

 

Q: How would you go about if you need to dilute the sample P1434035?

A: Use the same dilute buffer as the customer's buffer for the next experiment.

 

Q: Add more of the same loading buffer or a slightly different loading buffer?

A: the same loading buffer

 

Q: Does it show any lines if incubating with an antibody against rat Neurofascin? And if it does so, where (kD) does it show these lines?

A:

 

Q: What's the concentration of the Total Protein - Rat Normal Tissue: Skeletal Muscle?

A:

 

Q: What is your total protein array like? Does each spot on the array contain each single protein?

A: The total protein arrays are modified nitrocellulose membranes spotted with proteins from different tissues.  Each spot on the array contains a protein pool from an organ, but not a single protein.

 

Q: How much protein is loaded in each spot?

A: 30 nanogram of protein is loaded in each spot.

 

Q: How much protein is used for each spot on the total protein array?

A: Approximately 30 ng.

 

Q: Why is it the GADPH protein in the western blot (Supplied by the manufacturer) is disimilar across the array? GADPH being the internal control, should be expressed as similar as possible across the samples, in order for comparisons to be done. If the GADP

A: Unlike with cell lines, even house keeping genes, such as GAPDH, beta actin, the expression varies in different tissues.  That is why there are some house keeping gene normalized array or blot (the protein loading amount will be different).  We only assure load equal amount of the protein lysate and it is very normal to show various amount of GAPDH in different tissues.

 

Q: Is your total protein extraction kit suitable for extracting from fungi?

 

A: Yes, the kit can be used for extracting proteins from fungi.  The procedure is the same as for extracting tissue proteins.

 

Q: Is the total protein extraction kit suitable for use on bacteria?

A: Yes.

 

Q: With reference to Cat No: K3011010 (Total Protein Extraction Kit), we would like to know the total no of isolations that is the pack size of the kit. Your datasheet mentions that the kit can be used for isolation of total proteins from 5 gram of tissue or

A: The kit size is very obvious based on the tissue amount, actually it is more accurate, but not based on isolation numbers.  If you have 100 samples, each sample has 0.05g, then you can have 100 isolations.  If you have 5 samples, each sample has 1 g, then you can only do 5 isolations.

 

Q: Is it possible to do a protein quantification with a Lowry method after a protein purification with cat# K3011010?

A: Yes.

 

Q: AMS - William

A: WE don't have it.

 

Q: We have a question regarding one of your products: reference P1234042 Inc. Loading Buffer.  Could you please confirm how these lysates should be treated prior to loading. Do they already contain SDS and have they already been boiled?

A: The protein lysate with loading dye already contain SDS, but this mixture was not ever boiled.  So you should boil the lysate for 5 minutes, and put on ice before loading.

 

Q: Regarding P1434122, can you tell me what is the molecular weight of this product? Also, do you have a western blot image?

A: We are not able to determine the molecular weight of the protein lysate since it's made up of cytoplasmic, membrane, nuclear, and cytoskeleton proteins. 

We have a datasheet for the Total Protein Western Blots Rat Normal Tissue, Blot I.  One of the proteins is the heart.  It has a western blot image.

 

Q: I am interested in your Total Protein Western Blots, although I would like to know how many times one can strip and reprobe any of these blots?

A: It really depends on the protein abundance, for a house keeping gene, such as GAPDH, the blot can be stripped and reprobe for at least 2-3 times

 

Q: Is the phosphorylation state of proteins conserved?

A: Yes, the phosphorylation state of proteins is conserved because we add phosphortase inhibitors.

 

 

Q: Regarding cat# P1234201, was the tissue procured through radical prostatectomy, post-mortem, US-guided biopsy, or transurethral prostate resection?  If the tissue was acquired by first 3 methods it is likely to belong to peripheral zone, however if it is

A: Acquired from Post-mortem donor and "therefore likely to belong to peripheral zone" as indicated by the customer.

 

Q: I bought Total Protein - Human Tumor Cell Line: Hela(Cat.#P1255811 Lot.# A409191). I need protein concentration, but It's not described on tube and datasheet.

A: The protein concentration should be describe in the data sheet at 5 mg/ml

 

Q: I used your total RNA to do RT-PCR, but I did not get the PCR product?

A: It is possible that the gene of your interest is a very low abundant gene, increase Total RNA amount in your RT reaction or using our mRNA instead may help.

 

Q: What is the concentration of your Total RNA samples?

A: The Concentration of Total RNAs vary in a range at 1-3 ug/ul.

 

Q: What method did you use for total RNA isolation?

A: The method is proprietary modified phenol extraction.

 

Q: Is your RNA treated by DNase I?

A: Yes, most of RNAs, especially from the major organs are DNase I treated. However, we don't treat RNAs from rare tissues and some of tumor tissues.

 

Q: Can I have the same total RNA from different individuals?

A: Yes.  Usually we should be able to provide total RNAs from major organs from at least 10 different donors.

 

Q: I used your total RNA to do RT-PCR, but I did not get the PCR product?

A: It is possible that the gene of your interest is a very low abundant gene, increase Total RNA amount in your RT reaction or using our mRNA instead may help.

 

Q: What is the concentration of your Total RNA samples?

A: The Concentration of Total RNAs vary in a range at 1-3 ug/ul.

 

Q: What method did you use for total RNA isolation?

A: The method is proprietary modified phenol extraction.

 

Q: Is your RNA treated by DNase I?

A: Yes, most of RNAs, especially from the major organs are DNase I treated. However, we don't treat RNAs from rare tissues and some of tumor tissues.

 

Q: Can I have the same total RNA from different individuals?

A: Yes.  Usually we should be able to provide total RNAs from major organs from at least 10 different donors.

 

Q: I got your total RNA, and I measured the DEPC water diluted total RNA concentration again by myself, but the concentration I got is lower than yours, can you tell me why?

A: I would suggest you use our method to measure the concentration:

Dilute the RNA in 10 mM Tris-Cl, pH 7.5 but not DEPC water. We usually took 2 ul RNA into 498 ul 10 mM Tris-Cl, (pH 7.5), then measure the OD, use the OD value x 40ug/ml, and then x250 for the final concentration. Using DEPC water will always result lower UV260/280 ratio and lower concentration, and the concentration measured by DEPC water is not stable.

 

Q: We recently ordered/received liver total RNA from your company.  We ran the sample on the Agilent Bioanalyzer and the quality didn't look as good as we expected.  Do you have any electropherogram profiles of liver total RNA sample you've run in-house?  If

A: Tell us the lot number

 

Q: We are interested in RNA samples of hemapoetic neoplasm origin.  Mainly Multiple RNA, myeloma, Chronic Lymphocytic Leukemia, acute myelocytic leukaemia and non-Hodgkin's lymphoma.  Inform me the number of different donors.  Inform me the type of sample (P

A: The customer is requesting Myeloma tissue RNA, and unfortunately we are not able to provide it.  But you can ask if they will be interested in Leukymia blood or bone marrow RNAs.

 

Q: Does BioChain treat all of its RNA by DNAse 1?

A: Total RNA from some rare tissues and tumor tissues may not be treated by DNase I.  The tumor pancreas is one these rare tissues.  However, if the customer request that we treat it by Dnase, we can but there's the risk that the quality will be further compromised.

 

Q: Is BioChain's Total RNA suitable for microRNA research?

A: Yes.

 

Q: Is BioChain's total rna ready to use for RT-PCR without the need to first purify?

A: Yes.

 

Q: The product is in freeze condition.  The customer is asking how he will use the product because in Data sheet given that product is in liquid form.

A: Just thaw the RNA on ice and handle it as liquid.  It is better aliquot the RNA when it is thawed the first time, because freeze and thaw frequently may cause the RNA degraded.

 

Q: Our customer has additional question on extraction method of the Total RNA.  What extraction kit do you use?  Is that extraction method use a column purification method?

 

A: We either use Dr. P Kit or Total RNA isolation kit but more often Dr. P Kit since we also isolate protein lysate and gDNA simultaneously from same sample.  Not column but precipitation.

 

Q: Of course if total RNA is available it would be best otherwise if the cDNA is first strand, it should not be bias. But I need to know about the method of cDNA synthesis as a T7 promoter will be required for in-vitro transcription. In such a case, cRNA can

A: We recommend buying the total RNA instead of cDNA.

The cDNA is synthesized by using our cDNA synthesis kit with oligo dT primer, there should not be any bias.  However, since there is no T7 promoter on the oligo dT primer, you will not be able to use the cDNA for cRNA synthesis.

The real quantity of our cDNA cannot be measured.  We can only give estimate that the cDNA concentration is about 2.5 ng/ul.

 

Q: How are the total rna isolated?

A: Total RNA is isolated by modified guanidine thiocyanate techniques and stored in RNA storage buffer.  The integrity of the RNA is examined by visual inspection for the presence of intact bands of 18s and 28s ribosomal RNA when electrophoreses on a denaturing agarose gel. The quality and purity of total RNA were tested by spectrophotometer. A260/280 is between 1.8 and 2.0 (detected in 10 mM Tris-HCl, pH 7.5).  The RNA is treated by DNAse I, and is tested as DNA free RNA by PCR.  However, Total RNA from some rare tissues and tumor tissues may not be treated by DNAse I

 

Q: Can your total rna extraction kit be used to extract RNA from leukocyte and bone marrow?   What about your Dr. P Kit?

A: Yes for both.

 

Q: Is the preparation done by taking the whole ventricle or atrium (whereby representing all cells) or is the preparation done from a piece of the ventricle or atrium?

A: We use a piece of tissue not the whole tissue.

 

Q: Does the product contain RNA from the whole plant (or a selection of tissues)?  Is it the root?

A: Leaves and stems

 

Q: Total RNA Array - Human Tumor Tissue, Array II (96 Spots)

Code: H1235707.  I was informed that the total RNA Array, H1235707, will be discontinued.  How about the H1235706?  You also said Northern Blots will be discontinued.  Will blots and arrays on memb

A: According to our production, we will discontinue Total RNA Northern Blots, mRNA Northern Blots, Total RNA Arrays, and mRNA Arrays.  We will sell what we have available but will not make new stocks.  No, we don't plan to discontinue total rna single items any time soon.

 

 

Q: If isolating from plant using total rna extraction kit, how much starting tissues does the customer need and what would be the yield?

A: If extracting from 1 gram of plant tissue, it's estimated that about 600ug of total rna can be extracted.

 

Q: Can the total rna extraction kit be used on plant?

A: Yes, total rna extraction kit can be used on plant.

 

Q: How much minimum amount of tissue and cell can be used to isolate genomic DNA using our extraction kits.

A: Using genomic dna isolation kit to extract gdna leukocyte from 50ml will yield maximum of 6 mg gdna, which is = to 100ug per 1 ml

Using genomic dna isolation kit to extract gnda bone marrow from 1 ml will yield between 10 ug - 50 ug.  Variation may result depending if red or yellow bone marrow.

Using Dr. P Kit will result in about the same yield as above.

 

Q: How much minimum amount of tissue and cell can be used to isolate genomic DNA using our extraction kits.

A: Using genomic dna isolation kit to extract gdna leukocyte from 50ml will yield maximum of 6 mg gdna, which is = to 100ug per 1 ml

Using genomic dna isolation kit to extract gnda bone marrow from 1 ml will yield between 10 ug - 50 ug.  Variation may result depending if red or yellow bone marrow.

Using Dr. P Kit will result in about the same yield as above.

 

Q: The customer needs to know what type of kit are used for the extraction. He needs to look at the small RNA (<20nt). Do you know if the small RNA are isolated.

A: We used our Dr. P Kit to isolate the total RNA.  We then used our microRNA detection kit.  We still saw the presence of small RNA (<20 nt).

 

Q: How to weigh 0.1 gram cell pellet?

A: The cell pellet is usually obtained by centrifuge down the cells from the cultured cells.  So if you weigh the empty centrifuge tube first, then use the centrifuge tube centrifuge down the cultured cells, discard the supernatant, and weigh the tube again, then the weigh difference should be the pellet weight.  This is the most accurate way.  The cell numbers can give you estimate of weight, but different cells may give big variation on weight.  You can use 25 million cells as 1 gram for a reference.

 

Q: What's the species?  Is it white or grey mouse?

A: Balb/C.  White mouse.

 

Q: Which part of tissue do you isolate RNA from plants?

A: Leaves

 

Q: Does BioChain extract total rna plant arabidopsis from specific region or whole Arabidopsis?

A: Total rna extracted from whole arabidopsis.

 

Q: Is it then possible to get the info whether a specific lot of a particular RNA is DNaseI-treated or not in advance?  I have heard that some time ago BioChain used to send lot-specific COAs with the DNase-treatment (or not) information, what is the reason

A: We can send COA that states whether or not the RNA is DNASE I treated.  However, this is at the request of the customer.  If it's not requested, we only send the general COA.

 

Q: Does your Universal RNA contain small RNA fractions (micro RNAs) or is it column based purified and therefore lacks these fractions?

A: Our Universal RNA was not manufactured through column based purification method, so the small RNA fractions are retained.

 

Q: The standards that we used were the same between runs. We do not use the standards to calculate concentrations, we still rely on the standard that comes with the kit.  Because of the variation between our samples, we like having “our” standards as a furth

A:

 

Q: Would it be possible to assay with high concetrated metal salt (concentration like 1mol/Liter) or ammonia contained solution?

 

A: We have not tested the compatibility of our urea assay with high concentrations of metal salts. Ammonia, at least at physiological concentrations, does not interfere with the assay.

 

Q: I saw in the web page, telling 96 samples, but in the protocol I saw 1000 samples for the proprietary VNAR protease.  How many samples can I work with this kit?

 

A: The kit is indeed enough for 1000 samples, you can tell the kit contains 10 vial (1 ml each), each sample need 10 ul, so each vial is enough for 100 samples.  When it mentioned the 96 samples, it means you can do up to 96 samples within an hour.

 

Q: What's the shelf life?

A: The COA doesn't indicate a shelf life, however, it does state for long term storage, RNA oligonucleotides may be stored at or below -70°C.

 

Q: Are the proteins of each lane on the blot from a single donor or pooled donors?

A: Generally, protein of each lane on the blot is from a single donor.  However, the protein from rare tissues might be pooled.

 

Q: How much protein did you load on each lane

A: 50 ug.

 

Q: Could you tell me what concentration (ug/ul) of protein is loaded per lane on your human pre-made Western Blots?

A: 5 ml/ml; however, there's variation each time with new measurement and we consider a 10% variation is within a normal range.

 

Q: How much protein is loaded on the gels?  How is protein concentration determined?  What protein is used to normalize protein loading?  What type of gel is used?  How are proteins transferred?

A: Western Blot contains 50 µg tissue lysate per lane. The protein concentration is determined by commercial available and standard method. One of quality control parameters is western analysis with GAPDH antibody.  The tissue lysates were run on 4-20% denaturing polyacrylamide gels and electrophoresed. After electrophoresis, the gel is transferred on to a PVDF membrane. This blot is ready to be probed with polyclonal, monoclonal, or peptide antibodies. Protein marker is indicated at the left margin of the blot. The left upper corner of the membrane has been cut to provide orientation.

 

Q: I am interested in your Total Protein Western Blots, although I would like to know how many times one can strip and reprobe any of these blots?

A: It really depends on the protein abundance, for a house keeping gene, such as GAPDH, the blot can be stripped and reprobe for at least 2-3 times

 

Q: Is the phosphorylation state of proteins conserved?

A: Yes, the phosphorylation state of proteins is conserved because we add phosphortase inhibitors.

 

 

Q: A customer received cat# W1234410, lot# B105113. The left upper corner of the membrane had not been cut. Is it possible to use the colored marker? What are the length of the 2 colored bands?

A: Yes, you can use the colored marker directly.  From top to bottom 250, 130, 95, 72, 55, 36, 28, 17, and 11 kd.  The red colored ones are 72 and 28 kd

 

Q: Marion Ludwig-marion.ludwig@med.uni-rostock.de

A: Dear Marion,

Sorry for the late response! 

Unfortunately we did not do other selection for this cells.

Sincerely,

Dong

 

 

Q: How can customers from International send the tumor tissue to BioChain and what conditions?

A: Fresh Tumor tissue (with >50% tumor cells), Keep in cold HBSS,

Non-infectious: HBV, HIV, EBV, TB etc should be negative,

FedEx to the lab within 24 hours.

 

 

Q: Can Biochain test 5 chemical compounts as part of its Xenocraft Service?

A: Yes, we can.  We currently already established 105 tumor lines including lung, prostate, ovary, lymphoma, and pancreas tumor lines. So if the customer tell us which particular tumor they want to test, we can show the customer the tumor information we have from the patient, then customer can pick whichever case they want.  When the customer picks the tumor, we will recover the cell line into mice, with 6 mice for 1.5-2 months, then expand to at least 30 mice and separate into 5 groups (6 mice in one group): negative control, positive control, candidate drug high dose, candidate drug middle dose, and candidate drug low dose.  (This is usually the basic drug candidate efficacy test, customer may ask more groups or more mice in one group, more dose, etc.  This efficacy test will be 3-4 month, with report, it will take about 6 month.  This is for one compound, of course we can do many compound test at the same time, but we charge base on each compound test.  We don’t have any models, customer can either let us to collect tumor or they provide tumors to us and let us establish the line from the beginning.  It will take 6-10 months It will cost 30 mice to generate a grafted tumor line successfully, it needs 5 generation for the whole procedure, each generation 5 mice.  Not every case can be successful especially if customers provide tumors, due to poor quality of patients’ sample, such as no sufficient tumor cells, or no suitable tumor cells in the given tumor tissue. Tissue grafts will be terminated after 2 generations of endeavor.  After the line is established, on top of that, we can do the drug efficacy the same as in part one.  We don't sell any of the already established 105 tumor cell lines. We can only perform drug efficacy test for those and provide report.  However, if we make new tumor cell lines, then we can sell those.  Also, we can make tissue array cell lines.

 

Q: Does BioChain sell the tumor tissue cell line that is transplantable for Xenograft?

A: Yes. We can also make tissue array with the harvested cell line.

 

Q: 1)Is assay range of this kit "0.16 to 10 mg/dL"?

 

2)Concerning the standard curve, would the following steps be correct?

 

    1.Calibrator diluted to various concentrations by purified water.

    2. 250 ul of each diluted Calibrator into wells of 96 we

A: Concerning Procedure of using 96-well plate, the customer would like to confirm the followings;

 

1)Is assay range of this kit "0.16 to 10 mg/dL"?

The detection limit of the assay is 0.16 mg/dL, but we have not determined an upper limit of detection. The assay is linear to at least 10 mg/dL.

 

2)Concerning the standard curve, would the following steps be correct?

 

    1.Calibrator diluted to various concentrations by purified water.

    2. 250 ul of each diluted Calibrator into wells of 96 well plate.

    3. Read OD530nm after incubate 10 min. 

 

It is not necessary to dilute the calibrator. In order to increase the accuracy the calibrator, water, blanks and samples should be assayed in replicates. In order to measure the calibrator alone, no incubation is necessary.

3)Due to assay 1 sample, would the following preparation be correct?

 

  A  B  C  Saline  H2O Assay sample

ODsample(Total ) 50 uL  20 uL  130 uL  -  - 50 uL Sample

ODsample(Direct)  50 uL  20 uL   -  130 uL  - 50 uL Sample

ODBlank 50 uL   -   -  130 uL 20 uL 50 uL Sample

ODCaliblator  -   -   -   -  200 uL 50 uL Caliblator (10 mg/dL)

ODH2O  -   -   -   -  200 uL 50 uL H2O

 Yes, this is correct.

3)Concerning the CALCULATION, should the customer insert the each values calculated

   from the standard curve in your calculating formula?

   Or should they insert OD value into your calculating formula directly?

 

 This assay does not use a standard curve. The OD of the calibrator and the water must be entered into the equation.

4)If the mesurent value of sample over 10 mg/dL(or upper limit range of this kit), would you inform us

   of the recommended sample dilution? (is this water?)

I would recommend the sample to be diluted in a matrix similar to the sample, e.g. for blood one could use 5% BSA in saline. If not available, saline would be the next best diluent.

 

5)Is the some control sample recommended to be used for this assay?

We do not recommend any particular control sample. Human serum has normally less than 0.3 mg/dL.

 

 

Q: Is the phyllodes on this slide is benign tumor?

A: No we don't

 

Q: 1. questions with #Z7030001 and Z7030071.

Our customer wants to test with differentiated cell. Is it undifferentiated cell or differentiated cell? It is undifferentiated cell

If it’s undifferentiated cell, he’ll treat cytokine and differentiate before use

A: See Cell C12

 

Q: 1.      Because this product is ready-to-use and packaged in T75 flask, could this cell be delivered to Taiwan?

If yes, what kind of delivery method would be used?

Or, could this be packaged in cryo-tube? could you suggest an appropriate way to thaw the

A:

 

Q:

A:

 

Q:

A:

 

Q:

A:

 

Q:

A:

 

Q:

A: