BioChain Logo
 Sample Preparation for Diagnostics and Drug Discovery          ISO Certificate Order Online or Call 1-888-RNA-BLOT

   Help 

Search:

  Product Browser

  How to Order

Browse Online Catalog

  Your Account

  What's New

   New Products

   Promotions

   Company news
 
 
Reference
mRNA Northern Blots RNAmate
Total RNA RNA Array cDNA
Protein Tissue Section Tissue Array
Genomic DNA Antibody Kit & Reagent
Others


mRNA:

  • Jacob Glanville, Wenwu Zhai, Jan Berka, Dilduz Telman, Gabriella Huerta, Gautam R. Mehta, Irene Ni, Li Mei, Purnima D. Sundar, Giles M. R. Day, David Cox, Arvind Rajpal, and Jaume Pons
    Precise determination of the diversity of a combinatorial antibody library gives insight into the human immunoglobulin repertoire
    PNAS, Dec 2009; 106: 20216 - 20221.
    ... ...Total RNA and/or mRNA were obtained from 637 healthy human peripheral blood leukocyte donors (BioChain Institute and Clontech) and 17 human spleens (BioChain Institute, Clontech, and OriGene). First strand cDNA was synthesized by using human heavy... ...
    Ref. link


  • Henning Kessler, Angelika Herm-Götz, Stephan Hegge, Manuel Rauch, Dominique Soldati-Favre, Friedrich Frischknecht, and Markus Meissner
    Microneme protein 8 ¨C a new essential invasion factor in Toxoplasma gondii
    J. Cell Sci., Apr 2008; 121: 947 - 956.
    ... ...of MIC8, MIC8-like1 and MIC8-like2 was confirmed by RT-PCR (Titan one tube RT-PCR; Roche) on mRNA (isolated with mRNAeasy; Biochain) using oligonucleotide pairs MIC8-s (5-GCGGCAATTGCATTGGTGGTTGTGG-3), MIC8as (5-GCCTTAATTAAGACGCGATACCGCCCGAAGG-3), MIC8/2-s... ...
    Ref. link


  • Cédric Duret, Sabine Gerbal-Chaloin, Jeanne Ramos, Jean-Michel Fabre, Eric Jacquet, Francis Navarro, Pierre Blanc, Antonio Sa-Cunha, Patrick Maurel, and Martine Daujat-Chavanieu
    Isolation, Characterization, and Differentiation to Hepatocyte-Like Cells of Nonparenchymal Epithelial Cells from Adult Human Liver
    Stem Cells, Jul 2007; 25: 1779 - 1790.
    ... ...HNF4alpha]), or from 1 to 1/1,000 (for other genes) of a pool of mRNA isolated from human fetal (BioChain Institute, Hayward, CA, http://www.biochain.com ) (for glutathione S-transferase pi [GSTpi] and cytokeratins 7 and 19) or adult (for the other... ...
    Ref. link


  • Cedric Duret, Sabine Gerbal-Chaloin, Jeanne Ramos, Jean-Michel Fabre, Eric Jacquet, Francis Navarro, Pierre Blanc, Antonio Sa-Cunha, Patrick Maurel, and Martine Daujat-Chavanieu
    ISOLATION, CHARACTERIZATION AND DIFFERENTIATION TO HEPATOCYTE-LIKE CELLS OF NON PARENCHYMAL EPITHELIAL CELLS FROM ADULT HUMAN LIVER
    Stem Cells, Apr 2007; 10.1634/stemcells.2006-0664.
    ... ...1/5000 (for hepatocyte nuclear factors HNF4) or 1 to 1/1000 (for other genes) of a pool of mRNA isolated from human fetal (Biochain Institute,Inc,USA) (for GST, cytokeratins 7 and 19) or adult hepatocytes (for the other genes). The expression of 18S RNA was... ...
    Ref. link


  • Jae-Hyun Park, Meng-Lay Lin, Toshihiko Nishidate, Yusuke Nakamura, and Toyomasa Katagiri
    PDZ-Binding Kinase/T-LAK Cell-Originated Protein Kinase, a Putative Cancer/Testis Antigen with an Oncogenic Activity in Breast Cancer
    Cancer Res., Sep 2006; 66: 9186 - 9195.
    ... ...of mRNA isolated from normal adult human mammary gland (Biochain, Hayward, CA), lung, heart, liver, kidney, and bone marrow...tissue sections of heart, lung, liver, kidney, and testis (Biochain). Briefly, paraffin-embedded specimens were treated with... ...
    Ref. link


  • Tayebeh Rezaie, David M. Waitzman, Jennifer L. Seeman, Paul L. Kaufman, and Mansoor Sarfarazi
    Molecular Cloning and Expression Profiling of Optineurin in the Rhesus Monkey
    Invest. Ophthalmol. Vis. Sci., Jul 2005; 46: 2404 - 2410.
    ... ...normalized by amount of mRNA) blot from Biochain Institute (Hayward, CA) was used...prehybridized (FastHyb solution; Biochain) for 3 hours at 65C and subsequently...of an mRNA multiple tissue blot (BioChain). As shown in Figure 3 , two different... ...

  • Xiaomin Zhang, Gohar Azhar, Ying Zhong, and Jeanne Y. Wei
    Identification of a Novel Serum Response Factor Cofactor in Cardiac Gene Regulation
    J. Biol. Chem., Dec 2004; 279: 55626 - 55632.
    ... The human heart mRNA samples were obtained from Biochain Institute (Hayward, CA). ... 

  • Soji Kakiuchi, Yataro Daigo, Nobuhisa Ishikawa, Chiyuki Furukawa, Tatsuhiko Tsunoda, Seiji Yano, Kazuhiko Nakagawa, Takashi Tsuruo, Nobuoki Kohno, Masahiro Fukuoka, Saburo Sone, and Yusuke Nakamura
    Prediction of sensitivity of advanced non-small cell lung cancers to gefitinib (Iressa, ZD1839)
    Hum. Mol. Genet., Dec 2004; 13: 3029 - 3043.
    ... probe, normal human lung poly(A) + RNA (BD Biosciences Clontech, Palo Alto, CA, USA and BIOCHAIN, Hayward, CA, USA) was amplified in the same way. ...

  • Vidya Subramanian, Alexis Rothenberg, Carlos Gomez, Alex W. Cohen, Anne Garcia, Sucharita Bhattacharyya, Lawrence Shapiro, Rong Wang, Michael P. Lisanti, and Dawn L. Brasaemle
    Perilipin A mediates the reversible binding of CGI-58 to lipid droplets in 3T3-L1 adipocytes
    J. Biol. Chem., Aug 2004; 10.1074/jbc.M407462200.
    ... (Rockville, MD) and BioChain Institute, Inc. ...

    ... Nitrocellulose membranes containing poly A mRNA from mouse tissues (OriGene Technologies, Inc., Rockville, MD and BioChain Institute, Inc., Hayward, CA) were probed with 32 P-labeled cDNA probes for murine CGI-58. ...

  • Hideto Jinno, Toshiko Tanaka-Kagawa, Akiko Ohno, Yuko Makino, Erika Matsushima, Nobumitsu Hanioka, and Masanori Ando
    Functional Characterization of Cytochrome P450 2B6 Allelic Variants
    Drug Metab. Dispos., Apr 2003; 31: 398 - 403.
    ...Human adult normal liver mRNA was purchased from BioChain Institute Hayward, CA. ...

  • Abe S, Katagiri T, Saito-Hisaminato A, Usami SI, Inoue Y, Tsunoda T, Nakamura Y.
    Identification of CRYM as a Candidate Responsible for Nonsyndromic Deafness, through cDNA Microarray Analysis of Human Cochlear and Vestibular Tissues
    Am J Hum Genet. 2003 Jan; 72(1): 73-82. published online before print December 6, 2002
    ... ...We obtained 70?0 µg of each amplified RNA (aRNA) sample. As a control, we mixed PolyA(+) RNAs derived from 29 normal human tissues (bone marrow, brain, heart, kidney, liver, lung, lymph node, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, uterus, fetal brain, fetal kidney, fetal liver, fetal lung [Clontech], colon, ovary [Biochain], and mesenteric adipose tissue). ... ...
    Ref. link


  • Ramesh Ramakrishnan, David Dorris, Anna Lublinsky, Allen Nguyen, Marc Domanus, Anna Prokhorova, Linn Gieser, Edward Touma, Randall Lockner, Murthy Tata, Xiaomei Zhu, Marcus Patterson, Richard Shippy, Timothy J. Sendera, and Abhijit Mazumder
    An assessment of Motorola CodeLinkTM microarray performance for gene expression profiling applications
    Nucleic Acids Res., Apr 2002; 30: 30.
    ... MATERIALS AND METHODS Target preparation Five micrograms of total RNA (BioChain, Hayward, CA) were added to a reaction mix in a final volume of 12 µl, ...
    ... compared within three human poly(A)+ RNA samples (heart lot#A403084, brain lot#A311144 and kidney lot#A404013 from BioChain) using the Motorola CodeLink(TM) UniSet Human 1 expression bioarrays and the ABI TaqMan (R) products. ...

  • Jian Jin, Xuehui Chen, Yan Zhou, Mark Bartlam, Qing Guo, Yiwei Liu, Yixin Sun, Yu Gao, Sheng Ye, Guangtao Li, Zihe Rao, Boqin Qiang, and Jiangang Yuan
    Crystal structure of the catalytic domain of a human thioredoxin-like protein: Implications for substrate specificity and a novel regulation mechanism
    Eur. J. Biochem., Apr 2002; 269: 2060 - 2068.
    ... DDRT-PCR and full-length cDNA isolation Total RNA (2.5 µg) from 13- and 33-week-old human fetal cerebrum (Biochain) was reverse transcribed by Superscript II (Gibco-BRL) using a single-base anchored 3′ primer (5′-AAGCTTTTTTTTTTTN-3′, N=C, G, ...
    ... Northern blot analysis Total Poly(A) + RNA from 13- and 33-week-old human fetal cerebrum (Biochain) was electrophoresed in a 1% agarose gel containing 0.66 M formaldehyde and was blotted onto a ...

  • Byung-Taek Kim, Hiroshi Kitagawa, Jun-ichi Tamura, Toshiyuki Saito, Marion Kusche-Gullberg, Ulf Lindahl, and Kazuyuki Sugahara
    Human tumor suppressor EXT gene family members EXTL1 and EXTL3 encode 1,4- N-acetylglucosaminyltransferases that likely are involved in heparan sulfate/ heparin biosynthesis
    PNAS, Jun 2001; 98: 7176 - 7181. 
    ... was amplified with the first-strand cDNA transcribed from human adult brain poly (A) + RNA (Biochain Institute, San Leandro, CA) as a template by PCR by using a 5′ primer (5'-ATTGATCACATGGTGGCAGCTGCAACTG-3').

  • Huibin Yue, P. Scott Eastman, Bruce B. Wang, James Minor, Michael H. Doctolero, Rachel L. Nuttall, Robert Stack, John W. Becker, Julie R. Montgomery, Marina Vainer, and Rick Johnston
    An evaluation of the performance of cDNA microarrays for detecting changes in global mRNA expression
    Nucleic Acids Res., Apr 2001; 29: 41.
    ... Oligotex resin (Qiagen, Valencia, CA) from commercially available human placenta, brain and heart total RNA (Biochain, San Leandro, CA). ...
    ... done in the presence of 200 ng poly(A) mRNA, from either human brain or heart (Biochain, Hayward, CA). ...

  • Chang Bai, Brett Connolly, Michael L. Metzker, Catherine A. Hilliard, Xiaomei Liu, Volker Sandig, Avery Soderman, Sheila M. Galloway, Qingyun Liu, Christopher P. Austin, and C. Thomas Caskey
    Overexpression of M68/DcR3 in human gastrointestinal tract tumors independent of gene amplification and its location in a four-gene cluster
    PNAS, Feb 2000; 97: 1230 - 1235. 
    ... Northern Analysis. mRNA isolated from human tumor samples was obtained from BioChain Institute, San Leandro, CA. ...

  • Adrienne E. Dubin, Rene Huvar, Michael R. D'Andrea, Jayashree Pyati, Jessica Y. Zhu, K. C. Joy, Sandy J. Wilson, Jose E. Galindo, Charles A. Glass, Lin Luo, Michael R. Jackson, Timothy W. Lovenberg, and Mark G. Erlander
    The Pharmacological and Functional Characteristics of the Serotonin 5-HT3A Receptor Are Specifically Modified by a 5-HT3B Receptor Subunit
    J. Biol. Chem., Oct 1999; 274: 30799 - 30810. 
    ... Total RNA from normal human ascending and descending colon (CDP-061068; lot 8906066; CDP-061069; lot 8906067; BioChain Institute, Inc.) and 5 µg of each poly(A) RNA from normal human small intestine and ...

  • Henry M. Sarau, Robert S. Ames, Jon Chambers, Catherine Ellis, Nabil Elshourbagy, James J. Foley, Dulcie B. Schmidt, Roseanna M. Muccitelli, Owen Jenkins, Paul R. Murdock, Nicole C. Herrity, Wendy Halsey, Ganesh Sathe, Alison I. Muir, Parvathi Nuthulaganti, George M. Dytko, Peter T. Buckley, Shelagh Wilson, Derk J. Bergsma, and Douglas W.P. Hay
    ACCELERATED COMMUNICATION: Identification, Molecular Cloning, Expression, and Characterization of a Cysteinyl Leukotriene Receptor
    Mol. Pharmacol., Sep 1999; 56: 657 - 663. 
    ...poly A+ RNA from multiple tissues of four different individuals (two males, two females, except prostate) was prepared, (Biochain, San Leandro, CA; Clontech, Palo Alto, CA; Invitrogen, Leek, the Netherlands; Analytical Biological Services, Wilmington, ...

Protein: 

  • Ruey-Bing Yang, Heng-Kien Au, Chii-Ruey Tzeng, Ming-Tzu Tsai, Ping Wu, Yu-Chih Wu, Thai-Yen Ling, and Yen-Hua Huang
    Characterization of a novel cell-surface protein expressed on human sperm
    Hum. Reprod., Jan 2010; 25: 42 - 51.
    ... ...USA). The PCR products were cloned into pGEM-T Easy plasmid vector (Promega). Human testis tissue lysate was purchased from BioChain Institute, Inc. (Hayward, CA, USA). Human sperm samples were from the Department of Obstetrics and Gynecology, Center for Reproductive... ...
    Ref. link


  • Hanzhong Liu, Li Liu, Kaifeng Liu, Peyman Bizargity, Wayne W. Hancock, and Gary A. Visner
    Reduced Cytotoxic Function of Effector CD8+ T Cells Is Responsible for Indoleamine 2,3-Dioxygenase-Dependent Immune Suppression
    J. Immunol., Jul 2009; 183: 1022 - 1031.
    ... ...pathophysiology Commercial kits were used to determine intracellular ATP level (Molecular Probes), to isolate mitochondrial protein (BioChain Institute) and to assess citrate synthase activity in isolated CD8 T cells according to the manufacturers instruction (13... ...
    Ref. link


  • Anuradha Chakrabarty, Audrey Blacklock, Stanislav Svojanovsky, and Peter G. Smith
    Estrogen Elicits Dorsal Root Ganglion Axon Sprouting via a Renin-Angiotensin System
    Endocrinology, Jul 2008; 149: 3452 - 3460.
    ... ...antisera preabsorption overnight to a 5-fold excess of blocking peptides for AT2 (Santa Cruz Biotechnology) or REN native protein (BioChain Institute, Inc., Hayward, CA), and primary antisera heat inactivation for 20 min and antibody omission for ACE or AGN. A total... ...
    Ref. link


  • Jamie Fitzgerald, Cathleen Rich, Fiona H. Zhou, and Uwe Hansen
    Three Novel Collagen VI Chains, {alpha}4(VI), {alpha}5(VI), and {alpha}6(VI)
    J. Biol. Chem., Jul 2008; 283: 20170 - 20180.
    ... ...human adult skeletal muscle for COL6A6 (BioChain Institute). The mouse Col6a4 coding region...structural proteins was obtained commercially (Biochain, catalog number P5244171). A sample was...and a normal adult human tissue panel (Biochain Institute). Sections were blocked with... ...
    Ref. link


  • Eric Soupene, Vladimir Serikov, and Frans A. Kuypers
    Characterization of an acyl-CoA binding protein predominantly expressed in human primitive progenitor cells
    J. Lipid Res., Feb 2008; 10.1194/jlr.M800007-JLR200.
    ... ...protein array (Human adult normal tissues, Biochain Institute, Inc.) was performed as follows...according to the manufacturer's instructions (Biochain Institute, Inc.). Immunohistochemistry...antibody on a MegaWestern protein array (Biochain Institute, Inc.) representing 30 different... ...
    Ref. link


  • Kevin A. Glenn, Rick F. Nelson, Hsiang M. Wen, Adam J. Mallinger, and Henry L. Paulson
    Diversity in tissue expression, substrate binding and SCF complex formation for a lectin family of ubiquitin ligases
    J. Biol. Chem., Jan 2008; 10.1074/jbc.M709508200.
    ... ...and pelleting debris by centrifugation at 16,000 x g, 4?C for 15 min. Mouse tissue preparations from a commercial supplier (BioChain, Hayward, CA) produced similar results. Immunoprecipitation (IP) Nondenatured lysates from 10 cm plates were incubated with... ...
    Ref. link


  • Carrie E. Johnson, Yolanda Y. Huang, Amanda B. Parrish, Michelle I. Smith, Allyson E. Vaughn, Qian Zhang, Kevin M. Wright, Terry Van Dyke, Robert J. Wechsler-Reya, Sally Kornbluth, and Mohanish Deshmukh
    Differential Apaf-1 levels allow cytochrome c to induce apoptosis in brain tumors but not in normal neural tissues
    PNAS, Dec 2007; 104: 20820 - 20825.
    ... ...Chemical) along with an ECL-Plus detection system (Amersham Biosciences). Protein array of human astrocytomas was from the BioChain Institute (A1235713-1). Real-Time RT-PCR. RNA was isolated by using the small-scale RNAqueous Kit and treated with DNase... ...
    Ref. link


  • Yana Zavros, Meghna Waghray, Arthur Tessier, Longchuan Bai, Andrea Todisco, Deborah L. Gumucio, Linda C. Samuelson, Andrzej Dlugosz, and Juanita L. Merchant
    Reduced Pepsin A Processing of Sonic Hedgehog in Parietal Cells Precedes Gastric Atrophy and Transformation
    J. Biol. Chem., Nov 2007; 282: 33265 - 33274.
    ... ...and 60 min. Human Tissue Extracts-Three sets of normal corpus and intestinal-type tumor tissue extracts were purchased from BioChain Institute (Hayward, CA). The tumor tissues supplied were collected from patients with intestinal type gastric cancer. According... ...
    Ref. link


  • Yana Zavros, Meghna Waghray, Arthur Tessier, Longchuan Bai, Andrea Todisco, Deborah L. Gumucio, Linda C. Samuelson, Andrzej Dlugosz, and Juanita L. Merchant
    Reduced pepsin a processing of sonic hedgehog in parietal cells precedes gastric atrophy and transformation
    J. Biol. Chem., Sep 2007; 10.1074/jbc.M707090200.
    ... ...and 60 min. 5 Human tissue extracts Three sets of normal corpus and intestinal-type tumor tissue extracts were purchased from BioChain Institute (Hayward, CA). Tumor tissues supplied were collected from patients with intestinal type gastric cancer. According... ...
    Ref. link


  • Scott L. Kominsky, Betty Tyler, Jeffrey Sosnowski, Kelly Brady, Michele Doucet, Delissa Nell, James G. Smedley, III, Bruce McClane, Henry Brem, and Saraswati Sukumar
    Clostridium perfringens Enterotoxin as a Novel-Targeted Therapeutic for Brain Metastasis
    Cancer Res., Sep 2007; 67: 7977 - 7982.
    ... ...glycerol, 5 SDS, and 250 mmol/L Tris-HCl (pH 6.7). Total protein from human brain and spinal cord tissue was obtained from BioChain. Equal amounts of protein from cell and tissue lysates were resolved using 12 SDS-PAGE (Invitrogen). Protein was transferred... ...
    Ref. link


  • Raghavan Raju, Goran Rakocevic, Ziwei Chen, Gerard Hoehn, Cristina Semino-Mora, Wei Shi, Richard Olsen, and Marinos C. Dalakas
    Autoimmunity to GABAA-receptor-associated protein in stiff-person syndrome
    Brain, Dec 2006; 129: 3270 - 3276.
    ... ...bleed was tested for specificity by enzyme-linked immunosorbent assay (ELISA) and in western blot using total human brain (Biochain, Hayward, CA). Immunoprecipitation and western blot Aliquots of 15 mul serum from SPS or OND control patients were incubated... ...
    Ref. link


  • Daniel B. Campbell, James S. Sutcliffe, Philip J. Ebert, Roberto Militerni, Carmela Bravaccio, Simona Trillo, Maurizio Elia, Cindy Schneider, Raun Melmed, Roberto Sacco, Antonio M. Persico, and Pat Levitt
    From the Cover: A genetic variant that disrupts MET transcription is associated with autism
    PNAS, Nov 2006; 103: 16834 - 16839.
    ... ...spontaneously aborted 22-week female fetus, was purchased from BioChain Institute, Inc. (Hayward, CA; catalog no. P2244035; lot...Human fetal brain nuclear protein was purchased from BioChain Institute, Inc. (Hayward, CA); the source of the human... ...
    Ref. link


  • Daniel B. Campbell, James S. Sutcliffe, Philip J. Ebert, Roberto Militerni, Carmela Bravaccio, Simona Trillo, Maurizio Elia, Cindy Schneider, Raun Melmed, Roberto Sacco, Antonio M. Persico, and Pat Levitt
    A genetic variant that disrupts MET transcription is associated with autism
    PNAS, Oct 2006; 10.1073/pnas.0605296103.
    ... ...Human fetal brain nuclear protein was purchased from BioChain Institute, Inc. (Hayward, CA); the source of the human...spontaneously aborted 22-week female fetus, was purchased from BioChain Institute, Inc. (Hayward, CA; catalog no. P2244035; lot... ...
    Ref. link


  • Raghavan Raju, Goran Rakocevic, Ziwei Chen, Gerard Hoehn, Cristina Semino-Mora, Wei Shi, Richard Olsen, and Marinos C. Dalakas
    Autoimmunity to GABAA-receptor-associated protein in stiff-person syndrome
    Brain, Sep 2006; 10.1093/brain/awl245.
    ... ...bleed was tested for specificity by enzyme-linked immunosorbent assay (ELISA) and in western blot using total human brain (Biochain, Hayward, CA). Immunoprecipitation and western blot Aliquots of 15 ml serum from SPS or OND control patients were incubated... ...
    Ref. link


  • Mark R. Garbrecht, Thomas J. Schmidt, Zygmunt S. Krozowski, and Jeanne M. Snyder
    11-Hydroxysteroid dehydrogenase type 2 and the regulation of surfactant protein A by dexamethasone metabolites
    Am J Physiol Endocrinol Metab, Apr 2006; 290: E653 - E660.
    ... ...Loading was monitored by staining the blots with Ponceau S, a nonspecific protein dye. Homogenate proteins of human liver (BioChain, Hayward, CA) and Caco2 cells (human colon epithelial cell line, a gift of Dr. F. Jeffrey Field, University of Iowa) were... ...


  • Xiaofeng Lu, Minhui Wang, Jin Qi, Haitao Wang, Xinna Li, Dipika Gupta, and Roman Dziarski
    Peptidoglycan Recognition Proteins Are a New Class of Human Bactericidal Proteins
    J. Biol. Chem., Mar 2006; 281: 5895 - 5907.
    ... ...esophagus, stomach, small intestine, and colon, from normal human donors (male and female, 21-65 years old), were prepared by BioChain. Following standard deparaffinization, re-hydration, and quenching of endogenous peroxidase by 30 min incubation in 0.3... ...
  • Andrew M. F. Liu and Yung H. Wong
    Activation of Nuclear Factor B by Somatostatin Type 2 Receptor in Pancreatic Acinar AR42J Cells Involves G14 and Multiple Signaling Components: A MECHANISM REQUIRING PROTEIN KINASE C, CALMODULIN-DEPENDENT KINASE II, ERK, AND c-Src
    J. Biol. Chem., Oct 2005; 280: 34617 - 34625.
    ... ...luciferin substrate kit was a product of Roche Diagnostics. Normal rat pancreas membrane protein fraction was purchased from BioChain (Hayward, CA). Various antisera were products of Cell Signaling Technology (Beverly, MA) and Amersham Biosciences. Specific... ...

  • Hamid Mehenni, Nathalie Lin-Marq, Karine Buchet-Poyau, Alexandre Reymond, Martine A. Collart, Didier Picard, and Stylianos E. Antonarakis
    LKB
    1 interacts with and phosphorylates PTEN: a functional link between two proteins involved in cancer predisposing syndromes
    Hum. Mol. Genet., Aug 2005; 14: 2209 - 2219.
    ... ...immunoprecipitate endogenous proteins with antibodies against PTEN, a commercial total protein extract from human small intestine (BioChain) was used. For immunoblotting, antibodies to LKB1 or to PTEN (both from Santa Cruz Biotechnology) were diluted 1:1000... ...


  • Wei Li, Zu-Xi Yu, and Robert M. Kotin
    Profiles of PrKX Expression in Developmental Mouse Embryo and Human Tissues
    J. Histochem. Cytochem., Aug 2005; 53: 1003 - 1009.
    ... ...or fetal tissues including brain, heart, kidney, liver, lung, pancreas, spleen, and thymus were commercially obtained (BioChain Institute Hayward, CA). According to the manufacturer, the protein concentrations from each tissue were determined using... ...

  • Thomas A. Hughes and Hugh J. M. Brady
    Expression of axin2 Is Regulated by the Alternative 5'-Untranslated Regions of Its mRNA
    J. Biol. Chem., Mar 2005; 280: 8581 - 8588.
    .... RNA and protein that had been purified simultaneously from single tissue samples was purchased from BioChain (AMS Biotechnology). cDNA samples were subjected to semi-quantitative PCR using RedTaq (Sigma) and the following ...

  • Angela Relógio, Claudia Ben-Dov, Michael Baum, Matteo Ruggiu, Christine Gemund, Vladimir Benes, Robert B. Darnell, and Juan Valcárcel
    Alternative Splicing Microarrays Reveal Functional Expression of Neuron-specific Regulators in Hodgkin Lymphoma Cells
    Biol. Chem., Feb 2005; 280: 4779 - 4784.
    ... Lymph node tumor samples from lymphoma patients were purchased from BioChain (catalog number P1235161A-1, P1235161B-1). ...

  • Reeves J, Xuan J, Arfanis K, Morin C, Garde S, Ruiz M, Wisniewski J, Panchal C, Tanner J.
    Identification, purification and characterization of a novel human blood protein with binding affinity for prostate secretory protein of 94 amino acids
    Biochem J. 2005 Jan 1; 385(Pt 1): 105-114.
    ... ...Total protein lysates from human prostate, pituitary and ovary were obtained from BioChain Institute (Hayward, CA, U.S.A.). All other reagents used were of analytical grade. ... ...
    Ref. link


  • X. Chang, R. Yamada, A. Suzuki, T. Sawada, S. Yoshino, S. Tokuhiro, and K. Yamamoto
    Localization of peptidylarginine deiminase 4 (PADI4) and citrullinated protein in synovial tissue of rheumatoid arthritis
    Rheumatology, Jan 2005; 44: 40 - 50.
    ... The total protein in a commercial liver sample served as the control (Biochain). ...

  • Friederike Fellenberg, Tanja B. Hartmann, Reinhard Dummer, Dirk Usener, Dirk Schadendorf, and Stefan Eichmüller
    GBP-5 Splicing Variants: New Guanylate-Binding Proteins with Tumor-Associated Expression and Antigenicity
    J. Invest. Dermatol., Jun 2004; 122: 1510 - 1517.
    ... cell lysate and commercial protein medleys of normal tissues (Clontech, Palo Alto, California, USA or BioChain, Hayward, California, USA). ...

  • Miki Shimada, Reiko Terazawa, Yoshiteru Kamiyama, Wataru Honma, Kiyoshi Nagata, and Yasushi Yamazoe
    Unique properties of a renal sulfotransferase, St1d1 in dopamine metabolism
    J. Pharmacol. Exp. Ther., Apr 2004; 10.1124/jpet.104.065532.
    ... Human kidney cytosols were obtained from BioChain Institute, Inc. ...

  • Stephen A. Renshaw, Clare E. Dempsey, Frances A. Barnes, Stephanie M. Bagstaff, Steven K. Dower, Colin D. Bingle, and Moira K. B. Whyte
    Three Novel Bid Proteins Generated by Alternative Splicing of the Human Bid Gene
    J. Biol. Chem., Jan 2004; 279: 2846 - 2855.
    ... Preprepared protein samples were from the BioChain Institute (Hayward, CA). ...


  • Andrew M. Davidoff, Catherine Y. C. Ng, Junfang Zhou, Yunyu Spence, and Amit C. Nathwani
    Sex significantly influences transduction of murine liver by recombinant adeno-associated viral vectors through an androgen-dependent pathway
    Blood, Jul 2003; 102: 480 - 488.
    ... normal liver nuclear protein and Swiss Webster mouse hepatocyte nuclear extract were also purchased from BioChain Institute (Hayward, CA).

  • Asako Otomo, Shinji Hadano, Takeya Okada, Hikaru Mizumura, Ryota Kunita, Hitoshi Nishijima, Junko Showguchi-Miyata, Yoshiko Yanagisawa, Eri Kohiki, Etsuko Suga, Masanori Yasuda, Hitoshi Osuga, Takeharu Nishimoto, Shuh Narumiya, and Joh-E Ikeda
    ALS2, a novel guanine nucleotide exchange factor for the small GTPase Rab5, is implicated in endosomal dynamics
    Hum. Mol. Genet., Jul 2003; 12: 1671 - 1687.
    ... Protein samples for the human cerebral cortex and cerebellum were purchased from Biochain Inc. ...

  • Andrew M Davidoff, Catherine Y C Ng, Junfang Zhou, Yunyu Spence, and Amit C Nathwani
    Gender significantly influences transduction of murine liver by recombinant adeno-associated viral vectors through an androgen-dependent pathway
    Blood, Mar 2003; 200209288
    ... normal liver nuclear protein and Swiss Webster mouse hepatocyte nuclear extract were also purchased from (BioChain Institute Hayward, CA). ...
    ... and female mice, 2 weeks after castration or subcutaneous implantation of DHT pellets, respectively, by (BioChain Institute. ...)

  • Yong Li, Kaihua Wei, Chengrong Lu, Yingxian Li, Ming Li, Guichun Xing, Handong Wei, Qingming Wang, Jizhong Chen, Chutse Wu, Huipeng Chen, Songcheng Yang, and Fuchu He
    Identification of hepatopoietin dimerization, its interacting regions and alternative splicing of its transcription
    Eur. J. Biochem., Aug 2002; 269: 3888 - 3893.
    ...nuclear extracts of three different human liver tissues (fetal liver, adult normal liver and hepatoma, Biochain) were resolved on SDS PAGE, transferred to poly(vinylidene difluoride) membrane, and analyzed by immunoblotting with ...

  • Chengrong Lu, Yong Li, Yanlin Zhao, Guichun Xing, Fei Tang, Qingming Wang, Yuhui Sun, Handong Wei, Xiaoming Yang, Chutse Wu, Jianguo Chen, Kun-liang Guan, Chenggang Zhang, Huipeng Chen, and Fuchu He
    Intracrine hepatopoietin potentiates AP-1 activity through JAB1 independent of MAPK pathway
    FASEB J, Nov 2001; 105061. (Liver protein lysate from BioChain...)

  • Katsuki Ohtani, Yasuhiko Suzuki, Souji Eda, Takao Kawai, Tetsuo Kase, Hiroyuki Keshi, Yoshinori Sakai, Atsushi Fukuoh, Takashi Sakamoto, Hiroyuki Itabe, Tatsuo Suzutani, Masahiro Ogasawara, Itsuro Yoshida, and Nobutaka Wakamiya
    The Membrane-type Collectin CL-P1 Is a Scavenger Receptor on Vascular Endothelial Cells
    J. Biol. Chem., Nov 2001; 276: 44222 - 44228. 
    ...Western blotting analyses were performed using CL-P1 transfected cells, HUVEC , placental tissue membrane extracts (BioChain Institute, Inc., CA) without or with de-glycosylation (Enzymatic Deglycosylation kit, Bio-Rad), and in vitro transcription ...

  • Hiroshi Sakamoto, Tetsuo Mashima, Shigeo Sato, Yuichi Hashimoto, Takao Yamori, and Takashi Tsuruo
    Selective Activation of Apoptosis Program by S-p-bromobenzylglutathione Cyclopentyl Diester in Glyoxalase I-overexpressing Human Lung Cancer Cells
    Clin. Cancer Res., Aug 2001; 7: 2513 - 2518.
    ... Cytoplasmic protein from human normal tissue was purchased from BioChain Institute, Inc. ...
    ... normal tissues for GLO1 expressions using 48 Dot Human Tumor/Normal Tissue Total RNA Dot Blot (BioChain Institute, Inc.). ...

  • Friederike Fellenberg, Tanja B. Hartmann, Reinhard Dummer, Dirk Usener, Dirk Schadendorf, and Stefan Eichmüller
    GBP-5 Splicing Variants: New Guanylate-Binding Proteins with Tumor-Associated Expression and Antigenicity

    J. Invest. Dermatol., Jun 2004; 122: 1510 - 1517.
    ... cell lysate and commercial protein medleys of normal tissues (Clontech, Palo Alto, California, USA or BioChain, Hayward, California, USA). ...

cDNA: 

  • Sean Kim, Joseph E. Dinchuk, Monique N. Anthony, Tami Orcutt, Mary E. Zoeckler, Mary B. Sauer, Kathleen W. Mosure, Ragini Vuppugalla, James E. Grace, Jr., Jean Simmermacher, Heidi A. Dulac, Jennifer Pizzano, and Michael Sinz
    Evaluation of Cynomolgus Monkey Pregnane X Receptor, Primary Hepatocyte, and in Vivo Pharmacokinetic Changes in Predicting Human CYP3A4 Induction
    Drug Metab. Dispos., Jan 2010; 38: 16 - 24.
    ... ...hyperforin or 0.87 mg/capsule. Molecular Cloning of cynoPXR. A cynomolgus monkey liver cDNA panel was purchased from the Biochain Institute (Hayward, CA). Forward (nucleotide 1-27) and reverse (1274-1305) primers were selected based on a rhesus monkey PXR... ...
  • Ref. link
  • Fenghua Yuan, Jimmy El Hokayem, Wen Zhou, and Yanbin Zhang
    FANCI Protein Binds to DNA and Interacts with FANCD2 to Recognize Branched Structures
    J. Biol. Chem., Sep 2009; 284: 24443 - 24452.
    ... ...of Recombinant FA Proteins cDNAs for human FANCI and FANCD2 were obtained by PCR amplification from a universal cDNA pool (BioChain Institute, Inc.). The FANCI cDNA matches the NCBI Reference Sequence NM_001113378, and the FANCD2 cDNA matches NM_001018115... ...
  • Ref. link
  • Veronica J. Peschansky, Timothy J. Burbridge, Amy J. Volz, Christopher Fiondella, Zach Wissner-Gross, Albert M. Galaburda, Joseph J. Lo Turco, and Glenn D. Rosen
    The Effect of Variation in Expression of the Candidate Dyslexia Susceptibility Gene Homolog Kiaa0319 on Neuronal Migration and Dendritic Morphology in the Rat
    Cereb Cortex, Aug 2009; 10.1093/cercor/bhp154.
    ... ...Kiaa0319 as described below. The cDNAs prepared from frontal, parietal, and occipital lobes of human embryonic brain (20 weeks, Biochain Institute, Hayward, CA) were used as template to amplify the full-length coding sequence of Kiaa0319 using forward (5ATGGCGCCCCCCACAGGTGTG3... ...
  • Ref. link
  • Dorothee Günzel, Salah Amasheh, Sandra Pfaffenbach, Jan F. Richter, P. Jaya Kausalya, Walter Hunziker, and Michael Fromm
    Claudin-16 affects transcellular Cl\#8722; secretion in MDCK cells
    J. Physiol., Aug 2009; 587: 3777 - 3793.
    ... ...performed on MDCK-C7 cDNA and on commercial dog kidney cDNA (BioChain, Hayward, CA, USA) using HOTSTAR DNA polymerase (Qiagen, Hilden...performed on MDCK-C7 cDNA and on commercial dog kidney cDNA (BioChain, Hayward, CA, USA) using HOTSTAR DNA polymerase (Qiagen, Hilden... ...
  • Ref. link
  • Hui-Wen Lo, Hu Zhu, Xinyu Cao, Amy Aldrich, and Francis Ali-Osman
    A Novel Splice Variant of GLI1 That Promotes Glioblastoma Cell Migration and Invasion
    Cancer Res., Aug 2009; 10.1158/0008-5472.CAN-09-0886.
    ... ...purchased from Sigma unless otherwise stated. cDNAs of normal tissues and genomic DNAs from peripheral leukocytes were from BioChain. Human GBM cell lines were established in our laboratory from primary specimens (7), with the exception of U87MG, T98G, U373MG... ...
    Ref. link


  • Nandor Gabor Than, Roberto Romero, Morris Goodman, Amy Weckle, Jun Xing, Zhong Dong, Yi Xu, Federica Tarquini, Andras Szilagyi, Peter Gal, Zhuocheng Hou, Adi L. Tarca, Chong Jai Kim, Jung-Sun Kim, Saied Haidarian, Monica Uddin, Hans Bohn, Kurt Benirschke, Joaquin Santolaya-Forgas, Lawrence I. Grossman, Offer Erez, Sonia S. Hassan, Peter Zavodszky, Zoltan Papp, and Derek E. Wildman
    A primate subfamily of galectins expressed at the maternal–fetal interface that promote immune cell death
    PNAS, Jun 2009; 106: 9731 - 9736.
    ... ...PowerScript Reverse Transcriptase (BD Biosciences) for P. anubis and A. fusciceps samples. The cDNA for M. mulatta was purchased from Biochain Institute. The amplification of nucleotide sequences from genomic and complementary DNAs was performed by ``primer walk'' by... ...
    Ref. link


  • Yuichi Hashimoto, Megumi Kurita, Sadakazu Aiso, Ikuo Nishimoto, and Masaaki Matsuoka
    Humanin Inhibits Neuronal Cell Death by Interacting with a Cytokine Receptor Complex or Complexes Involving CNTF Receptor {alpha}/WSX-1/gp130
    Mol. Biol. Cell, Jun 2009; 20: 2864 - 2873.
    ... ...1996). C-terminally myc/6xHis-tagged human WSX-1 and mouse CREME9 cDNA were PCR-amplified from human and mouse embryo cDNAs (Biochain, Hayward, CA). A vector encoding C-terminally V5-tagged human CNTFR was purchased from Invitrogen (Carlsbad, CA). Rat IL-6Ralpha... ...
    Ref. link


  • Chia-Wei Li, Gia Khanh Dinh, and J. Don Chen
    Preferential Physical and Functional Interaction of Pregnane X Receptor with the SMRT{alpha} Isoform
    Mol. Pharmacol., Feb 2009; 75: 363 - 373.
    ... ...Zhang et al., 2004). Real-time PCR MOL #47845 11 Paired cDNAs from various human normal and tumor samples were purchased from BioChain Institute (Hayward, CA). Normal mouse and human liver cDNA libraries were purchased from Clontech. Total RNA was also isolated... ...
  • Ref. link
  • Marina Miller, Jae Youn Cho, Alexa Pham, Joe Ramsdell, and David H. Broide
    Adiponectin and Functional Adiponectin Receptor 1 Are Expressed by Airway Epithelial Cells in Chronic Obstructive Pulmonary Disease
    J. Immunol., Jan 2009; 182: 684 - 691.
    ... ...AdipoR1, and AdipoR2 was conducted using RT-PCR primers and conditions as previously described (17). Human adipose tissue cDNA (BioChain), which is known to express adiponectin, AdipoR1, and AdipoR2, was used as a control. For Western blots, whole A549 cell lysates... ...
  • Ref. link
  • Songqing Li, Shang L. Lian, Joanna J. Moser, Mark L. Fritzler, Marvin J. Fritzler, Minoru Satoh, and Edward K. L. Chan
    Identification of GW182 and its novel isoform TNGW1 as translational repressors in Ago2-mediated silencing
    J. Cell Sci., Dec 2008; 121: 4134 - 4144.
    ... ...lines (ATCC, Manassas, VA), and normal adult human testis (BioChain, Hayward, CA) using primer TNRC-1 (5-ATAATGCCAAGCGAGCTACAG...PCR amplification was conducted on the human testis cDNA (BioChain) using primer TNRC-5a [5-TTTGGAAGATCTATGAGAGAATTGGAAGCTAAAGCT-3... ...
  • Ref. link
  • Shiho Kawamura, Kieran Hervold, Felipe-Andr¨¨s Ramirez-Weber, and Thomas B. Kornberg
    Two Patched Protein Subtypes and a Conserved Domain of Group I Proteins That Regulates Turnover
    J. Biol. Chem., Nov 2008; 283: 30964 - 30969.
    ... ...mRNA and the FirstChoice RLM-RACE kit (Ambion). Canis familiaris and Rhesus monkey (Macaca mulatta) cDNAs were purchased from BioChain Institute. Primer Design for Reverse Transcription-PCR-Primers were designed based upon predicted CTD sequences and were chosen... ...
  • Ref. link
  • Osama M. H. Habayeb, Anthony H. Taylor, Stephen C. Bell, David J. Taylor, and Justin C. Konje
    Expression of the Endocannabinoid System in Human First Trimester Placenta and its Role in Trophoblast Proliferation
    Endocrinology, Oct 2008; 149: 5052 - 5060.
    ... ...CNR01LTN00 and CNR020TN00, respectively; University of Missouri-Rolla cDNA Resource Center, Rolla, MO), FAAH (12), and GAPDH (BioChain Institute Inc., Hayward, CA) cDNA targets adjusted so that a standard curve from 1-10,000,000 pmol cDNA could be constructed... ...
  • Ref. link
  • Cynthia Shannon Weickert, Ana L. Miranda-Angulo, Jenny Wong, William R. Perlman, Sarah E. Ward, Vakkalanka Radhakrishna, Richard E. Straub, Daniel R. Weinberger, and Joel E. Kleinman
    Variants in the estrogen receptor alpha gene and its mRNA contribute to risk for schizophrenia
    Hum. Mol. Genet., Aug 2008; 17: 2293 - 2309.
    ... ...constructed by PCR amplification of full-length human wild-type ESR1 or delta7 ESR1 from commercially available MCF-7 cDNA (BioChain Institute, Inc. Hayward, CA, USA). Primer pairs used in the amplification contained both XhoI and BamI restriction sites. Primer... ...
  • Ref. link
  • Masahiko Ito, Tomohide Shikano, Shoji Oda, Takashi Horiguchi, Satomi Tanimoto, Takeo Awaji, Hiroshi Mitani, and Shunichi Miyazaki
    Difference in Ca2+ Oscillation-Inducing Activity and Nuclear Translocation Ability of PLCZ1, an Egg-Activating Sperm Factor Candidate, Between Mouse, Rat, Human, and Medaka Fish
    Biol Reprod, Jun 2008; 78: 1081 - 1090.
    ... ...synthesized by superscript III (Invitrogen Corp., Carlsbad, CA) and human testis cDNA (PCR Ready First Strand cDNA; C1234260; BioChain Institute, Inc., Hayward, CA), respectively. The following primers were used for rat PLCZ1: 5-GGGGTACCGCCACCATGGAGAGCCATTATGA... ...
  • Ref. link

  • Yuichi Kondo, Tomohiro Yoshimoto, Koubun Yasuda, Shizue Futatsugi-Yumikura, Mai Morimoto, Nobuki Hayashi, Tomoaki Hoshino, Jiro Fujimoto, and Kenji Nakanishi
    Administration of IL-33 induces airway hyperresponsiveness and goblet cell hyperplasia in the lungs in the absence of adaptive immune system
    Int. Immunol., Jun 2008; 20: 791 - 800.
    ... ...human IL-33 was made by Hokudo Co., Ltd (Sapporo, Japan). Briefly, IL-33 (mature form) was amplified from human lung cDNA (BioChain Institute) as a template and subcloned into pET28a vector (Novagen). BL21 (DE3) RIL was transformed and expressed recombinant... ...
  • Ref. link

  • Yan Qun Chen, Ming-Shang Kuo, Shuyu Li, Hai H. Bui, David A. Peake, Philip E. Sanders, Stefan J. Thibodeaux, Shaoyou Chu, Yue-Wei Qian, Yang Zhao, David S. Bredt, David E. Moller, Robert J. Konrad, Anne P. Beigneux, Stephen G. Young, and Guoqing Cao
    AGPAT6 Is a Novel Microsomal Glycerol-3-phosphate Acyltransferase
    J. Biol. Chem., Apr 2008; 283: 10048 - 10057.
    ... ...Human AGPAT6-Human normal tissue cDNA panels were obtained from BioChain (Hayward, CA) and PrimGen (Bothell, WA). TaqMan real time quantitative...Procedures using human normal tissue cDNA panel obtained from BioChain (A) or PrimGen (B). Data were expressed as mean S.D. (n... ...
  • Ref. link

  • Victoria L. Robinson, Ore Shalhav, Kristen Otto, Tomoko Kawai, Myriam Gorospe, and Carrie W. Rinker-Schaeffer
    Mitogen-Activated Protein Kinase Kinase 4/c-Jun NH2-Terminal Kinase Kinase 1 Protein Expression Is Subject to Translational Regulation in Prostate Cancer Cell Lines
    Mol. Cancer Res., Mar 2008; 6: 501 - 508.
    ... ...amplified by PCR (primer sequences: 5-GAGTCAACGGATTTGGTCGT-3 and 5-TGAGCTTGACAAAGTGGTCG-3), and beta-actin was a 838-bp cDNA (BioChain). Drug Treatments Drug solutions and vehicle controls were prepared to final concentrations in the appropriate medium and... ...
    Ref. link
  • Jennifer L. Strande, Anna Hsu, Jidong Su, Xiangping Fu, Garrett J. Gross, and John E. Baker
    Inhibiting Protease-Activated Receptor 4 Limits Myocardial Ischemia/Reperfusion Injury in Rat Hearts by Unmasking Adenosine Signaling
    J. Pharmacol. Exp. Ther., Mar 2008; 324: 1045 - 1054.
    ... ...from Sigma-Aldrich (St. Louis, MO) unless otherwise specified. PCR. Rat heart PCR Ready First Strand cDNA was purchased from BioChain Institute, Inc. (Hayward, CA). This consists of cDNA reverse transcribed from mRNA pooled from three rat hearts. Forward and... ...
  • Ref. link

  • Sheli R. Radoshitzky, Jens H. Kuhn, Christina F. Spiropoulou, C¨¦sar G. Albariño, Dan P. Nguyen, Jorge Salazar-Bravo, Tatyana Dorfman, Amy S. Lee, Enxiu Wang, Susan R. Ross, Hyeryun Choe, and Michael Farzan
    Receptor determinants of zoonotic transmission of New World hemorrhagic fever arenaviruses
    PNAS, Feb 2008; 105: 2664 - 2669.
    ... ...provided by Colin Parrish (Cornell University, Ithaca, NY). R. norvegicus TfR1 (rTfR1) was cloned from a rat liver cDNA library (BioChain) by using the following primers: 5-AATAACTACTTCGAAGCCACCATGGATCAAGCCAGATCAGCATTCTC-3 and 5-AATAACTACCTCGAGTTAAAACTCATTGTCAATATTCCAAATGTCACCAG-3...
    Ref. Link
  • YanQun Chen, Ming-Shang Kuo, Shuyu Li, Hai H. Bui, David A. Peake, Philip E. Sanders, Stefan J. Thibodeaux, Shaoyou Chu, Yue-Wei Qian, Yang Zhao, David S. Bredt, David E. Moller, Robert J. Konrad, Anne P. Beigneux, Stephen G. Young, and Guoqing Cao
    AGPAT6 Is a novel microsomal glycerol-3-phosphate acyltransferase (GPAT)
    J. Biol. Chem., Jan 2008; 10.1074/jbc.M708151200.
    ... ...AGPAT6--Human normal tissue cDNA panels were obtained from BioChain (Hayward, CA) and PrimGen (Bothell, WA). TaqMan real-time quantitative...Procedures using human normal tissue cDNA panel obtained from BioChain (A) or PrimGen (B). Data were expressed as mean ? SD (n = 3... ...
    Ref. link


  • Jennifer L. Strande, Anna Hsu, Jidong Su, Xiangping Fu, Garrett J. Gross, and John E. Baker
    Inhibiting Protease-Activated Receptor 4 Limits Myocardial Ischemia/Reperfusion Injury in Rat Hearts by Unmasking Adenosine Signaling
    J. Pharmacol. Exp. Ther., Nov 2007; 10.1124/jpet.107.133595.
    ... ...obtained from Sigma (St. Louis, MO) unless otherwise specified. PCR Rat heart PCR Ready First Strand cDNA was purchased from BioChain Institute, Inc (Hayward, CA). This consists of cDNA reverse transcribed from mRNA pooled from three rat hearts. Forward and... ...
    Ref. link


  • Isabelle Goulet, Gabrielle Gauvin, Sophie Boisvenue, and Jocelyn Côt?
    Alternative Splicing Yields Protein Arginine Methyltransferase 1 Isoforms with Distinct Activity, Substrate Specificity, and Subcellular Localization
    J. Biol. Chem., Nov 2007; 282: 33009 - 33021.
    ... ...kindly provided by Dr. Martin Pelchat (University of Ottawa). RT-PCR Analysis-Total human tissue cDNAs were obtained from BioChain (Hayward, CA). PCR were performed in 25-mul reaction mixture using TaqDNA polymerase (Qiagen). cDNAs were amplified using the... ...
    Ref. link


  • Scott H. Long, Marc J. Berna, Michelle Thill, Andrea Pace, Tapas K. Pradhan, K. Martin Hoffmann, Jose Serrano, and Robert T. Jensen
    Secretin-Receptor and Secretin-Receptor-Variant Expression in Gastrinomas: Correlation with Clinical and Tumoral Features and Secretin and Calcium Provocative Test Results
    J. Clin. Endocrinol. Metab., Nov 2007; 92: 4394 - 4402.
    ... ...amplification. In all experiments, dilutions of standard were included, which was human pancreas (Panc) cDNA (lot no. A901107; BioChain Institute, Inc., Hayward, CA). Western blot Pooled tissue from cryosections containing more than 80% tumor was lysed in... ...
    Ref. link


  • Glenn D. Rosen, Jilin Bai, Yu Wang, Christopher G. Fiondella, Steven W. Threlkeld, Joseph J. LoTurco, and Albert M. Galaburda
    Disruption of Neuronal Migration by RNAi of Dyx1c1 Results in Neocortical and Hippocampal Malformations
    Cereb Cortex, Nov 2007; 17: 2562 - 2572.
    ... ...Dyx1c1 as described below. The cDNA prepared from frontal, parietal, and occipital lobes of human embryonic brain (20 weeks, Biochain Institute, Hayward, CA) was amplified with respective forward and reverse primers (GGG AGA AAT TCA GAA AAT ATA TTT AC and TTA... ...
    Ref. link


  • Isabelle Goulet, Gabrielle Gauvin, Sophie Boisvenue, and Jocelyn Cote
    Alternative splicing yields protein-arginine methyltransferase 1 isoforms with distinct activity, substrate specificity and subcellular localization
    J. Biol. Chem., Sep 2007; 10.1074/jbc.M704349200.
    ... ...was kindly provided by Dr. Martin Pelchat (University of Ottawa). RT-PCR analysis Total human tissue cDNAs were obtained from BioChain (Hayward, California). PCR were performed in 25 ?l reaction mixture using Taq DNA polymerase (Qiagen). cDNAs were amplified... ...
    Ref. link


  • April Smith Torhan, Boonlert Cheewatrakoolpong, Lia Kwee, and Scott Greenfeder
    Cloning and characterization of the hamster and guinea pig nicotinic acid receptors
    J. Lipid Res., Sep 2007; 48: 2065 - 2071.
    ... ...GPR109A (nicotinic acid receptor) receptor Guinea pig and hamster genomic DNA and cDNA from various tissues were purchased from Biochain Institute, Inc. (Hayward, CA). The Advantage 2 PCR kit was purchased from Clontech (Mountain View, CA). All primers were synthesized... ...
    Ref. link


  • Jeannette M Moebius, Darius Widera, Juergen Schmitz, Christian Kaltschmidt, and Christoph Piechaczek
    Impact of polysialylated CD56 on natural killer cell cytotoxicity
    BMC Immunol. 2007; 8: 13. Published online 2007 August 6. doi: 10.1186/1471-2172-8-13.
    ... ...Human normal adult brain cDNA (1 µl per PCR reaction) and human fetal brain cDNA (2 µl per PCR reaction) were purchased from Biochain Institute, Inc (Hayward, CA, USA).... ...
    Ref. link


  • Waddah A. Alrefai, Xiaoming Wen, Wen Jiang, Jonathan P. Katz, Kris A Steinbrecher, Mitchell B Cohen, MD, Ifor R. Williams, Pradeep K. Dudeja, and Gary D. Wu
    Molecular Cloning and Promoter Analysis of Down-Regulated in Adenoma DRA
    Am J Physiol Gastrointest Liver Physiol, Aug 2007; 10.1152/ajpgi.00029.2007.
    ... ...small intestine, one step real time PCR was performed utilizing cDNA from duodenum, jejunum and ileum that were obtained from BioChain (Hayward, CA) DNase I footprinting-688(DRA)LUC was digested with Hind III and end labeled with 32 P using Klenow. After releasing... ...
    Ref. link


  • Scott H. Long, Marc J. Berna, Michelle Thill, Andrea Pace, Tapas K. Pradhan, K. Martin Hoffmann, Jose Serrano, and Robert T. Jensen
    Secretin-Receptor and Secretin-Receptor-Variant Expression in Gastrinomas: Correlation with Clinical and Tumoral Features and Secretin and Calcium Provocative Test Results
    J. Clin. Endocrinol. Metab., Aug 2007; 10.1210/jc.2007-0986.
    ... ...5 min concluded the amplification. In all experiments, dilutions of standard were included, which was human pancreas cDNA (BioChain Institute, Inc., lot no. A901107, Hayward,CA.) Western BlotPooled tissue from cryosections containing >80% tumor were lysed... ...
    Ref. link


  • Xudong Liao, Wei Wang, Shenghan Chen, and Qingyu Wu
    Role of glycosylation in corin zymogen activation
    J. Biol. Chem., Jul 2007; 10.1074/jbc.M703687200.
    ... ...A human corin cDNA fragment containing the entire open-reading frame was amplified by PCR from a human fetal heart library (BioChain, Hayward, CA) using Phusion High-Fidelity polymerase with sense primer 5'-AGA GAA AAG CGA CCA AGA TAA A-3' and anti-sense primer... ...
    Ref. link


  • Nattachet Plengvidhya, Suwattanee Kooptiwut, Napat Songtawee, Asako Doi, Hiroto Furuta, Masahiro Nishi, Kishio Nanjo, Wiwit Tantibhedhyangkul, Watip Boonyasrisawat, Pa-thai Yenchitsomanus, Alessandro Doria, and Napatawn Banchuin
    PAX4 Mutations in Thais with Maturity Onset Diabetes of the Young
    J. Clin. Endocrinol. Metab., Jul 2007; 92: 2821 - 2826.
    ... ...PAX4 variant Full-length human wild-type PAX4 cDNA was amplified from PCR Ready First Strand cDNA of normal human placenta (BioChain Institute, Inc., PSA Vista, Singapore) by PCR using platinum Pfx DNA polymerase (Invitrogen, Leek, The Netherlands) and subcloned... ...
    Ref. link


  • Marie Brulliard, Dalia Lorphelin, Olivier Collignon, Walter Lorphelin, Benoit Thouvenot, Emmanuel Gothi? Sandrine Jacquenet, Virginie Ogier, Olivier Roitel, Jean-Marie Monnez, Pierre Vallois, Frances T. Yen, Olivier Poch, Marc Guenneugues, Gilles Karcher, Pierre Oudet, and Bernard E. Bihain
    Nonrandom variations in human cancer ESTs indicate that mRNA heterogeneity increases during carcinogenesis
    PNAS, May 2007; 104: 7522 - 7527.
    ... ...Tissue Versus Normal Adjacent Tissue. cDNA from cancerous and adjacent normal kidney tissues obtained from the same individual (BioChain; CliniSciences, Montrouge, France) were amplified by PCR with oligonucleotides complementary to the ENO1 gene (positions 1505-1524... ...
    Ref. link


  • Claudia Palena, Dmitry E. Polev, Kwong Y. Tsang, Romaine I. Fernando, Mary Litzinger, Larisa L. Krukovskaya, Ancha V. Baranova, Andrei P. Kozlov, and Jeffrey Schlom
    The Human T-Box Mesodermal Transcription Factor Brachyury Is a Candidate Target for T-Cell–Mediated Cancer Immunotherapy
    Clin. Cancer Res., Apr 2007; 13: 2471 - 2478.
    ... ...Commercially available tumor tissue-derived cDNAs, prepared from different individuals with different tumor types, were obtained from BioChain Institute Inc. (Hayward, CA). Total RNA from human cancer cell lines and normal CD19+ isolated B cells were prepared by using... ...
    Ref. link


  • Jaime Kim, Karla A. Temple, Sara A. Jones, Kimberly N. Meredith, Juliana L. Basko, and Matthew J. Brady
    Differential Modulation of 3T3-L1 Adipogenesis Mediated by 11-Hydroxysteroid Dehydrogenase-1 Levels
    J. Biol. Chem., Apr 2007; 282: 11038 - 11046.
    ... ...ACT TAC AAA CAT. Replicate PCRs (final volume, 50 mul) were run using 2.5 ng of murine hepatic or adipocytic cDNA library (Biochain Institute Inc., Hayward, CA), 100 pmol of each primer, and 400 mum dNTPs in 60 mm Tris, pH 9.0, 15 mm ammonium sulfate, 2 mm... ...
    Ref. link


  • Nattachet Plengvidhya, Suwattnee Kooptiwut, Napat Songtawee, Asako Doi, Hiroto Furata, Masahiro Nishi, Kishio Nanjo, Wiwit Tantibhedhyangkul, Watip Boonyasrisawat, Pa-thai Yenchitsomanus, Alessandro Doria, and Napatawn Banchuin
    PAX4 Mutations in Thais with Maturity-Onset Diabetes of the Young
    J. Clin. Endocrinol. Metab., Apr 2007; 10.1210/jc.2006-1927.
    ... ...Pax4 variant Full-length human wild-type PAX4 cDNA was amplified from PCR Ready First Strand cDNA of normal human placenta (BioChain Institute, Inc., Singapore) by PCR using platinum Pfx DNA polymerase (Invitrogen, Leek, Netherlands) and subcloned into a pcDNA... ...
    Ref. link


  • Craig S. McLachlan, Melissa L. Chen, Clare N. Lynex, Denise L. M. Goh, Sydney Brenner, and Stacey K. H. Tay
    Changes in PDE4D Isoforms in the Hippocampus of a Patient With Advanced Alzheimer Disease
    Arch Neurol, Mar 2007; 64: 456 - 457.
    ... ...hippocampus by profiling PDE4D expression in the healthy adult and AD hippocampus. Methods Commercial complementary DNA (cDNA) (BioChain Institute, Hayward, Calif) was obtained for 3 normal adult human hippocampal samples and from a patient diagnosed with advanced... ...
    Ref. link


  • Jaime Kim, Karla A. Temple, Sara A. Jones, Kimberly N. Meredith, Juliana L. Basko, and Matthew J. Brady
    Differential modulation of 3T3-L1 adipogenesis mediated by 11-hydroxysteroid dehydrogenase-1 levels
    J. Biol. Chem., Feb 2007; 10.1074/jbc.M606197200.
    ... ...TAC AAA CAT. Replicate PCR reactions (50 l final volume) were run using 2.5 ng of murine hepatic or adipocytic cDNA library (Biochain Institute Inc, Hayward, CA), 100 pmol of each primer and 400 M dNTPs in 60 mM Tris (pH 9.0)/15 mM ammonium sulfate/2 mM MgCl2... ...
    Ref. link


  • Noel R. Monks, Shuqian Liu, Yongsheng Xu, Hui Yu, Adam S. Bendelow, and Jeffrey A. Moscow
    Potent cytotoxicity of the phosphatase inhibitor microcystin LR and microcystin analogues in OATP1B1- and OATP1B3-expressing HeLa cells
    Mol. Cancer Ther., Feb 2007; 6: 587 - 598.
    ... ...obtained from the National Cancer Institute Cooperative Human Tissue Network (Columbus, OH). Normal liver cDNA was purchased from Biochain Institute, Inc. (Hayward, CA). Microcystins LR and YR were purchased from Sigma (St. Louis, MO). Microcystin LF, LW, RR, and... ...
    Ref. link


  • Eduardo R. Butelman, Marek Mandau, Kevin Tidgewell, Thomas E. Prisinzano, Vadim Yuferov, and Mary Jeanne Kreek
    Effects of Salvinorin A, a -Opioid Hallucinogen, on a Neuroendocrine Biomarker Assay in Nonhuman Primates with High -Receptor Homology to Humans
    J. Pharmacol. Exp. Ther., Jan 2007; 320: 300 - 306.
    ... ...OPRK1 ) cDNA. The coding region of the OPRK1 gene was obtained by PCR amplification of M. mulatta brain cDNA (obtained from BioChain, Hayward, CA) with the forward primer 5-TCCTCGCC TT CCTGCTGCA-3, located 30 nucleotides upstream of ATG codon, and the reverse... ...
    Ref. link


  • Glenn D. Rosen, Jilin Bai, Yu Wang, Christopher G. Fiondella, Steven W. Threlkeld, Joseph J. LoTurco, and Albert M. Galaburda
    Disruption of Neuronal Migration by RNAi of Dyx1c1 Results in Neocortical and Hippocampal Malformations
    Cereb Cortex, Jan 2007; 10.1093/cercor/bhl162.
    ... ...Dyx1c1 as described below. The cDNA prepared from frontal, parietal, and occipital lobes of human embryonic brain (20 weeks, Biochain Institute, Hayward, CA) was amplified with respective forward and reverse primers (GGG AGA AAT TCA GAA AAT ATA TTT AC and TTA... ...
    Ref. link


  • Eduardo R. Butelman, Marek Mandau, Kevin Tidgewell, Thomas E. Prisinzano, Vadim Yuferov, and Mary Jeanne Kreek
    Effects of Salvinorin A, a -Opioid Hallucinogen, on a Neuroendocrine Biomarker Assay in Nonhuman Primates with High -Receptor Homology to Humans
    J. Pharmacol. Exp. Ther., Jan 2007; 320: 300 - 306.
    ... ...OPRK1 ) cDNA. The coding region of the OPRK1 gene was obtained by PCR amplification of M. mulatta brain cDNA (obtained from BioChain, Hayward, CA) with the forward primer 5-TCCTCGCC TT CCTGCTGCA-3, located 30 nucleotides upstream of ATG codon, and the reverse... ...
    Ref. link


  • Yoshiyuki Mochida, Duenpim Parisuthiman, Masaru Kaku, Jun-ichi Hanai, Vikas P. Sukhatme, and Mitsuo Yamauchi
    Nephrocan, a Novel Member of the Small Leucine-rich Repeat Protein Family, Is an Inhibitor of Transforming Growth Factor- Signaling
    J. Biol. Chem., Nov 2006; 281: 36044 - 36051.
    ... ...In addition, we cloned and sequenced a dog ortholog of NPN (GenBank accession number; DQ233647) using the dog kidney cDNA (BioChain Institute, Inc., Hayward, CA), and we found that the dog ortholog possesses a gene structure similar to that of mouse. At this... ...
    Ref. link


  • Vincent Castronovo, David Waltregny, Philippe Kischel, Christoph Roesli, Giuliano Elia, Jascha-N. Rybak, and Dario Neri
    A Chemical Proteomics Approach for the Identification of Accessible Antigens Expressed in Human Kidney Cancer
    Mol. Cell. Proteomics, Nov 2006; 5: 2083 - 2091.
    ... ...clear cell carcinoma, granular cell carcinoma, transitional cell carcinoma, normal adult, and fetal kidney was purchased from BioChain (Hayward, CA). PCR was performed using the Hot Start Taq polymerase kit (Qiagen). PCR conditions were as follows: denaturation... ...
    Ref. link


  • Eduardo R. Butelman, Marek Mandau, Kevin Tidgewell, Thomas E. Prisinzano, Vadim Yuferov, and Mary Jeanne Kreek
    Effects of salvinorin A, a -opioid hallucinogen, on a neuroendocrine biomarker assay in non-human primates with high -receptor homology to humans
    J. Pharmacol. Exp. Ther., Oct 2006; 10.1124/jpet.106.112417.
    ... ...OPRK1) cDNA: The coding region of the OPRK1 gene was obtained by PCR amplification of Macaca mulatta brain cDNA (obtained from BioChain, Hayward, CA) with the a forward primer 5-TCCTCGCC TT CCTGCTGCA-3, located 30 nucleotides upstream of ATG codon, and a reverse... ...
    Ref. link


  • Kohsuke Kanekura, Ikuo Nishimoto, Sadakazu Aiso, and Masaaki Matsuoka
    Characterization of Amyotrophic Lateral Sclerosis-linked P56S Mutation of Vesicle-associated Membrane Protein-associated Protein B (VAPB/ALS8)
    J. Biol. Chem., Oct 2006; 281: 30223 - 30233.
    ... ...number NM_014231), and VAMP2 (GenBank accession number NM_014232) were amplified from a human postcentral gyrus cDNA library (Biochain, Hayward, CA) by PCR with a sense primer (5-CGGGATCCACCAATGGCGAAGGTGGAGCAGGTC-3) and an antisense primer (5-GGAATTCCTACAAGGCAATCTTCCCAATAATTAC-3... ...
    Ref. link


  • Oleg V. Kovalenko, Claudia Wiese, and David Schild
    RAD51AP2, a novel vertebrate- and meiotic-specific protein, shares a conserved RAD51-interacting C-terminal domain with RAD51AP1/PIR51
    Nucleic Acids Res., Oct 2006; 34: 5081 - 5092.
    ... ...transcripts are present in cDNA samples from 16 different adult human tissues (Clontech), 5 different fetal human tissues (BioChain) and 7 different human cell lines (Clontech). The PCR primers used for RAD51AP1 were AP1-5: 5GATGACAAGCTCTACCAGAGAGAC3 and... ...
    Ref. link


  • Yoshiyuki Mochida, Duenpim Parisuthiman, Masaru Kaku, Jun-ichi Hanai, Vikas P. Sukhatme, and Mitsuo Yamauchi
    Nephrocan, a novel member of the small leucine-rich repeat protein family, is an inhibitor of transforming growth factor-beta signaling
    J. Biol. Chem., Sep 2006; 10.1074/jbc.M604787200.
    ... ...In addition, we cloned and sequenced a dog ortholog of NPN (GenBankTM accession number; DQ233647) using the dog kidney cDNA (BioChain Institute, Inc., Hayward, CA), and we found that the dog ortholog possesses a similar gene structure to that of mouse. At this... ...
    Ref. link


  • Nawajes A. Mandal and Radha Ayyagari
    Complement Factor H: Spatial and Temporal Expression and Localization in the Eye
    Invest. Ophthalmol. Vis. Sci., Sep 2006; 47: 4091 - 4097.
    ... ...TRIzol. Human major organ cDNAs from brain, liver, lungs, heart, spleen, pancreas, kidney, muscle, and placenta were obtained (BioChain Institute Inc., Hayward, CA) and were used for expression studies. Human retina quick-clone cDNA (Clontech) was also used for... ...
    Ref. link


  • Ryu Takeya, Masahiko Taura, Tomoko Yamasaki, Seiji Naito, and Hideki Sumimoto
    Expression and function of Noxo1, an alternative splicing form of the NADPH oxidase organizer 1
    FEBS J., Aug 2006; 273: 3663 - 3677.
    ... ...cDNA panels and Human Fetal Neural Tissue cDNA panels (Biochain Institute, Hayward, CA, USA), according to the manufacturer's...analyzed by PCR using Human Fetal Neural Tissue cDNA panels (Biochain Institute). The PCR products were subjected to 10 polyacrylamide... ...
    Ref. link


  • Silviu Locovei, Li Bao, and Gerhard Dahl
    Pannexin 1 in erythrocytes: Function without a gap
    PNAS, May 2006; 103: 7655 - 7659.
    ... ...Data were normalized to the control condition (incubation in Krebs solution). Human bone marrow cDNA was obtained from BioChain Institute (Hayward, CA). For PCR amplification, the primers gaggtatctgaaagcaccacttcaagtaccc and gaccactgctcttaatattctccagtacc... ...

  • Ya Xu, Li Lu, Clifford Greyson, Mona Rizeq, Karin Nunley, Beata Wyatt, Michael R. Bristow, Carlin S. Long, and Gregory G. Schwartz
    The PPAR- activator fenofibrate fails to provide myocardial protection in ischemia and reperfusion in pigs
    Am J Physiol Heart Circ Physiol, May 2006; 290: H1798 - H1807.
    ... ...the porcine liver (CPT-Ia) and muscle (CPT-Ib) genes were amplified from normal pig heart and liver with PCR-ready cDNAs (BioChain, Hayward, CA) by using 20-mer primers complementary to bases 196-215 (forward) and 390-409 (reverse) for CPT-Ia and bases... ...
  • Akira Kawata, Junko Iida, Mitsunobu Ikeda, Yuji Sato, Hiroki Mori, Ai Kansaku, Kazutaka Sumita, Naoyuki Fujiwara, Chiaki Rokukawa, Mamiko Hamano, Susumu Hirabayashi, and Yutaka Hata
    CIN85 Is Localized at Synapses and Forms a Complex with S-SCAM via Dendrin
    J. Biochem. (Tokyo), May 2006; 139: 931 - 939.
    ... ...5-gcggccgcctctcactgc-ctcttcct-3 for dendrin; 5-gaattcgtggaggccatagtggagtt-3 and 5-gtcgactattttgattgtagagctttc-3 for CIN85) on human brain cDNA (BioChain Institute Inc.). pET32a vector was purchased from Takara Biotechnology. pClneoMyc, pBudCE2 and pBTM116KM vectors were described... ...

  • Morgan D. Fullerton, Laura Wagner, Zongfei Yuan, and Marica Bakovic
    Impaired trafficking of choline transporter-like protein-1 at plasma membrane and inhibition of choline transport in THP-1 monocyte-derived macrophages
    Am J Physiol Cell Physiol, Apr 2006; 290: C1230 - C1238.
    ... ...30 s at 72C, and a final extension for 10 min at 72C. The CHT1 mRNA in THP-1 cells was compared with human brain cDNA (BioChain) as a positive control using PCR conditions of 94C for 10 min, 40 cycles of 45 s at 94C, 45 s at 50C, and 45 s at 72C... ...

  • M. Petroziello, Maureen C. Ryan, Leia Smith, Ronald Simon, Guido Sauter, Ezogelin Oflazoglu, Svetlana O. Doronina, Damon L. Meyer, Joseph A. Francisco, Paul Carter, Peter D. Senter, John A. Copland, Christopher G. Wood, and Alan F. Wahl
    Lymphocyte Activation Antigen CD70 Expressed by Renal Cell Carcinoma Is a Potential Therapeutic Target for Anti-CD70 Antibody-Drug Conjugates
    Che-Leung Law, Kristine A. Gordon, Brian E. Toki, Andrew K. Yamane, Michelle A. Hering, Charles G. Cerveny, Joseph
    Cancer Res., Feb 2006; 66: 2328 - 2337.
    ... ...hamster ovary cells and purified by protein A chromatography. Human RCC tumor and normal kidney cDNA were purchased from BioChain Institute (Hayward, CA). Fresh frozen RCC tumors were obtained from Bio RESEARCH Support (Boca Raton, FL). Staged frozen... ...

  • Geoffrey W. Stone, Suzanne Barzee, Victoria Snarsky, Kristin Kee, Celsa A. Spina, Xiao-Fang Yu, and Richard S. Kornbluth
    Multimeric Soluble CD40 Ligand and GITR Ligand as Adjuvants for Human Immunodeficiency Virus DNA Vaccines
    J. Virol., Feb 2006; 80: 1762 - 1772.
    ... ...To construct the plasmid for a 2-trimer soluble form of murine CD40L (pAcrp30-CD40L), cDNA from mouse adipose tissue (BioChain Institute, Inc., Hayward, CA) was used to obtain a PCR product for the 5 untranslated region and 5 coding sequence of Acrp30... ...

  • Tapan K. Bera, Ashley Saint Fleur, Yoomi Lee, Andre Kydd, Yoonsoo Hahn, Nicholas C. Popescu, Drazen B. Zimonjic, Byungkook Lee, and Ira Pastan
    POTE Paralogs Are Induced and Differentially Expressed in Many Cancers
    Cancer Res., Jan 2006; 66: 52 - 56.
    ... ...PCR-ready cDNAs from breast and colon cancers were purchased from OriGene (Gaithersburg, MD) and BioChain Institute, Inc. (Hayward, CA), respectively. PCR was done on cDNA from different normal and cancer tissues following the... ...

  • Jutamas Ngampasutadol, Sanjay Ram, Anna M. Blom, Hanna Jarva, Ann E. Jerse, Egil Lien, Jon Goguen, Sunita Gulati, and Peter A. Rice
    From The Cover: Human C4b-binding protein selectively interacts with Neisseria gonorrhoeae and results in species-specific infection
    PNAS, Nov 2005; 102: 17142 - 17147.
    ... ...in ref. 18. Sequencing of Rhesus Macaque C4bp CCP1 and Sequence Alignment. Rhesus macaque liver cDNA was purchased from BioChain (Hayward, CA). CCP1 of rhesus C4bp was amplified by using primer pair 5-TCTTCCAAATGACCTTGATCGCTG-3 and 5-GGCTTGGTCTCCAAACGCCTATT-3... ...
  • Chi-Liang Eric Yen, Charles H. Brown, IV, Mara Monetti, and Robert V. Farese, Jr.
    A human skin multifunctional O-acyltransferase that catalyzes the synthesis of acylglycerols, waxes, and retinyl esters
    J. Lipid Res., Nov 2005; 46: 2388 - 2397.
    ... ...were selected with Primer Express software (Applied Biosystems, Foster City, CA). Human cDNAs of various tissues were from BioChain (Hayward, CA). Insect cell expression studies MFAT cDNAs [with and without an N-terminal FLAG epitope: MGDYKDDDDG... ...

  • Jonathan D Turner and Claude P Muller
    Structure of the glucocorticoid receptor (NR3C1) gene 5' untranslated region: identification, and tissue distribution of multiple new human exon 1
    J. Mol. Endocrinol., Oct 2005; 35: 283 - 292.
    ... ...CD19+ B cells and CD11c CD123+ (BDCA-4+) plasmacytoid dendritic cells. Hippocampal cDNA (dT16 primed) was obtained from BioChain (Gentaur, Brussels, Belgium). Isolation of mRNA, and reverse transcription Briefly, 106 purified cells or 10 mg of... ...

  • Maria E Mycielska, Christopher P Palmer, William J Brackenbury, and Mustafa B. A Djamgoz
    Expression of Na+-dependent citrate transport in a strongly metastatic human prostate cancer PC-3M cell line: regulation by voltage-gated Na+ channel activity
    J. Physiol., Mar 2005; 563: 393 - 408.
    ... Human liver and kidney cDNAs were obtained from Biochain (USA). ... 
    ... The quality of cDNAs was verified using primers to {beta}-actin (Biochain). ...

  • Kohsuke Kanekura, Yuichi Hashimoto, Yoshiko Kita, Jumpei Sasabe, Sadakazu Aiso, Ikuo Nishimoto, and Masaaki Matsuoka
    A Rac1/Phosphatidylinositol 3-Kinase/Akt3 Anti-apoptotic Pathway, Triggered by AlsinLF, the Product of the ALS2 Gene, Antagonizes Cu/Zn-superoxide Dismutase (SOD1) Mutant-induced Motoneuronal Cell Death
    Biol. Chem., Feb 2005; 280: 4532 - 4543.
    ... cDNA was PCR-amplified from cDNAs isolated from the frontal lobe of a human brain cerebrum (BioChain, Hayward, CA) with a sense primer (CGGGATCCATGGCTGCAATCCGAAAGAAGC) and an antisense primer (GGAATTCTCAGAGAATGGGACAGCCCC). ...
    ... A human RhoG cDNA was obtained from a human frontal lobe cDNA library (BioChain) by PCR with a sense primer (CGGGATCCATGCAGAGCATCAAGTGCGTG) and an antisense primer (GGAATTCTCACAAGAGGATGCAGGACC). cDNAs for RhoB, ...


  • Toshihiro Uchida, Hideo Wada, Minoru Mizutani, Miho Iwashita, Hiroaki Ishihara, Toshiro Shibano, Misako Suzuki, Yumiko Matsubara, Kenji Soejima, Masanori Matsumoto, Yoshihiro Fujimura, Yasuo Ikeda, and Mitsuru Murata
    Identification of novel mutations in ADAMTS13 in an adult patient with congenital thrombotic thrombocytopenic purpura
    Blood, May 2004; 10.1182/blood-2004-02-0715
    ... ADAMTS13 cDNA (GenBank accession number NM139025) was PCR-amplified from a human fetal liver cDNA library (BioChain Institute Inc.), and cloned into 6 pcDNA3.1/myc-His. ...

  • Kohsuke Kanekura, Yuichi Hashimoto, Takako Niikura, Sadakazu Aiso, Masaaki Matsuoka, and Ikuo Nishimoto
    Alsin, the Product of ALS2 Gene, Suppresses SOD1 Mutant Neurotoxicity through RhoGEF Domain by Interacting with SOD1 Mutants
    Biol. Chem., Apr 2004; 279: 19247 - 19256
    ... DNA Construction —Full-length alsin SF cDNA was obtained from human heart cDNA (BioChain) by PCR using a sense primer (ACTAGTACCATGGACCAAAGAAGAGAAGCTC) and an antisense primer (GCGGCCGCGCTACCAAGCCTTACCCCTTTTAAAG). ...
    ... EcoRI site to the NheI site of alsin LF, was obtained from human thalamus cDNA (BioChain) by PCR using a sense primer (GCTTCCATAGTGGAGCAGTGACAGAC) and an antisense primer (GCGGCCGCCTCAATGAGGCTCCATGCTGACC). ...

  • Kou Miyazaki, Tomoyuki Fujita, Toshinori Ozaki, Chiaki Kato, Yuka Kurose, Maya Sakamoto, Shinsuke Kato, Takeshi Goto, Yasuto Itoyama, Masashi Aoki, and Akira Nakagawara
    NEDL1, a Novel Ubiquitin-protein Isopeptide Ligase for Dishevelled-1, Targets Mutant Superoxide Dismutase-1
    J. Biol. Chem., Mar 2004; 279: 11327 - 11335. 
    ... For reverse transcription (RT)-PCR analysis, cDNA derived from adult human neural system (BioChain Institute, Hayward, CA) was subjected to PCR amplification using the following primers: NEDL1 , 5′-CCGATTTGAGATCACTTCCTCC-3′ ...


  • Susumu Hirabayashi, Makiko Tajima, Ikuko Yao, Wataru Nishimura, Hiroki Mori, and Yutaka Hata
    JAM4, a Junctional Cell Adhesion Molecule Interacting with a Tight Junction Protein, MAGI-1
    Mol. Cell. Biol., Jun 2003; 23: 4267 - 4282. ... of mouse JAM1 and mouse JAM4, respectively, were obtained by PCR on mouse lung cDNA (BioChain, Inc.) and kidney cDNA (Clontech). pGex4T-1 and pFLAG-CMV-1 were purchased from Amersham Pharmacia Biotech and ...

  • Maurice Phil DeYoung, Matthew Tress, and Ramaswamy Narayanan
    Identification of Down's syndrome critical locus gene SIM2-s as a drug therapy target for solid tumors
    PNAS, Apr 2003; 100: 4760 - 4765. 
    ... Normal and fetal-tissue cDNAs were from CLONTECH and the Biochain Institute (San Leandro, CA).

  • Thanh H. Vu, Nguyen V. Chuyen, Tao Li, and Andrew R. Hoffman
    Loss of Imprinting of IGF2 Sense and Antisense Transcripts in Wilms' Tumor
    Cancer Res., Apr 2003; 63: 1900 - 1905. 
    ... cDNAs from poly(A + ) RNA were also obtained from Clontech (Palo Alto, CA) and Biochain (San Leandro, CA). ...

  • Hideto Jinno, Toshiko Tanaka-Kagawa, Nobumitsu Hanioka, Mayumi Saeki, Seiichi Ishida, Tetsuji Nishimura, Masanori Ando, Yoshiro Saito, Shogo Ozawa, and Jun-ichi Sawada
    Glucuronidation of 7-Ethyl-10-hydroxycamptothecin (SN-38), an Active Metabolite of Irinotecan (CPT-11), by Human UGT1A1 Variants, G71R, P229Q, and Y486D
    Drug Metab. Dispos., Jan 2003; 31: 108 - 113. 
    ...Human adult normal liver cDNA was purchased from BioChain Institute Inc. ...

  • Tatsuya Sawasaki, Tomio Ogasawara, Ryo Morishita, and Yaeta Endo
    A cell-free protein synthesis system for high-throughput proteomics
    PNAS, Nov 2002; 99: 14652 - 14657. 
    ... These genes were cloned from tissue (heart, brain, kidney, liver, placenta) cDNAs (BioChain Institute, #0516001).

  • Minori Kono, Hidetaka Nagata, Sinobu Umemura, Seiji Kawana, and R. Yoshiyuki Osamura
    In situ expression of corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) genes in human skin
    FASEB J, Aug 2001; 102541. 
    ... (pituitary gland and thalamus cDNA from BioChain...)

Total RNA:

  • Scott J. Diede, Jamie Guenthoer, Linda N. Geng, Sarah E. Mahoney, Michael Marotta, James M. Olson, Hisashi Tanaka, and Stephen J. Tapscott
    DNA methylation of developmental genes in pediatric medulloblastomas identified by denaturation analysis of methylation differences
    PNAS, Dec 2009; 10.1073/pnas.0907606106.
    ... ...manufacturer's pro- tocol (Invitrogen) and quantitated using a NanoDrop spec- trophotometer. Normal cerebellum RNA was obtained from Biochain. First-strand cDNA synthesis was performed using random hexamers on 1 g of total RNA as input, using the Su- perScript III... ...
    Ref. link


  • Jacob Glanville, Wenwu Zhai, Jan Berka, Dilduz Telman, Gabriella Huerta, Gautam R. Mehta, Irene Ni, Li Mei, Purnima D. Sundar, Giles M. R. Day, David Cox, Arvind Rajpal, and Jaume Pons
    Precise determination of the diversity of a combinatorial antibody library gives insight into the human immunoglobulin repertoire
    PNAS, Dec 2009; 106: 20216 - 20221.
    ... ...Total RNA and/or mRNA were obtained from 637 healthy human peripheral blood leukocyte donors (BioChain Institute and Clontech) and 17 human spleens (BioChain Institute, Clontech, and OriGene). First strand cDNA was synthesized by using human heavy... ...
    Ref. link


  • Aurélie Ernst, Stefanie Hofmann, Rezvan Ahmadi, Natalia Becker, Andrey Korshunov, Felix Engel, Christian Hartmann, Jörg Felsberg, Michael Sabel, Heike Peterziel, Moritz Durchdewald, Jochen Hess, Sebastian Barbus, Benito Campos, Anna Starzinski-Powitz, Andreas Unterberg, Guido Reifenberger, Peter Lichter, Christel Herold-Mende, and Bernhard Radlwimmer
    Genomic and Expression Profiling of Glioblastoma Stem Cell–Like Spheroid Cultures Identifies Novel Tumor-Relevant Genes Associated with Survival
    Clin. Cancer Res., Nov 2009; 15: 6541 - 6550.
    ... ...candidate genes in tumors, a reference of total RNA obtained from nonneoplastic human brain tissue samples of five individuals (BioChain) was used. Total RNA was treated with DNaseI (Invitrogen) and reverse-transcribed with SuperscriptII (Invitrogen). Each cDNA... ...
    Ref. link


  • Bin Ye, Stacie L. Kroboth, Jie-Lin Pu, Jason J. Sims, Nitin T. Aggarwal, Elizabeth M. McNally, Jonathan C. Makielski, and Nian-Qing Shi
    Molecular Identification and Functional Characterization of a Mitochondrial Sulfonylurea Receptor 2 Splice Variant Generated by Intraexonic Splicing
    Circ. Res., Nov 2009; 105: 1083 - 1093.
    ... ...performed using a mouse or human heart FirstChoice RACE-Ready cDNA library (Amnion, Austin, Tex). Human LV RNA was obtained from Biochain (Hayward, Calif). Mouse heart RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, Calif). RT-PCRs were carried... ...
    Ref. link


  • Dilini Ranatunga, Christian M. Hedrich, Fengying Wang, Daniel W. McVicar, Nathan Nowak, Trupti Joshi, Lionel Feigenbaum, Lindsay R. Grant, Simona Stäger, and Jay H. Bream
    A human IL10 BAC transgene reveals tissue-specific control of IL-10 expression and alters disease outcome
    PNAS, Oct 2009; 106: 17123 - 17128.
    ... ...a first strand cDNA synthesis kit (Invitrogen). Total human RNA isolated from tissues of healthy donors was purchased from BioChain Institute, Inc. Quantitative PCR was performed using Taqman site-specific primers and probes (Applied Biosystems) on an ABI... ...
    Ref. link


  • Dimitrios Iliopoulos, Christos Polytarchou, Maria Hatziapostolou, Filippos Kottakis, Ioanna G. Maroulakou, Kevin Struhl, and Philip N. Tsichlis
    MicroRNAs Differentially Regulated by Akt Isoforms Control EMT and Stem Cell Renewal in Cancer Cells
    Sci. Signal., Oct 2009; 2: ra62.
    ... ...Human breast cancer samples RNAs from eight primary tumors and their corresponding metastatic tumors were purchased from Biochain Inc. These samples were used for real-time RT-PCR for E-cadherin, miR-200a, miR-200b, Akt1, and Akt2. Glyceraldehyde-3-phosphate... ...
    Ref. link


  • Sivan Osenberg, Dan Dominissini, Gideon Rechavi, and Eli Eisenberg
    Widespread cleavage of A-to-I hyperediting substrates
    RNA, Sep 2009; 15: 1632 - 1639.
    ... ...Experimental materials and methods Human adult hippocampus total RNA and genomic DNA from the same subject were purchased from Biochain. For RT-PCR, each RNA sample was treated with DNase I (Invitrogen) and reverse transcribed using M-MLV RT and random hexamers... ...
    Ref. link


  • Masayuki Kuraoka, Dongmei Liao, Kaiyong Yang, Sallie D. Allgood, Marc C. Levesque, Garnett Kelsoe, and Yoshihiro Ueda
    Activation-Induced Cytidine Deaminase Expression and Activity in the Absence of Germinal Centers: Insights into Hyper-IgM Syndrome
    J. Immunol., Sep 2009; 183: 3237 - 3248.
    .... ...populations, subcloned Ramos cells, and AMuLV transformants. Total RNA libraries of human adult tonsil (Biochain) and fetal liver (Biochain/Stratagene) were purchased; cDNA from mouse and human tissues was prepared by standard methods (12, 50... ...
    Ref. link


  • Celia M. Santi, Alice Butler, Julia Kuhn, Aguan Wei, and Lawrence Salkoff
    Bovine and Mouse SLO3 K+ Channels: EVOLUTIONARY DIVERGENCE POINTS TO AN RCK1 REGION OF CRITICAL FUNCTION
    J. Biol. Chem., Aug 2009; 284: 21589 - 21598.
    ... ...MATERIALS AND METHODS Cloning bSLO3 was cloned by reverse transcription-PCR of bovine testes total RNA (obtained from Biochain). First strand cDNA was made using Powerscript reverse transcriptase (Clontech) and random hexamers. Specific primers were... ...
    Ref. link


  • David Monk, Philippe Arnaud, Jennifer Frost, Frank A. Hills, Philip Stanier, Robert Feil, and Gudrun E. Moore
    Reciprocal imprinting of human GRB10 in placental trophoblast and brain: evolutionary conservation of reversed allelic expression
    Hum. Mol. Genet., Aug 2009; 18: 3066 - 3074.
    ... ...of the GRB10 isoforms arising from each promoter, we used custom-made fetal northern blots containing 2 microg poly A+ RNA (Biochain). PCR products containing the first exon associated with each promoter region (UN1-D86962; UN1A-NM_001001555; UN2-AJ271366... ...
    Ref. link


  • Yukimasa Takeda, Xiaohui Liu, Miho Sumiyoshi, Ayami Matsushima, Miki Shimohigashi, and Yasuyuki Shimohigashi
    Placenta Expressing the Greatest Quantity of Bisphenol A Receptor ERR{gamma} among the Human Reproductive Tissues: Predominant Expression of Type-1 ERR{gamma} Isoform
    J. Biochem., Jul 2009; 146: 113 - 122.
    ... ...prostate and testis) were purchased from Clontech, Stratagene and Biochain (Hayward, CA, USA). Each total RNA sample (1 mug) was reverse-transcribed...tissues were purchased from Clontech (C), Stratagene (S) and BioChain (B). b M and F represent male and female, respectively... ...
    Ref. link


  • Jin Billy Li, Erez Y. Levanon, Jung-Ki Yoon, John Aach, Bin Xie, Emily LeProust, Kun Zhang, Yuan Gao, and George M. Church
    Genome-Wide Identification of Human RNA Editing Sites by Parallel DNA Capturing and Sequencing
    Science, May 2009; 324: 1210 - 1213.
    ... ...References 30 We thank R. Emeson, M. P. Ball, and F. Isaacs for critical reading of the manuscript; P. Wang and Z. Liu (BioChain Institute) for helping collect human samples; M. Higuchi and P. Seeburg for providing ADAR2 / mouse brain cDNA; Harvard Biopolymers... ...
    Ref. link


  • Dimitrios Iliopoulos, Eirini I. Bimpaki, Maria Nesterova, and Constantine A. Stratakis
    MicroRNA Signature of Primary Pigmented Nodular Adrenocortical Disease: Clinical Correlations and Regulation of Wnt Signaling
    Cancer Res., Apr 2009; 69: 3278 - 3282.
    ... ...Four normal adrenal samples were used as controls; three of them were commercially available RNA adrenal samples (Ambion, Biochain) and a single normal adrenal tissue sample obtained from a cadaver through the National Development and Research Institutes... ...
    Ref. link


  • Wei Li, Dimitry M. Danilenko, Stuart Bunting, Rajkumar Ganesan, Susan Sa, Ronald Ferrando, Thomas D. Wu, Ganesh A. Kolumam, Wenjun Ouyang, and Daniel Kirchhofer
    The Serine Protease Marapsin Is Expressed in Stratified Squamous Epithelia and Is Up-regulated in the Hyperproliferative Epidermis of Psoriasis and Regenerating Wounds
    J. Biol. Chem., Jan 2009; 284: 218 - 228.
    ... ...system. EXPERIMENTAL PROCEDURES Reagents-Total RNA from human pancreas was purchased from different suppliers (Clontech, BioChain, Stratagene, Ambion, U. S. Biologicals, and Chemicon). Human and mouse total RNA adult tissue panels were purchased from Clontech... ...
    Ref. link


  • Willemijn M. Gommans, Nicholas E. Tatalias, Christina P. Sie, Dylan Dupuis, Nicholas Vendetti, Lauren Smith, Rikhi Kaushal, and Stefan Maas
    Screening of human SNP database identifies recoding sites of A-to-I RNA editing
    RNA, Oct 2008; 14: 2074 - 2085.
    ... ...RNA editing analysis For experimental validation, human brain total RNA and gDNA isolated from the same specimen (Biochain) were used and processed using standard protocols for reverse transcription and PCR (see Supplemental Table S1 for primer sequences... ...
    Ref. link


  • Atsushi Yonezawa, Satohiro Masuda, Toshiya Katsura, and Ken-ichi Inui
    Identification and functional characterization of a novel human and rat riboflavin transporter, RFT1
    Am J Physiol Cell Physiol, Sep 2008; 295: C632 - C641.
    ... ...thymus, small intestine, stomach, and liver) obtained from BioChain (Hayward, CA), rat tissues (brain, heart, lung, liver...intestine, spleen, kidney cortex, and kidney medulla) from BioChain, and cells (HEK-293 cells and Caco-2 cells) were reverse... ...
    Ref. link


  • Barbara Rosati, Min Dong, Lan Cheng, Shian-Ren Liou, Qinghong Yan, Ji Young Park, Elaine Shiang, Michael Sanguinetti, Hong-Sheng Wang, and David McKinnon
    Evolution of Ventricular Myocyte Electrophysiology
    Physiol Genomics, Sep 2008; 10.1152/physiolgenomics.00159.2007.
    ... ...was prepared using Qiagen RNeasy columns. Human RNA samples were obtained from independent commercial suppliers (Ambion or BioChain). Complementary DNAs were prepared as previously described (32). Three independent primer pairs for each gene were used for... ...
    Ref. link


  • Yoganand Balagurunathan, David L. Morse, Galen Hostetter, Vijayalakshmi Shanmugam, Phillip Stafford, Sonsoles Shack, John Pearson, Maria Trissal, Michael J. Demeure, Daniel D. Von Hoff, Victor J. Hruby, Robert J. Gillies, and Haiyong Han
    Gene expression profiling-based identification of cell-surface targets for developing multimeric ligands in pancreatic cancer
    Mol. Cancer Ther., Sep 2008; 7: 3071 - 3080.
    ... ...the Molecular Profiling Institute. RNA samples for normal tissues representing 28 different organ sites were purchased from Biochain and Stratagene. Paraffin-embedded pancreatic tissues were obtained from the Biospecimen Repository Core of the Pancreatic Cancer... ...
    Ref. link


  • Thomas Landemaine, Amanda Jackson, Akeila Bellahc¨¨ne, Nadia Rucci, Soraya Sin, Berta Martin Abad, Angels Sierra, Alain Boudinet, Jean-Marc Guinebreti¨¨re, Enrico Ricevuto, Catherine Nogu¨¨s, Marianne Briffod, Ivan Bi¨¨che, Pascal Cherel, Teresa Garcia, Vincent Castronovo, Anna Teti, Rosette Lidereau, and Keltouma Driouch
    A Six-Gene Signature Predicting Breast Cancer Lung Metastasis
    Cancer Res., Aug 2008; 68: 6092 - 6099.
    ... ...IDIBELL), respectively. RNA pools from normal lung and normal liver (at least five samples in each cases) were purchased from Biochain and Invitrogen. A series of 72 primary breast tumors (CRH cohort) was specifically selected from patients with node-negative... ...
    Ref. link


  • Masayo Aoki, Tomohiro Terada, Moto Kajiwara, Ken Ogasawara, Iwao Ikai, Osamu Ogawa, Toshiya Katsura, and Ken-ichi Inui
    Kidney-specific expression of human organic cation transporter 2 (OCT2/SLC22A2) is regulated by DNA methylation
    Am J Physiol Renal Physiol, Jul 2008; 295: F165 - F170.
    ... ...consent. Quantification of OCT1, OCT2, and USF1 mRNA expression. Total RNA from various human tissues was purchased from BioChain (Hayward, CA). Reverse transcription of the total RNA (500 ng/20 ul reaction) and real-time PCR were carried out as described... ...
    Ref. link

  • Tao Zhang, Cathie D. Xiang, David Gale, Samantha Carreiro, Ellen Y. Wu, and Eric Y. Zhang
    Drug Transporter and Cytochrome P450 mRNA Expression in Human Ocular Barriers: Implications for Ocular Drug Disposition
    Am J Physiol Renal Physiol, Jul 2008; 295: F165 - F170.
    ... ...consent. Quantification of OCT1, OCT2, and USF1 mRNA expression. Total RNA from various human tissues was purchased from BioChain (Hayward, CA). Reverse transcription of the total RNA (500 ng/20 ul reaction) and real-time PCR were carried out as described... ...
    Ref. link


  • Elizabeth Y. Rula, Andre H. Lagrange, Michelle M. Jacobs, NingNing Hu, Robert L. Macdonald, and Ronald B. Emeson
    Developmental Modulation of GABAA Receptor Function by RNA Editing
    J. Neurosci., Jun 2008; 28: 6196 - 6201.
    ... ...RNA (Sprague Dawley) was isolated as previously described (Burns et al., 1997), and human whole-brain RNA was purchased from BioChain Institute. As described in supplemental Methods (available at www.jneurosci.org as supplemental material ), first-strand... ...
    Ref. link


  • Amara C. Siva, Martha A. Wild, Richard E. Kirkland, Mary Jean Nolan, Bing Lin, Toshiaki Maruyama, Ferda Yantiri-Wernimont, Shana Frederickson, Katherine S. Bowdish, and Hong Xin
    Targeting CUB Domain-Containing Protein 1 with a Monoclonal Antibody Inhibits Metastasis in a Prostate Cancer Model
    Cancer Res., May 2008; 68: 3759 - 3766.
    ... ...pyrimidine] was purchased from Calbiochem. RNA samples. Total RNA for the normal tissue panel was purchased from BD Biosciences and BioChain Institute, Inc. Total RNA from frozen sections of prostate cell lines and severe combined immunodeficient (SCID) xenografts... ...
    Ref. link


  • Christopher Wright, Donald Bergstrom, Hongyue Dai, Matthew Marton, Mark Morris, George Tokiwa, Yanqun Wang, and Thomas Fare
    Characterization of Globin RNA Interference in Gene Expression Profiling of Whole-Blood Samples
    Clin. Chem., Feb 2008; 54: 396 - 405.
    ... ...the abundance of the b-globin message. supplementation with human brain total rna We obtained human brain total RNA from BioChain (catalog no. R1234035-50, lot no. A703158) and added it to aliquots of peripheral blood total RNA at the following concentrations... ...
    Ref. link


  • Germán Gastón Leparc and Robi David Mitra
    A sensitive procedure to detect alternatively spliced mRNA in pooled-tissue samples
    Nucleic Acids Res., Dec 2007; 35: e146.
    ... ...11-day, 15-day and 17-day mouse embryo, were obtained from Biochain (Cat No. R4334566, R1334XI-10, R1334XV-10 and R1334XVII-10...pancreas, uterus and prostate total RNA samples were obtained from BioChain (Cat No. R1234218-50, R1234086-50, R1234086-50, R1234188-50... ...
    Ref. link


  • Hironobu Sato, Hiromu Suzuki, Minoru Toyota, Masanori Nojima, Reo Maruyama, Shigeru Sasaki, Hideyasu Takagi, Yohei Sogabe, Yasushi Sasaki, Masashi Idogawa, Tomoko Sonoda, Mitsuru Mori, Kohzoh Imai, Takashi Tokino, and Yasuhisa Shinomura
    Frequent epigenetic inactivation of DICKKOPF family genes in human gastrointestinal tumors
    Carcinogenesis, Dec 2007; 28: 2459 - 2466.
    ... ...treated with a DNA-free kit (Ambion, Austin, TX). Total RNA from normal colon mucosa from a healthy individual was purchased from BioChain (Hayward, CA). Reverse transcriptase-polymerase chain reaction Single-stranded cDNA was prepared using SuperScript III... ...
    Ref. link


  • Hirohide Yoshikawa, Kenichi Matsubara, Xiaoling Zhou, Shu Okamura, Takahiko Kubo, Yaeko Murase, Yuko Shikauchi, Manel Esteller, James G. Herman, Xin Wei Wang, and Curtis C. Harris
    WNT10B Functional Dualism: -Catenin/Tcf-dependent Growth Promotion or Independent Suppression with Deregulated Expression in Cancer
    Mol. Biol. Cell, Nov 2007; 18: 4292 - 4303.
    ... ...medium, supplemented with 10% fetal bovine serum. Normal DNA and RNA samples (liver, colon, and placenta) were purchased from Biochain Institute (Hayward, CA) and BD Biosciences (Palo Alto, CA). Primary HCC samples are as described previously (Yoshikawa et al... ...
    Ref. link


  • Nurit Paz, Erez Y. Levanon, Ninette Amariglio, Amy B. Heimberger, Zvi Ram, Shlomi Constantini, Zohar S. Barbash, Konstantin Adamsky, Michal Safran, Avi Hirschberg, Meir Krupsky, Issachar Ben-Dov, Simona Cazacu, Tom Mikkelsen, Chaya Brodie, Eli Eisenberg, and Gideon Rechavi
    Altered adenosine-to-inosine RNA editing in human cancer
    Genome Res., Nov 2007; 17: 1586 - 1595.
    ... ...Center, Tel Aviv Sourasky Medical Center, or Henry Ford Hospital (Detroit, MI), or were purchased (Stratagene, Clontech, and Biochain). Malignant and normal samples from oral cavity (six subjects) or lung (five subjects) were collected at the Chaim Sheba Medical... ...
    Ref. link


  • Yakun Chen, Yong Tang, Man-Tzu Wang, Su Zeng, and Daotai Nie
    EXPERIMENTAL THERAPEUTICS, MOLECULAR TARGETS, AND CHEMICAL BIOLOGY: Human Pregnane X Receptor and Resistance to Chemotherapy in Prostate Cancer
    Cancer Res., Nov 2007; 67: 10361 - 10367.
    ... ...of PXR or its target genes, CYP3A4 and MDR1, was evaluated by semiquantitative RT-PCR. A normal human colon tissue sample (BioChain Institute, Inc.) and a human liver cancer cell line, HepG2, were used in parallel to compare the transcript levels of PXR in... ...
    Ref. link


  • Emiko Hayashi, Yuriko Matsuzaki, Go Hasegawa, Tomonori Yaguchi, Sachiko Kurihara, Tomonobu Fujita, Toshiro Kageshita, Makoto Sano, and Yutaka Kawakami
    Identification of a Novel Cancer-Testis Antigen CRT2 Frequently Expressed in Various Cancers Using Representational Differential Analysis
    Clin. Cancer Res., Nov 2007; 13: 6267 - 6274.
    ... ...fetal brain, fetal thymus, thymus, and fetal liver were purchased from Clontech. Total RNA from esophagus was purchased from Biochain Institute, Inc. The malignant melanoma, esophageal cancer, gastric cancer, pancreatic ductal adenocarcinoma, colon cancer... ...
    Ref. link


  • Changming Fang, Jarrod Dean, and Jeffrey W. Smith
    A Novel Variant of Ileal Bile Acid Binding Protein Is Up-regulated through Nuclear Factor-B Activation in Colorectal Adenocarcinoma
    Cancer Res., Oct 2007; 67: 9039 - 9046.
    ... ...quantitative reverse transcription-PCR (RT-PCR) with RNA from normal human intestine and liver purchased from Invitrogen and from BioChain Institute, Inc. Expression of acidic ribosomal phosphoprotein P0 (ARPP0) was used as a control. The expression of IBABP-L... ...
    Ref. link


  • Osamu Seguchi, Seiji Takashima, Satoru Yamazaki, Masanori Asakura, Yoshihiro Asano, Yasunori Shintani, Masakatsu Wakeno, Tetsuo Minamino, Hiroya Kondo, Hidehiko Furukawa, Kenji Nakamaru, Asuka Naito, Tomoko Takahashi, Toshiaki Ohtsuka, Koichi Kawakami, Tadashi Isomura, Soichiro Kitamura, Hitonobu Tomoike, Naoki Mochizuki, and Masafumi Kitakaze
    A cardiac myosin light chain kinase regulates sarcomere assembly in the vertebrate heart
    J. Clin. Invest., Oct 2007; 117: 2812 - 2824.
    ... ...and ejection fraction (EF) was measured by echocardiography the day before the operation. Normal samples were purchased from Biochain Inc. Cardiac gene expression was determined using the HG-U95 Affymetrix GeneChip. All expression data were normalized by global... ...
    Ref. link


  • Noa Matarasso, Anat Bar-Shira, Uri Rozovski, Serena Rosner, and Avi Orr-Urtreger
    Functional Analysis of the Aurora Kinase A Ile31 Allelic Variant in Human Prostate
    Neoplasia. 2007 September; 9(9): 707?15.
    ... ...Twenty-eight RNA samples from donor prostate tissues classified as normal prostate were purchased: 27 samples from donors of Asian descent (BioChain Institute, Inc., Hayward, CA) and 1 sample from a donor of Caucasian descent (Ambion, Inc., Austin, TX).... ...
    Ref. link


  • Yi-Mei J. Lin, Shin-Chih Chao, Tsung-Ming Chen, Te-Jen Lai, Jia-Shing Chen, and H. Sunny Sun
    Association of Functional Polymorphisms of the Human Tryptophan Hydroxylase 2 Gene With Risk for Bipolar Disorder in Han Chinese
    Arch Gen Psychiatry, Sep 2007; 64: 1015 - 1024.
    ... ...on our Web site), respectively. Using Q-RT-PCR, 8 complementary DNA libraries made from various sections of the human brain (BioChain Institute, Hayward, California) were used to assay the relative messenger RNA (mRNA) expression level of the TPH1 and TPH2... ...
    Ref. link


  • Hirohide Yoshikawa, Kenichi Matsubara, Xiaoling Zhou, Shu Okamura, Takahiko Kubo, Yaeko Murase, Yuko Shikauchi, Manel Esteller, James G. Herman, Xin Wei Wang, and Curtis C. Harris
    WNT10B Functional Dualism: -Catenin/Tcf-dependent Growth Promotion or Independent Suppression with Deregulated Expression in Cancer
    Mol. Biol. Cell, Aug 2007; 10.1091/mbc.E06-10-0889.
    ... ...1640, supplemented with 10% fetal bovine serum. Normal DNA and RNA samples (liver, colon, and placenta) were purchased from Biochain Institute, Inc. (Hayward, CA) and BD Biosciences (Palo Alto, CA). Primary HCC samples are as described(Ye et al., 2003; Yoshikawa... ...
    Ref. link


  • Damian G Romero, Ming Yi Zhou, Licy L Yanes, Maria W Plonczynski, Tanganika R Washington, Celso E Gomez-Sanchez, and Elise P Gomez-Sanchez
    Regulators of G-protein signaling 4 in adrenal gland: localization, regulation, and role in aldosterone secretion
    J. Endocrinol., Aug 2007; 194: 429 - 440.
    ... ...generously provided Losartan. Human adrenal total RNA was obtained from several sources: hAd1 (59-year-old male donor) from BioChain Institute Inc. (Hayward, CA, USA), hAd2 (pooled from 61 male/female Caucasian donors, ages 15-61) from BD Biosciences (Mountain... ...
    Ref. link


  • Junichi Enokizono, Hiroyuki Kusuhara, and Yuichi Sugiyama
    Role of Breast Cancer Resistance Protein (Bcrp/Abcg2) in the Disposition of Phytoestrogens : the Importance of Bcrp in the Efflux Transport in the Blood-Brain and -Testis Barriers
    Mol. Pharmacol., Jul 2007; 10.1124/mol.107.034751.
    ... ...isolated from these tissues with using ISOGEN (Wako pure chemical industries). Total RNA of human epididymis was purchased from BioChain Institute (Hayward, CA). Total RNA from mouse and human epididymis was converted to cDNA using random primer and avian myeloblastosis... ...
    Ref. link


  • Debopriya Das, Tyson A. Clark, Anthony Schweitzer, Miki Yamamoto, Henry Marr, Josh Arribere, Simon Minovitsky, Alexander Poliakov, Inna Dubchak, John E. Blume, and John G. Conboy
    A correlation with exon expression approach to identify cis-regulatory elements for tissue-specific alternative splicing
    Nucleic Acids Res., Jul 2007; 35: 4845 - 4857.
    ... ...Total RNA from three biological replicates (three separate individuals) of 16 normal adult human tissues was purchased from BioChain (Hayward, CA, USA). Labeled target was generated from 200ng of total RNA and hybridized to a prototype version of the Affymetrix... ...
    Ref. link


  • Ayush Dagvadorj, Sean Collins, Jean-Baptiste Jomain, Junaid Abdulghani, James Karras, Tobias Zellweger, Hongzhen Li, Martti Nurmi, Kalle Alanen, Tuomas Mirtti, Tapio Visakorpi, Lukas Bubendorf, Vincent Goffin, and Marja T. Nevalainen
    Autocrine Prolactin Promotes Prostate Cancer Cell Growth via Janus Kinase-2-Signal Transducer and Activator of Transcription-5a/b Signaling Pathway
    Endocrinology, Jul 2007; 148: 3089 - 3101.
    ... ...Pit1). The size of the PCR product yielded by this primer pair was 440 bp. Human brain pituitary total RNA was purchased from BioChain Institute, Inc. (Hayward, CA) and was used as positive control. Luciferase reporter gene assay CWR22Rv cells were transfected... ...
    Ref. link


  • Evemie Dub? Peter T.K. Chan, Louis Hermo, and Daniel G. Cyr
    Gene Expression Profiling and Its Relevance to the Blood-Epididymal Barrier in the Human Epididymis
    Biol Reprod, Jun 2007; 76: 1034 - 1044.
    ... ...presence of transcripts for the different CLDN genes. Total RNA (500 ng) was obtained from two different individuals using Biochain (Hayward, CA) and reverse-transcribed using an oligo(dT)16 primer. Forward and reverse primers for the genes of interest were... ...
    Ref. link


  • Glenn S. Belinsky, Ann L. Parke, Qihong Huang, Kerry Blanchard, Supriya Jayadev, Raymond Stoll, Marti Rothe, Luke E. K. Achenie, Rishi R. Gupta, George Y. Wu, and Daniel W. Rosenberg
    The Contribution of Methotrexate Exposure and Host Factors on Transcriptional Variance in Human Liver
    Toxicol. Sci., Jun 2007; 97: 582 - 594.
    ... ...pathologists at JDH. Total RNA from normal human livers was obtained from Ambion (Austin, TX), Clontech (Mountain View, CA), and Biochain (Hayward, CA). The normal group of livers consisted of one female and nine males ranging in age from 24 to 70 years. Pathologic... ...
    Ref. link


  • Ayush Dagvadorj, Sean Collins, Jean-Baptiste Jomain, Junaid Abdulghani, James Karras, Tobias Zellweger, Hongzhen Li, Martti Nurmi, Kalle Alanen, Tuomas Mirtti, Tapio Visakorpi, Lukas Bubendorf, Vincent Goffin, and Marja T. Nevalainen
    Autocrine Prolactin Promotes Prostate Cancer Cell Growth via Jak2-Stat5a/b Signaling Pathway
    Endocrinology, Apr 2007; 10.1210/en.2006-1761.
    ... ...000306). The size of the PCR product yielded by this primer pair is 440 bp. Human brain pituitary total RNA was purchased from BioChain Institute, Inc. (Hayward, CA) and was used as positive control. Luciferase Reporter Gene Assay CWR22Rv cells were transfected... ...
    Ref. link


  • Evemie Dub? Peter T.K. Chan, Louis Hermo, and Daniel G. Cyr
    Gene Expression Profiling and Its Relevance to the Blood-Epididymal Barrier in the Human Epididymis
    Biol Reprod, Feb 2007; 10.1095/biolreprod.106.059246.
    ... ...the presence of transcripts for the different CLDN genes. Total RNA (500 ng) was obtained from two different individuals from Biochain (Hayward, CA, USA) and was reverse transcribed using an Oligo d(T)16 primer. Forward and reverse primers for the genes of interest... ...
    Ref. link


  • E. Kostova, C.H. Yeung, C.M. Luetjens, M. Brune, E. Nieschlag, and J. Gromoll
    Association of three isoforms of the meiotic BOULE gene with spermatogenic failure in infertile men
    Mol. Hum. Reprod., Feb 2007; 13: 85 - 93.
    ... ...diagnosis in the case of MA and SCO. RNA extraction, RT and quantitative PCR Commercially derived testis total RNA (BioChain, Hayward, CA, USA) from two healthy men was used as control to analyse the normal distribution of BOULE isoforms. Total RNA... ...
    Ref. link


  • Durocher F, Labrie Y, Soucy P, Sinilnikova O, Labuda D, Bessette P, Chiquette J, Laframboise R, Lépine J, Lespérance B, Ouellette G, Pichette R, Plante M, Tavtigian SV, Simard J.
    Mutation analysis and characterization of ATR sequence variants in breast cancer cases from high-risk French Canadian breast/ovarian cancer families
    BMC Cancer. 2006; 6: 230. published online before print September 29, 2006
    ... ...Total RNA samples from normal tissues were purchased directly either from Stratagene (breast and ovary) (La Jolla, CA, USA), BioChain Institute Inc. (leukocyte) (Hayward, CA, USA),... ...
    Ref. link


  • Damian G. Romero, Maria W. Plonczynski, Elise P. Gomez-Sanchez, Licy L. Yanes, and Celso E. Gomez-Sanchez
    RGS2 Is Regulated by Angiotensin II and Functions as a Negative Feedback of Aldosterone Production in H295R Human Adrenocortical Cells
    Endocrinology, Aug 2006; 147: 3889 - 3897.
    ... ...from Tocris (Ellisville, MO). Human adrenal total RNA was obtained from several sources: hAd1 (59-yr-old male donor) from BioChain Institute, Inc. (Hayward, CA)... ...
  • Tae-You Kim, Sheng Zhong, C. Robert Fields, Jeong Hoon Kim, and Keith D. Robertson
    Epigenomic Profiling Reveals Novel and Frequent Targets of Aberrant DNA Methylation-Mediated Silencing in Malignant Glioma
    Cancer Res., Aug 2006; 66: 7490 - 7501.
    ... ...chloroform extraction method (17). Two normal brain DNA and RNA samples from cancer-free individuals were purchased from BioChain (Hayward, CA)... ...
  • Satohiro Masuda, Tomohiro Terada, Atsushi Yonezawa, Yuko Tanihara, Koshiro Kishimoto, Toshiya Katsura, Osamu Ogawa, and Ken-ichi Inui
    Identification and Functional Characterization of a New Human Kidney–Specific H+/Organic Cation Antiporter, Kidney-Specific Multidrug and Toxin Extrusion 2
    J. Am. Soc. Nephrol., Aug 2006; 17: 2127 - 2135
    ... ...AB250364 and AB250701 , respectively. Real-Time PCR and RT-PCR Total RNA from various human tissues was purchased from BioChain (Hayward, CA). RT of the total RNA (500 ng/20 Ml reaction) and real-time PCR were carried out as described previously... ...

  • Vincent Castronovo, David Waltregny, Philippe Kischel, Christoph Roesli, Giuliano Elia, Jascha N. Rybak, and Dario Neri
    A chemical proteomic approach for the identification of accessible antigens expressed in human kidney cancer
    Mol. Cell. Proteomics, Jul 2006; 10.1074/mcp.M600164-MCP200.
    ... ...cell carcinoma, granular cell carcinoma, transitional cell carcinoma, normal adult and fetal kidney were purchased from BioChain (Hayward, CA, USA)... ...

  • Jae-Hyun Park, Meng-Lay Lin, Toshihiko Nishidate, Yusuke Nakamura, and Toyomasa Katagiri
    PDZ-Binding Kinase/T-LAK Cell-Originated Protein Kinase, a Putative Cancer/Testis Antigen with an Oncogenic Activity in Breast Cancer
    Cancer Res., Sep 2006; 66: 9186 - 9195.
    ... ...of mRNA isolated from normal adult human mammary gland (Biochain, Hayward, CA), lung, heart, liver, kidney, and bone marrow...tissue sections of heart, lung, liver, kidney, and testis (Biochain). Briefly, paraffin-embedded specimens were treated with... ...
    Ref. link


  • Døsen G, Tenstad E, Nygren MK, Stubberud H, Funderud S, Rian E.
    Wnt expression and canonical Wnt signaling in human bone marrow B lymphopoiesis
    BMC Immunol. 2006; 7: 13. published online before print June 29, 2006
    ... ...Total RNA from freshly isolated and sorted BM CD45+CD10+IgM- cells was isolated using Absolutely RNA?RT-PCR Mini-prep kit (Stratagene Europe, Amsterdam, Netherland) according to the manufacturer's instructions. RNA from human fetal brain was purchased from BioChain Institute, Inc., USA. ... ...
    Ref. link


  • Blow MJ, Grocock RJ, van Dongen S, Enright AJ, Dicks E, Futreal PA, Wooster R, Stratton MR.
    RNA editing of human microRNAs
    Genome Biol. 2006; 7(4): R27.
    ... ...For the initial screen of RNA editing in ten human tissues, total RNA and matching genomic DNA from the same tissue sample was obtained for human brain, heart, liver, lung, ovary, placenta, skeletal muscle, small intestine, spleen and testis from Biochain (Hayward, USA). ... ...
    Ref. link


  • Goldstein M, Meller I, Issakov J, Orr-Urtreger A.
    Novel Genes Implicated in Embryonal, Alveolar, and Pleomorphic Rhabdomyosarcoma: A Cytogenetic and Molecular Analysis of Primary Tumors
    Neoplasia. 2006 May; 8(5): 332-343.
    ... ...As normal controls, we purchased four different RNA samples that were extracted from normal adult skeletal muscles (Clontech BD Biosciences, Erembodegem, Belgium; Ambion, Inc., Austin, TX; BioChain Institute, Inc., Hayward, CA). ... ...
    Ref. link


  • Human Umbilical Cord Matrix Stem Cells: Preliminary Characterization and Effect of Transplantation in a Rodent Model of Parkinson’s Disease
    Mark L. Weiss, Satish Medicetty, Amber R. Bledsoe, Raja Shekar Rachakatla, Michael Choi, Shosh Merchav, Yongquan Luo, Mahendra S. Rao, Gopalrao Velagaleti, and Deryl Troyer
    Stem Cells, Mar 2006; 24: 781 - 792.
    ... ...positive human control RNA (liver, placenta, and muscle; BioChain, Hayward, CA, http://www.biochain.com ) was evaluated using RT-PCR to confirm or expand... ...

  • Wei Zhou, Zhilin Liu, Jianbo Wu, Jing-hua Liu, Salman M. Hyder, Eric Antoniou, and Dennis B. Lubahn
    Identification and Characterization of Two Novel Splicing Isoforms of Human Estrogen-Related Receptor ß
    J. Clin. Endocrinol. Metab., Feb 2006; 91: 569 - 579.
    ... ...A third placenta total RNA was purchased from BioChain Institute, Inc. (Hayward, CA). .. ...

  • Damian G. Romero, Gaston R. Vergara, Zheng Zhu, Gina S. Covington, Maria W. Plonczynski, Licy L. Yanes, Elise P. Gomez-Sanchez, and Celso E. Gomez-Sanchez
    Interleukin-8 Synthesis, Regulation, and Steroidogenic Role in H295R Human Adrenocortical Cells
    Endocrinology, Feb 2006; 147: 891 - 898.
    ... ...cortisol. Real time RT-PCR Human adrenal total RNA was obtained from several sources: hAd1 (59 yr old male donor) from BioChain Institute, Inc. (Hayward, CA),... ...

  • Helene Baribault, Jean Danao, Jamila Gupte, Li Yang, Banghua Sun, William Richards, and Hui Tian
    The G-Protein-Coupled Receptor GPR103 Regulates Bone Formation
    Mol. Cell. Biol., Jan 2006; 26: 709 - 717.
    ... ...visualized by autoradiography and light microscopy. Quantitative RT-PCR was performed on human total RNA from various tissues (BioChain or Clontech) using the Taqman Gold kit (Applied Biosystems) and primer and probe set 5-GGGCTTTCACAATGCTAG-3, 5-GGAAGTCATATTTGATCTC-3... ...
  • Stephen J. Elliman, Isaac Wu, and Daniel M. Kemp
    Adult Tissue-specific Expression of a Dppa3-derived Retrogene Represents a Postnatal Transcript of Pluripotent Cell Origin
    J. Biol. Chem., Jan 2006; 281: 16 - 19.
    ... ...integrity of each sample. Pancreas cDNA was obtained from BioChain, and RACE (rapid amplification of cDNA ends) cDNA was...thyroid gland, heart and adrenal gland were obtained from BioChain. Each reaction well contained 5 mul of forward primer... ...

  • Bekpen C, Hunn JP, Rohde C, Parvanova I, Guethlein L, Dunn DM, Glowalla E, Leptin M, Howard JC.
    The interferon-inducible p47 (IRG) GTPases in vertebrates: loss of the cell autonomous resistance mechanism in the human lineage
    Genome Biol. 2005; 6(11): R92.
    ... ...Poly(A) RNA was isolated from total RNA using the Oligotex mRNA kit (QIAGEN). Total RNA from human tissues was purchased from Biochain (Hayward, CA, USA).... ...
    Ref. link


  • Renate Parry, Doug Schneider, Debra Hudson, Debbie Parkes, Jian-Ai Xuan, Alicia Newton, Pam Toy, Rick Lin, Rick Harkins, Bruno Alicke, Sandra Biroc, Peter J. Kretschmer, Meredith Halks-Miller, Helmut Klocker, Ying Zhu, Brent Larsen, Ronald R. Cobb, Peter Bringmann, Georg Roth, Jason S. Lewis, Harald Dinter, and Gordon Parry
    Identification of a Novel Prostate Tumor Target, Mindin/RG-1, for Antibody-Based Radiotherapy of Prostate Cancer
    Cancer Res., Sep 2005; 65: 8397 - 8405.
    ... ...Tumor tissue total RNA was purchased from BioChain (Hayward, CA). A real-time quantitative reverse transcription-PCR assay was developed to measure mindin/RG-1 using specific... ...

  • John Backus, Todd Laughlin, Yixin Wang, Robert Belly, Robert White, Jon Baden, C. Justus Min, Ann Mannie, Lorraine Tafra, David Atkins, and Kathryn M. Verbanac
    Identification and Characterization of Optimal Gene Expression Markers for Detection of Breast Cancer Metastasis
    Mol. Diagn., Aug 2005; 7: 327 - 336.
    ... ...medullary). Twenty-four tissue RNA samples from lung, colon, rectum, and ovary (6 normal and 18 cancerous; procured from BioChain, Inc.) were used as tissue specificity samples, along with a white blood cell (WBC) total RNA pool derived from 24 female... ...

  • Tatiana Ort, Anibal A. Arjona, John R. MacDougall, Pam J. Nelson, Mark E. Rothenberg, Frank Wu, Andrew Eisen, and Yuan-Di C. Halvorsen
    Recombinant Human FIZZ3/Resistin Stimulates Lipolysis in Cultured Human Adipocytes, Mouse Adipose Explants, and Normal Mice
    Endocrinology, May 2005; 146: 2200 - 2209.
    ... ...real-time quantitative PCR (RTQ-PCR). Total RNA from various human tissues was acquired from Stratagene (La Jolla, CA) and BioChain Institute (Hayward, CA). All tissue samples were received from certified hospitals with informed consent from donors or... ...

  • Xiao-Yan Zhao, Doug Schneider, Sandra L. Biroc, Renate Parry, Bruno Alicke, Pamela Toy, Jian-Ai Xuan, Choitsu Sakamoto, Ken Wada, Michael Schulze, Beate Müller-Tiemann, Gordon Parry, and Harald Dinter
    Targeting Tomoregulin for Radioimmunotherapy of Prostate Cancer
    Cancer Res., Apr 2005; 65: 2846 - 2853.
    ... ...tumor tissues were purified from clinical samples, and normal human tissue RNA was purchased from a commercial vendor (BioChain, Hayward, CA). Solid bars, normal prostate (N. prostate), benign prostatic hyperplasia (BPH Prostate), and prostate tumor... ...

  • Thomas A. Hughes and Hugh J. M. Brady
    Expression of axin2 Is Regulated by the Alternative 5'-Untranslated Regions of Its mRNA
    J. Biol. Chem., Mar 2005; 280: 8581 - 8588.
    .... RNA and protein that had been purified simultaneously from single tissue samples was purchased from BioChain (AMS Biotechnology). cDNA samples were subjected to semi-quantitative PCR using RedTaq (Sigma) and the following ...

  • Guenther Boden, Carol Homko, Maria Mozzoli, Louise C. Showe, Calen Nichols, and Peter Cheung
    Thiazolidinediones Upregulate Fatty Acid Uptake and Oxidation in Adipose Tissue of Diabetic Patients
    Diabetes, Mar 2005; 54: 880 - 885.
    ... Control RNAs were human adult adipose tissue RNA and skeletal muscle RNA (purchased from BioChain, Haywood, CA). ...

  • Erez Y. Levanon, Martina Hallegger, Yaron Kinar, Ronen Shemesh, Kristina Djinovic-Carugo, Gideon Rechavi, Michael F. Jantsch, and Eli Eisenberg
    Evolutionarily conserved human targets of adenosine to inosine RNA editing
    Nucleic Acids Res., Feb 2005; 33: 1162 - 1168.
    ... RNA and genomic DNA (gDNA) isolated simultaneously from the same tissue sample were purchased from Biochain Institute (Hayward, CA). ...


  • Mingjun Liu, Yubin Ge, Diane C. Cabelof, Amro Aboukameel, Ahmad R. Heydari, Ramzi Mohammad, and Larry H. Matherly
    Structure and Regulation of the Murine Reduced Folate Carrier Gene: IDENTIFICATION OF FOUR NONCODING EXONS AND PROMOTERS AND REGULATION BY DIETARY FOLATES

    Biol. Chem., Feb 2005; 280: 5588 - 5597.

    ... Total RNA from mouse small intestine was purchased from BioChain Institute, Inc. ...

  • Tatiana Ort, Anibal A. Arjona, John R. MacDougall, Pam J. Nelson, Mark E. Rothenberg, Frank Wu, Andrew Eisen, and Yuan-Di C. Halvorsen
    Recombinant Human FIZZ3/Resistin Stimulates Lipolysis in Cultured Human Adipocytes, Mouse Adipose Explants and in Normal Mice

    Endocrinology, Feb 2005; 10.1210/en.2004-1421.
    ... Total RNA from various human tissues was acquired from Stratagene (La Jolla, CA) and BioChain Institute (Hayward, CA). ...

  • Vladimir P. Grinevich, Sharon R. Letchworth, Kari A. Lindenberger, Jean Menager, Veronique Mary, Khalima A. Sadieva, Lori M. Buhlman, Georg Andrees Bohme, Laurent Pradier, Jesus Benavides, Ronald J. Lukas, and Merouane Bencherif
    Heterologous Expression of Human {alpha}6{beta}4{beta}3{alpha}5 Nicotinic Acetylcholine Receptors: Binding Properties Consistent with Their Natural Expression Require Quaternary Subunit Assembly Including the {alpha}5 Subunit

    Pharmacol. Exp. Ther., Feb 2005; 312: 619 - 626.

    ... for total brain and cortex was obtained from BD Biosciences Clontech (Palo Alto, CA) and Biochain (Hayward, CA), respectively. ...

  • Omer Barad, Eti Meiri, Amir Avniel, Ranit Aharonov, Adi Barzilai, Isaac Bentwich, Uri Einav, Shlomit Gilad, Patrick Hurban, Yael Karov, Edward K. Lobenhofer, Eilon Sharon, Yoel M. Shiboleth, Marat Shtutman, Zvi Bentwich, and Paz Einat
    MicroRNA expression detected by oligonucleotide microarrays: System establishment and expression profiling in human tissues

    Genome Res., Dec 2004; 14: 2486 - 2494.
    ... brain RNA from Ambion, whereas Sempere et al. ( 2004 ) obtained it from the Biochain Institute. ...

  • Ken-ichiro Okada, Tetsuo Minamino, Yoshitane Tsukamoto, Yulin Liao, Osamu Tsukamoto, Seiji Takashima, Akio Hirata, Masashi Fujita, Yoko Nagamachi, Takeshi Nakatani, Chikao Yutani, Kentaro Ozawa, Satoshi Ogawa, Hitonobu Tomoike, Masatsugu Hori, and Masafumi Kitakaze
    Prolonged Endoplasmic Reticulum Stress in Hypertrophic and Failing Heart After Aortic Constriction: Possible Contribution of Endoplasmic Reticulum Stress to Cardiac Myocyte Apoptosis
    Circulation, Aug 2004; 110: 705 - 712.
    ... As the normal controls, we used total human heart RNA purchased from BD Bioscience and BioChain. ...

    ... Lanes 1 and 2 show normal human heart specimens obtained from Clontech and BioChain, respectively. ...

  • Begovich AB, Carlton VE, Honigberg LA, Schrodi SJ, Chokkalingam AP, Alexander HC, Ardlie KG, Huang Q, Smith AM, Spoerke JM, Conn MT, Chang M, Chang SY, Saiki RK, Catanese JJ, Leong DU, Garcia VE, McAllister LB, Jeffery DA, Lee AT, Batliwalla F, Remmers E, Criswell LA, Seldin MF, Kastner DL, Amos CI, Sninsky JJ, Gregersen PK.
    A Missense Single-Nucleotide Polymorphism in a Gene Encoding a Protein Tyrosine Phosphatase (PTPN22) Is Associated with Rheumatoid Arthritis
    Am J Hum Genet. 2004 Aug; 75(2): 330-337.
    ... ...Tissues: Adipose BioChain -2.21 ... ...
    ... ...Tissues: Esophagus BioChain -3.61 ... ...
    ... ...Tissues: Breast BioChain -1.98 ... ...
    ... ...Tissues: Heart (pericardium) BioChain -1.56 ... ...
    ... ...Tissues: Pancreas BioChain -3.34 ... ...
    ... ...Tissues: Stomach BioChain -2.16 ... ...
    ... ...Tissues: Umbilical cord (fetal) BioChain -1.37 ... ...
    Ref. link


  • Olsen CL, Hsu PP, Glienke J, Rubanyi GM, Brooks AR.
    Hedgehog-interacting protein is highly expressed in endothelial cells but down-regulated during angiogenesis and in several human tumors
    BMC Cancer. 2004; 4: 43. published online before print August 4, 2004
    ... ...we measured HIP mRNA levels in a variety of tumor samples. Tumor and corresponding normal tissue RNA samples (normal and tumor tissues were from different individuals) were obtained from two different commercial sources (Ambion and BioChain), and the endothelial cell marker vWF was used to normalize HIP expression to the number of endothelial cells present in the tumors. ... ...
    Ref. link


  • Rotem Sorek, Ronen Shemesh, Yuval Cohen, Ortal Basechess, Gil Ast, and Ron Shamir
    A Non-EST-Based Method for Exon-Skipping Prediction
    Genome Res., Aug 2004; 14: 1617 - 1623.
    ... from the following human tissue samples: (1) Brain pool, a pool of brain-derived RNA samples (Biochain ?Normal); (2) Prostate pool, a pool of prostate-derived RNA samples (Biochain ?Normal); (3) ...
    ... Testis pool, a pool of testis-derived RNA samples (Biochain ?Normal); (4) Kidney pool, a pool of kidney-derived RNA samples (Biochain ? Normal); (5) ...

  • Sherif F. Nagueh, Gopi Shah, Yiming Wu, Guillermo Torre-Amione, Nicholas M.P. King, Sunshine Lahmers, Christian C. Witt, Katy Becker, Siegfried Labeit, and Henk L. Granzier
    Altered Titin Expression, Myocardial Stiffness, and Left Ventricular Function in Patients With Dilated Cardiomyopathy
    Circulation, Jul 2004; 110: 155 - 162.
    ... myocardium (obtained from 6 males, aged 21 to 74 years, mean 37+-9 years; Ambion and Biochain Institute Inc). ...

  • Hideto Jinno, Toshiko Tanaka-Kagawa, Nobumitsu Hanioka, Seiich Ishida, Mayumi Saeki, Akiko Soyama, Masaya Itoda, Tetsuji Nishimura, Yoshiro Saito, Shogo Ozawa, Masanori Ando, and Jun-ichi Sawada
    Identification of Novel Alternative Splice Variants of Human Constitutive Androstane Receptor and Characterization of Their Expression in the Liver
    Mol. Pharmacol., Mar 2004; 65: 496 - 502.
    ... Human liver total RNA (of male subjects aged 24?4) was obtained from Biochain (Hayward, CA). ... 


  • Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, Ambros V.
    Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation
    Genome Biol. 2004; 5(3): R13. published online before print February 16, 2004
    ... ...Frozen dissected organs from six-week-old C57BL/6 mice were a gift from Nathan Watson (Norris Cotton Cancer Center at Dartmouth-Hitchcock Medical Center). Total RNA was extracted from pooled organs of two to four mice or from cell lines with Trizol Reagent following the vendor's recommendations. Total RNA, 5 or 10 µg, was routinely loaded onto 12% urea-polyacrylamide gels as described in [50]. Total RNA from human organs was acquired from the Biochain Institute. Membranes were stripped by boiling in 0.1% SDS and re-hybridized up to five times without observing decreases in quality ... ...
    Ref. link


  • Winkler DG, Sutherland MK, Geoghegan JC, Yu C, Hayes T, Skonier JE, Shpektor D, Jonas M, Kovacevich BR, Staehling-Hampton K, Appleby M, Brunkow ME, Latham JA.
    Osteocyte control of bone formation via sclerostin, a novel BMP antagonist
    EMBO J. 2003 Dec 1; 22(23): 6267-6276.
    ... ...hMSCs cultured in growth (undifferentiated hMSCs) or osteogenic (hMSCs to osteoblasts) medium were harvested 21 days after plating and RNA isolated for RT–PCR analyses of SOST, COL1A1, PPAR?2, PTHR1, COLIXA1 and COLXA1. SOST expression was also determined in RNA prepared from abdominal adipose tissue (Biochain Institute, Hayward, CA), cartilage tissue from femoral growth plates (Biochain Institute), primary cultures of human osteoblasts . ... ...
    Ref. link


  • Bijay S. Jaiswal and Marco Conti
    Calcium regulation of the soluble adenylyl cyclase expressed in mammalian spermatozoa
    PNAS, Sep 2003; 100: 10676 - 10681.
    ... Human total testis RNA was obtained from Clontech and Biochain Institute (Hayward, CA). ...

  • Dirk Usener, Dirk Schadendorf, Joachim Koch, Stefan Dübel, and Stefan Eichmüller
    cTAGE: A Cutaneous T Cell Lymphoma Associated Antigen Family with Tumor-Specific Splicing
    J. Invest. Dermatol., Jul 2003; 121: 198 - 206.
    ... tissues: bone marrow, brain, colon, placenta, prostate, spleen, skeletal muscle, small intestine, trachea, stomach, testis; BioChain Institute, Hayward, CA, and Becton Dickinson Clontech). ...

  • Noriko Okazaki, Naomi Takahashi, Shin-ichi Kojima, Yasuhiko Masuho, and Hisashi Koga
    Protocadherin LKC, a new candidate for a tumor suppressor of colon and liver cancers, its association with contact inhibition of cell proliferation
    Carcinogenesis, Jul 2002; 23: 1139 - 1148. 
    ... The total RNA-Human Normal Colon was purchased from BioChain Institute (Hayward, CA). ...

  • David R. Dorris, Ramesh Ramakrishnan, Dionisios Trakas, Frank Dudzik, Richard Belval, Connie Zhao, Allen Nguyen, Marc Domanus, and Abhijit Mazumder
    A Highly Reproducible, Linear, and Automated Sample Preparation Method for DNA Microarrays
    Genome Res., Jun 2002; 12: 976 - 984. 
    ... Preparation Total RNA was purchased for all tissues and the Burkitt's lymphoma cell lines (Ambion; BioChain; Clontech), or prepared from the hepatocarcinoma cell line HepG2 using the TriZOL method (Invitrogen). ...

  • Zhi-Bin Tong, Carolyn A. Bondy, Jian Zhou, and Lawrence M. Nelson
    A human homologue of mouse Mater, a maternal effect gene essential for early embryonic development
    Hum. Reprod., Apr 2002; 17: 903 - 911. 
    ... Ovarian RNA from a 26 year old woman was purchased from BioChain Inc. ...

  • Jian Jin, Xuehui Chen, Yan Zhou, Mark Bartlam, Qing Guo, Yiwei Liu, Yixin Sun, Yu Gao, Sheng Ye, Guangtao Li, Zihe Rao, Boqin Qiang, and Jiangang Yuan
    Crystal structure of the catalytic domain of a human thioredoxin-like protein: Implications for substrate specificity and a novel regulation mechanism
    Eur. J. Biochem., Apr 2002; 269: 2060 - 2068.
    ... DDRT-PCR and full-length cDNA isolation Total RNA (2.5 µg) from 13- and 33-week-old human fetal cerebrum (Biochain) was reverse transcribed by Superscript II (Gibco-BRL) using a single-base anchored 3′ primer (5′-AAGCTTTTTTTTTTTN-3′, N=C, G, ...
    ... Northern blot analysis Total Poly(A) + RNA from 13- and 33-week-old human fetal cerebrum (Biochain) was electrophoresed in a 1% agarose gel containing 0.66 M formaldehyde and was blotted onto a ...


  • Ramesh Ramakrishnan, David Dorris, Anna Lublinsky, Allen Nguyen, Marc Domanus, Anna Prokhorova, Linn Gieser, Edward Touma, Randall Lockner, Murthy Tata, Xiaomei Zhu, Marcus Patterson, Richard Shippy, Timothy J. Sendera, and Abhijit Mazumder
    An assessment of Motorola CodeLinkTM microarray performance for gene expression profiling applications
    Nucleic Acids Res., Apr 2002; 30: 30.
    ... MATERIALS AND METHODS Target preparation Five micrograms of total RNA (BioChain, Hayward, CA) were added to a reaction mix in a final volume of 12 µl, ...
    ... compared within three human poly(A)+ RNA samples (heart lot#A403084, brain lot#A311144 and kidney lot#A404013 from BioChain) using the Motorola CodeLink(TM) UniSet Human 1 expression bioarrays and the ABI TaqMan (R) products. ...

  • Antonio Riccio, Cesar Mattei, Rosemary E. Kelsell, Andrew D. Medhurst, Andrew R. Calver, Andrew D. Randall, John B. Davis, Christopher D. Benham, and Menelas N. Pangalos
    Cloning and Functional Expression of Human Short TRP7, a Candidate Protein for Store-operated Ca2+ Influx
    J. Biol. Chem., Mar 2002; 277: 12302 - 12309. 
    ... David Netherland's Brain Bank, Amsterdam) or purchased as prepared RNA from Biochain (San Leandro, CA) and CLONTECH.

  • Sridhar Ramaswamy, Pablo Tamayo, Ryan Rifkin, Sayan Mukherjee, Chen-Hsiang Yeang, Michael Angelo, Christine Ladd, Michael Reich, Eva Latulippe, Jill P. Mesirov, Tomaso Poggio, William Gerald, Massimo Loda, Eric S. Lander, and Todd R. Golub
    Multiclass cancer diagnosis using tumor gene expression signatures
    PNAS, Dec 2001; 98: 15149 - 15154. 
    ... Normal tissue RNA (Biochain, Hayward, CA) was from snap-frozen autopsy specimens collected through the International Tissue Collection Network.

  • Mariana Nacht, Tatiana Dracheva, Yuhong Gao, Takeshi Fujii, Yidong Chen, Audrey Player, Viatcheslav Akmaev, Brian Cook, Michael Dufault, Mindy Zhang, Wen Zhang, MingZhou Guo, John Curran, Sean Han, David Sidransky, Kenneth Buetow, Stephen L. Madden, and Jin Jen
    Molecular characteristics of non-small cell lung cancer
    PNAS, Dec 2001; 98: 15203 - 15208.
    ... Tumor RNA samples used for quantitative PCR and GeneChip analyses were either purchased from BioChain (Hayward, CA) or obtained in the same manner as samples used for SAGE ( ). ...

  • Makiko Iguchi, Setsuya Aiba, Yumiko Yoshino, and Hachiro Tagami
    Human Follicular Papilla Cells Carry Out Nonadipose Tissue Production of Leptin
    J. Invest. Dermatol., Dec 2001; 117: 1349 - 1356. 
    ... We also used RNA from human cutaneous adipose tissue (BioChain Institute, Hayward, CA) as a control

  • John E. DeHaven, Katherine A. Robinson, Bryce A. Nelson, and Maria G. Buse
    A Novel Variant of Glutamine: Fructose-6-Phosphate Amidotransferase-1 (GFAT1) mRNA Is Selectively Expressed in Striated Muscle
    Diabetes, Nov 2001; 50: 2419 - 2424. (cat. no. 061015) and human whole brain total RNA (cat. no. 061002) was obtained from Biochain Institute (Hayward, CA). ...

  • Feng Wang-Johanning, Andra R. Frost, Gary L. Johanning, M. B. Khazaeli, Albert F. LoBuglio, Denise R. Shaw, and Theresa V. Strong
    Expression of Human Endogenous Retrovirus K Envelope Transcripts in Human Breast Cancer
    Clin. Cancer Res., Jun 2001; 7: 1553 - 1560. 
    ... and RNA from breast cancer tissues (invasive ductal carcinoma) was purchased from BioChain Institute, Inc. ...

  • Huibin Yue, P. Scott Eastman, Bruce B. Wang, James Minor, Michael H. Doctolero, Rachel L. Nuttall, Robert Stack, John W. Becker, Julie R. Montgomery, Marina Vainer, and Rick Johnston
    An evaluation of the performance of cDNA microarrays for detecting changes in global mRNA expression
    Nucleic Acids Res., Apr 2001; 29: 41.
    ... Oligotex resin (Qiagen, Valencia, CA) from commercially available human placenta, brain and heart total RNA (Biochain, San Leandro, CA). ...
    ... done in the presence of 200 ng poly(A) mRNA, from either human brain or heart (Biochain, Hayward, CA). ...

  • Yuan Zhu, David Michalovich, Hsiao-Ling Wu, K. B. Tan, George M. Dytko, Ishrat J. Mannan, Rogely Boyce, James Alston, Lauren A Tierney, Xiaotong Li, Nicole C. Herrity, Lisa Vawter, Henry M. Sarau, Robert S. Ames, Colleen M. Davenport, J. Paul Hieble, Shelagh Wilson, Derk J. Bergsma, and Laura R. Fitzgerald
    Cloning, Expression, and Pharmacological Characterization of a Novel Human Histamine Receptor
    Mol. Pharmacol., Mar 2001; 59: 434 - 441. 
    ... Ravid in Netherland's Brain Bank (Amsterdam, the Netherlands), or purchased as preprepared RNA from Biochain (San Leandro, CA), CLONTECH (Palo Alto, CA). ...

  • John B. Welsh, Patrick P. Zarrinkar, Lisa M. Sapinoso, Suzanne G. Kern, Cynthia A. Behling, Bradley J. Monk, David J. Lockhart, Robert A. Burger, and Garret M. Hampton
    Analysis of gene expression profiles in normal and neoplastic ovarian tissue samples identifies candidate molecular markers of epithelial ovarian cancer
    PNAS, Jan 2001; 98: 1176 - 1181.
    ... RNA from normal human ovarian tissue was purchased from BioChain Institute (Hayward, CA). ...
    ... Normal human ovary purchased from BioChain was not enriched for any specific cell type before RNA preparation, and, accordingly, we observed...

  • Kenneth R. Luehrsen, Scott Davidson, Yun Ji Lee, Riaz Rouhani, Ali Soleimani, Teresa Raich, Carol A. Cain, Ellen J. Collarini, Douglas T. Yamanishi, Jennifer Pearson, Kerry Magee, Mary Rose Madlansacay, Veeraiah Bodepudi, David Davoudzadeh, Paula A. Schueler, and Walt Mahoney
    High-density Hapten Labeling and HRP Conjugation of Oligonucleotides for Use as In Situ Hybridization Probes to Detect mRNA Targets in Cells and Tissues
    J. Histochem. Cytochem., Jan 2000; 48: 133 - 146. 
    ... Total RNA from human adult peripheral blood was purchased from Biochain Institute (San Leandro, CA). ...

  • Adrienne E. Dubin, Rene Huvar, Michael R. D'Andrea, Jayashree Pyati, Jessica Y. Zhu, K. C. Joy, Sandy J. Wilson, Jose E. Galindo, Charles A. Glass, Lin Luo, Michael R. Jackson, Timothy W. Lovenberg, and Mark G. Erlander
    The Pharmacological and Functional Characteristics of the Serotonin 5-HT3A Receptor Are Specifically Modified by a 5-HT3B Receptor Subunit
    J. Biol. Chem., Oct 1999; 274: 30799 - 30810. 
    ... Total RNA from normal human ascending and descending colon (CDP-061068; lot 8906066; CDP-061069; lot 8906067; BioChain Institute, Inc.) and 5 µg of each poly(A) RNA from normal human small intestine and ...

  • Bo Hu, Kien Trinh, William F. Figueira, and Paul A. Price
    Isolation and Sequence of a Novel Human Chondrocyte Protein Related to Mammalian Members of the Chitinase Protein Family
    J. Biol. Chem., Aug 1996; 271: 19415 - 19420. 
    ... total RNA from human heart, brain, kidney, liver, lung, pancreas, and spleen was purchased from BioChain Institute, Inc. ...

  • Ilgar Abbaszade, Rui-Qin Liu, Fude Yang, Stuart A. Rosenfeld, O. Harold Ross, John R. Link, Dawn M. Ellis, Micky D. Tortorella, Michael A. Pratta, Jeannine M. Hollis, Richard Wynn, Jodie L. Duke, Henry J. George, Milton C. Hillman, Jr., Kathleen Murphy, Barbara H. Wiswall, Robert A. Copeland, Carl P. Decicco, Robert Bruckner, Hideaki Nagase, Yoshifumi Itoh, Robert C. Newton, Ronald L. Magolda, James M. Trzaskos, Gregory F. Hollis, Elizabeth C. Arner, and Timothy C. Burn
    Cloning and Characterization of ADAMTS11, an Aggrecanase from the ADAMTS Family
    J. Biol. Chem., Aug 1999; 274: 23443 - 23450. 
    ... RNAs from normal and diseased tissues were obtained from a commercial vendor (Biochain Institute Inc., San Leandro, CA) with quality being assessed in ethidium bromide-stained agarose gels prior ...

RNA Array:

  • Kenneth D. Bromberg, Harriet M. Kluger, Agnes Delaunay, Sabiha Abbas, Kyle A. DiVito, Stan Krajewski, and Ze'ev Ronai
    Increased Expression of the E3 Ubiquitin Ligase RNF5 Is Associated with Decreased Survival in Breast Cancer
    Cancer Res., Sep 2007; 67: 8172 - 8179.
    ... ...and Methods Tumor tissue mRNA array. The BioChain Human Adult Tumor/Normal Tissues mRNA Array (BioChain Institute, Inc.) was used to analyze RNF5...overnight using FastHyb-Hybridization Solution (BioChain Institute) according to the manufacturers... ...
    Ref. link


  • James T. Trent, III and Mark S. Hargrove
    A Ubiquitously Expressed Human Hexacoordinate Hemoglobin
    J. Biol. Chem., May 2002; 277: 19538 - 19545.
    ... RNA Hybridization Assay A human adult normal tissue RNA Dot-Blot I (BioChain Institute) was screened using 32 P-labeled probes generated with random hexamer primers and HGb or ...

  • Hiroshi Sakamoto, Tetsuo Mashima, Shigeo Sato, Yuichi Hashimoto, Takao Yamori, and Takashi Tsuruo
    Selective Activation of Apoptosis Program by S-p-bromobenzylglutathione Cyclopentyl Diester in Glyoxalase I-overexpressing Human Lung Cancer Cells
    Clin. Cancer Res., Aug 2001; 7: 2513 - 2518.
    ... Cytoplasmic protein from human normal tissue was purchased from BioChain Institute, Inc. ...
    ... normal tissues for GLO1 expressions using 48 Dot Human Tumor/Normal Tissue Total RNA Dot Blot (BioChain Institute, Inc.). ...

  • Joseph A. Hedrick, Allison Helms, Alain Vicari, and Albert Zlotnik
    Characterization of a Novel CC Chemokine, HCC-4, Whose Expression Is Increased by Interleukin-10
    Blood, Jun 1998; 91: 4242 - 4247. 
    ... Northern blot analysis of multiple tissue blots (Clonetech, Palo Alto, CA) and multiple tissue dot-blots (BioChain Institute, San Leandro, CA). ...

Northern Blots:

  • Sachie Nakamichi, Yoko Senga, Hiroshi Inoue, Aki Emi, Yasushi Matsuki, Eijiro Watanabe, Ryuji Hiramatsu, Wataru Ogawa, and Masato Kasuga
    Role of the E3 ubiquitin ligase gene related to anergy in lymphocytes in glucose and lipid metabolism in the liver
    J. Mol. Endocrinol., Feb 2009; 42: 161 - 169.
    ... ...analysis, a membrane loaded with 20mug total RNA extracted from various mouse organs (Mouse Tissue Total RNA Northern Blot; BioChain, Hayward, CA, USA) was probed with a 32P-labeled fragment of mouse GRAIL cDNA (nucleotides 138-482) isolated by PCR. For assay... ...
    Ref. link


  • Damien Carrel, Justine Masson, Sana Al Awabdh, Catherine Borg Capra, Zsolt Lenkei, Michel Hamon, Michel Boris Emerit, and Mich¨¨le Darmon
    Targeting of the 5-HT1A Serotonin Receptor to Neuronal Dendrites Is Mediated by Yif1B
    J. Neurosci., Aug 2008; 28: 8063 - 8073.
    ... ...interactions (Wojcik et al., 2002). Northern blot experiments. The mRNA Northern blot NBA (Normalized By Amount of RNA; BioChain Institute) was hybridized using [alpha-32P]dCTP (GE Healthcare) labeled probe made following the Rediprime II Random Prime... ...
    Ref. link


  • Ravinder K. Gill, Nitika Pant, Seema Saksena, Amika Singla, Talat M. Nazir, Lisa Vohwinkel, Jerrold R. Turner, Jay Goldstein, Waddah A. Alrefai, and Pradeep K. Dudeja
    Function, expression, and characterization of the serotonin transporter in the native human intestine
    Am J Physiol Gastrointest Liver Physiol, Jan 2008; 294: G254 - G262.
    ... ...colon were commercially obtained (from BioChain). Human SERT was amplified with gene...human multiple-tissue Northern blots (BioChain) each containing poly(A) RNA (3 ug/lane...human multiple-tissue Northern blots (BioChain) were probed with 32P-labeled 491-bp... ...
    Ref. link


  • Sumit Agarwal, Josephine Harada, Jeffrey Schreifels, Patrycja Lech, Bryan Nikolai, Tomoyuki Yamaguchi, Sumit K. Chanda, and Nikunj V. Somia
    Isolation, characterization, and genetic complementation of a cellular mutant resistant to retroviral infection
    PNAS, Oct 2006; 103: 15933 - 15938.
    ... ...Blot Analysis. Northern blot analysis was performed as described previously (3). A human RNA tissue blot was purchased from BioChain Institute (Hayward, CA). Cellular Localization. Immunocytochemistry was carried out essentially as described previously (3... ...
    Ref. link


  • D. Monk, R. Sanches, P. Arnaud, S. Apostolidou, F.A. Hills, S. Abu-Amero, A. Murrell, H. Friess, W. Reik, P. Stanier, M. Constância, and G.E. Moore
    Imprinting of IGF2 P0 transcript and novel alternatively spliced INS-IGF2 isoforms show differences between mouse and human
    Hum. Mol. Genet., Apr 2006; 15: 1259 - 1269.
    ... ...containing polyARNA (2microg per lane) was purchased from Ambion. Custom-made fetal northern blots were obtained from BioChain. The IGF2 RNA probes, which encompassed the P1-specific promoter region (130501-130800 of AC0130303), P0-specific promoter... ...

  • Sass JO, Mohr V, Olbrich H, Engelke U, Horvath J, Fliegauf M, Loges NT, Schweitzer-Krantz S, Moebus R, Weiler P, Kispert A, Superti-Furga A, Wevers RA, Omran H.
    Mutations in ACY1, the Gene Encoding Aminoacylase 1, Cause a Novel Inborn Error of Metabolism
    Am J Hum Genet. 2006 Mar; 78(3): 401-409.
    ... ...Tissue specificity of expression of the human ACY1 gene was analyzed by northern blot hybridization, by use of a 657-bp BsmI/ScaI fragment of the human cDNA (IMAGp958G107Q [RZPD Web site]) as a probe. Human multiple-tissue northern blots (BioChain Institute and BD Biosciences) were hybridized overnight at 63.5°C in Church buffer .... ...
    Ref. link


  • Ning Qin, Sui-Po Zhang, Tasha L. Reitz, Jay M. Mei, and Christopher M. Flores
    Cloning, Expression, and Functional Characterization of Human Cyclooxygenase-1 Splicing Variants: Evidence for Intron 1 Retention
    J. Pharmacol. Exp. Ther., Dec 2005; 315: 1298 - 1305.
    ... ...Different Types of Tumor mRNA blots were purchased from BioChain Institute, Inc. (Hayward, CA). Each blot was prehybridized...multiple tissue total protein blots were purchased from BioChain Institute, Inc. Blots were blocked with 5% dry milk in... ...

  • Sadaharu Masuyama, Satoshi Tateishi, Kentaro Yomogida, Yoshitake Nishimune, Keiichiro Suzuki, Yoshiyuki Sakuraba, Hirokazu Inoue, Michio Ogawa, and Masaru Yamaizumi
    Regulated expression and dynamic changes in subnuclear localization of mammalian Rad18 under normal and genotoxic conditions
    Genes Cells, Aug 2005; 10: 753 - 762.
    ... ...hybridized with 32P-labeled human RAD18 cDNA using Multiple Tissue Northern Blot (Clontech) and Total RNA Northern Blot (BioChain). Chinese hamster total RNA from various organs was hybridized with 32P-labeled mouse RAD18 cDNA. Northern blot analysis... ...

  • Olsen CL, Hsu PP, Glienke J, Rubanyi GM, Brooks AR.
    Mutations in the JARID1C Gene, Which Is Involved in Transcriptional Regulation and Chromatin Remodeling, Cause X-Linked Mental Retardation
    Am J Hum Genet. 2005 Feb; 76(2): 227-236.
    ... ...Total RNA was isolated from patient and control lymphoblastoid cell lines by use of TRIzol (Invitrogen), in accordance with the manufacturer's protocol. Poly-A+ RNAs, which were each obtained from 100 µg of total RNA by use of Dynabeads (Dynal), were separated in a formaldehyde-containing gel in 1 ?MOPS buffer, transferred to a Hybond N+ membrane, and crosslinked by UV. A human multiple-tissue northern blot was obtained from BioChain. ... ...
    Ref. link

  • C. van der Meer-van Kraaij, E. Kramer, D. Jonker-Termont, M.B. Katan, R. van der Meer, and J. Keijer
    Differential gene expression in rat colon by dietary heme and calcium
    Carcinogenesis, Jan 2005; 26: 73 - 79.
    ... Northern blot analysis Northern blot analysis was performed using pre-made
    rat tissue blots (BioChain, Clontech) with 2 or 3 {micro}g poly(A) + RNA, normalized by expression of the {beta}-actin ...

  • Sabine Meurer, Sylke Pioch, Kristina Wagner, Werner Müller-Esterl, and Steffen Gross
    AGAP1, a Novel Binding Partner of Nitric Oxide-sensitive Guanylyl Cyclase
    Biol. Chem., Nov 2004; 279: 49346 - 49354.

    ... from BD Biosciences, and mouse tissue NBA (normalized by amount of mRNA) blot came from BioChain (Hayward, CA). ...

  • Cynthia Shannon Weickert, Richard E. Straub, Benjamin W. McClintock, Mitsuyuki Matsumoto, Ryota Hashimoto, Thomas M. Hyde, Mary M. Herman, Daniel R. Weinberger, and Joel E. Kleinman
    Human Dysbindin (DTNBP1) Gene Expression in Normal Brain and in Schizophrenic Prefrontal Cortex and Midbrain
    Arch Gen Psychiatry, Jun 2004; 61: 544 - 555.
    ... N3234410; BioChain Institute Inc, Hayward, Calif), containing total RNA from adults (frontal lobe, temporal lobe, parietal lobe, ...

  • John F. Lockwood, Jingsong Cao, Paul Burn, and Yuguang Shi
    A Human Intestinal Monoacylglycerol Acyltransferase: Differential Features in Tissue Expression and Activity
    Am J Physiol Endocrinol Metab, Jun 2003; 10.1152/ajpendo.00179.2003.
    ... Biosciences Clontech, Palo Alto, CA and OriGene Technologies Inc., Rockville, MD) and total RNA blots (Biochain Institute, Inc., Hayward, CA) were hybridized with [ 32P]-dCTP (ICN Radiochemicals) labeled probes prepared from ...

  • Jingsong Cao, John Lockwood, Paul Burn, and Yuguang Shi
    Cloning and Functional Characterization of a Mouse Intestinal Acyl-CoA:Monoacylglycerol Acyltransferase, MGAT2
    J. Biol. Chem., Apr 2003; 278: 13860 - 1386
    ... (Rockville, MD) or BioChain Institute Inc. ...
    ... Mouse multiple tissue blots from Origene ( A ) and Biochain ( B ) containing 2 µg of poly(A) + RNA were hybridized with radiolabeled probes ...

  • Songzhu An, Gene Cutler, Jack Jiagang Zhao, Shu-Gui Huang, Hui Tian, Wanbo Li, Lingming Liang, Miki Rich, Amy Bakleh, Juan Du, Jin-Long Chen, and Kang Dai
    Identification and characterization of a melanin-concentrating hormone receptor
    PNAS, Jun 2001; 98: 7576 - 7581.
    ... The human brain RNA blots were purchased from the Biochain Institute. ...
    ... Each lane of the Biochain blots contains 20 µg of total RNA isolated from various regions of the human brain. ...

  • Makiko Meguro, Kohzoh Mitsuya, Nobuo Nomura, Masakazu Kohda, Akiko Kashiwagi, Ryuichi Nishigaki, Hirotaka Yoshioka, Mitsuyoshi Nakao, Michio Oishi, and Mitsuo Oshimura
    Large-scale evaluation of imprinting status in the Prader¨CWilli syndrome region: an imprinted direct repeat cluster resembling small nucleolar RNA genes
    Hum. Mol. Genet., Feb 2001; 10: 383 - 394. 
    ... with [{alpha}- 32 P]dCTP by random priming and hybridized to a Gene Hunter mRNA blot (BioChain). ...

  • Teresa L. Born, Dirk E. Smith, Kirsten E. Garka, Blair R. Renshaw, Jeanette S. Bertles, and John E. Sims
    Identification and Characterization of Two Members of a Novel Class of the Interleukin-1 Receptor (IL-1R) Family. DELINEATION OF A NEW CLASS OF IL-1R-RELATED PROTEINS BASED ON SIGNALING
    J. Biol. Chem., Sep 2000; 275: 29946 - 29954. ... Normal and cancer cell line human multiple tissue Northern blots were purchased from CLONTECH and Biochain Institute, Inc. ...
    ... Northern blots containing mRNA from the indicated tissues were purchased from CLONTECH Laboratories, Inc. or Biochain Institute, Inc. ...

  • Kimberly Kelly, Elizabeth Manos, Gregory Jensen, Lincoln Nadauld, and David A. Jones
    APRIL/TRDL-1, a Tumor Necrosis Factor-like Ligand, Stimulates Cell Death
    Cancer Res., Feb 2000; 60: 1021 - 1027. 
    ... A multiple tumor mRNA blot was obtained from Biochain Institute, Inc. ...

  • Henning Walczak, Mariapia A. Degli-Esposti, Richard S. Johnson, Pam J. Smolak, Jennifer Y. Waugh, Norman Boiani, Martin S. Timour, Mary J. Gerhart, Kenneth A. Schooley, Craig A. Smith, Raymond G. Goodwin, and Charles T. Rauch
    TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL
    EMBO J., Sep 1997; 16: 5386 - 5397. 
    ... library screen was added to two different human multiple-tissue Northern blots (Clontech, Palo Alto, CA; Biochain, Palo Alto, CA). ...

RNAmate:

  • David Claveau, Mirna Sirinyan, Jocelyne Guay, Robert Gordon, Chi-Chung Chan, Yves Bureau, Denis Riendeau, and Joseph A. Mancini
    Microsomal Prostaglandin E Synthase-1 Is a Major Terminal Synthase That Is Selectively Up-Regulated During Cyclooxygenase-2-Dependent Prostaglandin E2 Production in the Rat Adjuvant-Induced Arthritis Model
    J. Immunol., May 2003; 170: 4738 - 4744. ... After dissolving the RNA, an equal volume of RNAmate (BioChain Institute, Hayward, CA) was added to precipitate the RNA and eliminate potential polysaccharides and proteoglycan ...

  • David L. Gerhold, Franklin Liu, Guoqiang Jiang, Zhihua Li, Jian Xu, Meiqing Lu, Jeffrey R. Sachs, Ansuman Bagchi, Arthur Fridman, Daniel J. Holder, Thomas W. Doebber, Joel Berger, Alex Elbrecht, David E. Moller, and Bei B. Zhang
    Gene Expression Profile of Adipocyte Differentiation and Its Regulation by Peroxisome Proliferator-Activated Receptor- Agonists
    Endocrinology, Jun 2002; 143: 2106 - 2118. 
    ... Total RNA was reprecipitated using RNAmate (Biochain, San Leandro, CA), and mRNA was isolated using oligo(deoxythymidine)-decorated latex beads (QIAGEN, Hilden, Germany) according ...

  • DAVID GERHOLD, MEIQING LU, JIAN XU, CHRISTOPHER AUSTIN, C. THOMAS CASKEY, and THOMAS RUSHMORE
    Monitoring expression of genes involved in drug metabolism and toxicology using DNA microarrays
    Physiol Genomics, Apr 2001; 5: 161 - 170. 
    ... Total RNA was reprecipitated using RNAmate (Biochain, San Leandro, CA); mRNA was isolated using oligo-dT-decorated latex beads (Qiagen, Hilden, Germany) according to ...

Genomic DNA:

  • C.L. Galindo, L.J. McIver, J.F. McCormick, M.A. Skinner, Y. Xie, R.A. Gelhausen, K. Ng, N.M. Kumar, and H.R. Garner
    Global Microsatellite Content Distinguishes Humans, Primates, Animals, and Plants
    Mol. Biol. Evol., Dec 2009; 26: 2809 - 2819.
    ... ...genomic DNA was purchased from Coriell Cell Repositories (Camden, NJ), and Arabidopsis and corn genomic DNA was purchased from Biochain Institute, Inc. (Hayward, CA). Alaskan husky and Angus bull genomic DNA was graciously provided by John Fondon III (University... ...
    Ref. link


  • Kazumori Kawakami, Hiroshi Hirata, Soichiro Yamamura, Nobuyuki Kikuno, Sharanjot Saini, Shahana Majid, Yuichiro Tanaka, Ken Kawamoto, Hideki Enokida, Masayuki Nakagawa, and Rajvir Dahiya
    Functional Significance of Wnt Inhibitory Factor-1 Gene in Kidney Cancer
    Cancer Res., Nov 2009; 69: 8603 - 8610.
    ... ...EpiTect Bisulfite kit (Qiagen) following the manufacturer's directions. The genomic DNA from adult human normal kidney tissue (BioChain) was also modified and used as a control. Primers for bisulfite genomic sequencing PCR were designed by using the online program... ...
    Ref. link


  • Leah R Villegas, Theodore J Kottom, and Andrew H. Limper
    Characterization of PCEng2 a {beta}-1,3-Endoglucanase Homologue in Pneumocystis carinii with Activity in Cell Wall Regulation
    Am. J. Respir. Cell Mol. Biol., Sep 2009; 10.1165/rcmb.2009-0131OC.
    ... ...restriction enzyme (HindIII or EcoRI, Promega, Inc.) for 4 hours at 37°C. Genomic DNA (10µg) from normal rat lung tissue (BioChain) was also digested under the same conditions as controls. The digested genomic DNA was then electrophoresed through a 1% agarose... ...
    Ref. link


  • Huiqing Chen, Kyunghee Yang, Suyoung Choi, James H. Fischer, and Hyunyoung Jeong
    Up-Regulation of UDP-Glucuronosyltransferase (UGT) 1A4 by 17β-Estradiol: A Potential Mechanism of Increased Lamotrigine Elimination in Pregnancy
    Drug Metab. Dispos., Sep 2009; 37: 1841 - 1847.
    ... ...construct the pGL3-UGT1A4 plasmid, the upstream region of UGT1A4 (-2399 to +28) was PCR-amplified using human genomic DNA (Biochain, Hayward, CA) as the template and a pair of primers: forward and reverse primers of 5-TGCCTACCACAGACACTAAG-3 and 5-TCAGCAGAAGCCACCGAC-3... ...
    Ref. link


  • Sivan Osenberg, Dan Dominissini, Gideon Rechavi, and Eli Eisenberg
    Widespread cleavage of A-to-I hyperediting substrates
    RNA, Sep 2009; 15: 1632 - 1639.
    ... ...Experimental materials and methods Human adult hippocampus total RNA and genomic DNA from the same subject were purchased from Biochain. For RT-PCR, each RNA sample was treated with DNase I (Invitrogen) and reverse transcribed using M-MLV RT and random hexamers... ...
    Ref. link


  • Hui-Wen Lo, Hu Zhu, Xinyu Cao, Amy Aldrich, and Francis Ali-Osman
    A Novel Splice Variant of GLI1 That Promotes Glioblastoma Cell Migration and Invasion
    Cancer Res., Aug 2009; 10.1158/0008-5472.CAN-09-0886.
    ... ...purchased from Sigma unless otherwise stated. cDNAs of normal tissues and genomic DNAs from peripheral leukocytes were from BioChain. Human GBM cell lines were established in our laboratory from primary specimens (7), with the exception of U87MG, T98G, U373MG... ...
    Ref. link


  • Hehuang Xie, Min Wang, Maria de F. Bonaldo, Christina Smith, Veena Rajaram, Stewart Goldman, Tadanori Tomita, and Marcelo B. Soares
    High-throughput sequence-based epigenomic analysis of Alu repeats in human cerebellum
    Nucleic Acids Res., Jul 2009; 37: 4331 - 4340.
    ... ...those in the remainder Alu elements. DNA samples Human genomic DNA samples for fetal adrenal gland tissues were purchased (BioChain Inc., Hayward, CA). Human snap-frozen cerebellum and cortex tissues were obtained from the tissue bank of the Department of... ...
    Ref. link


  • Paul N. Kongkham, Paul A. Northcott, Young Shin Ra, Yukiko Nakahara, Todd G. Mainprize, Sidney E. Croul, Christian A. Smith, Michael D. Taylor, and James T. Rutka
    An Epigenetic Genome-Wide Screen Identifies SPINT2 as a Novel Tumor Suppressor Gene in Pediatric Medulloblastoma
    Cancer Res., Dec 2008; 68: 9945 - 9953.
    ... ...culture were purchased from Wisent, Inc. Normal human fetal and adult cerebellar genomic DNA and RNA samples were purchased from Biochain. 5-aza-dC treatment protocol, reverse transcription-PCR/quantitative real-time PCR, and affymetrix HG U133 plus 2.0 expression... ...
    Ref. link


  • Daniel Diaczok, Christopher Romero, Janice Zunich, Ian Marshall, and Sally Radovick
    A Novel Dominant Negative Mutation of OTX2 Associated with Combined Pituitary Hormone Deficiency
    J. Clin. Endocrinol. Metab., Nov 2008; 93: 4351 - 4359.
    ... ...informed consent and with appropriate institutional review board approval. Control DNA (n 50) was obtained from healthy adults (Biochain, Hayward, CA). Genomic DNA was prepared from peripheral blood using the DNeasy Tissue Kit (QIAGEN, Inc., Valencia, CA). DNA... ...
    Ref. link


  • Willemijn M. Gommans, Nicholas E. Tatalias, Christina P. Sie, Dylan Dupuis, Nicholas Vendetti, Lauren Smith, Rikhi Kaushal, and Stefan Maas
    Screening of human SNP database identifies recoding sites of A-to-I RNA editing
    RNA, Oct 2008; 14: 2074 - 2085.
    ... ...RNA editing analysis For experimental validation, human brain total RNA and gDNA isolated from the same specimen (Biochain) were used and processed using standard protocols for reverse transcription and PCR (see Supplemental Table S1 for primer sequences... ...
    Ref. link


  • Yi-Chun Liao, Yi-Ping Shih, and Su Hao Lo
    Mutations in the Focal Adhesion Targeting Region of Deleted in Liver Cancer-1 Attenuate Their Expression and Function
    Cancer Res., Oct 2008; 68: 7718 - 7722.
    ... ...Materials and Methods Mutation analysis. Prostate cDNA and colon genomic DNA samples were purchased from OriGene Technologies and BioChain, respectively. DNA fragments were amplified by PCR using DLC-1 primers 5-GGCAGCCTGCCCTCTCCCAAGGAA (forward) and 5-CAGGGCTGAGTCCGAATCTCCCTC-3... ...
    Ref. link


  • Maile Reed Brown, Jack Kronengold, Valeswara-Rao Gazula, Charalampos G. Spilianakis, Richard A. Flavell, Christian A. von Hehn, Arin Bhattacharjee, and Leonard K. Kaczmarek
    Amino-termini isoforms of the Slack K+ channel, regulated by alternative promoters, differentially modulate rhythmic firing and adaptation
    J. Physiol., Sep 2008; 10.1113/jphysiol.2008.160861. 
    ... ...amino-terminus (forward primer CCCATCTTCTTCCTTCCCTGAGCCGTC and reverse primer ATCCTGCGGGAGCGCTTGGCGC). Using PCR-ready rat genomic DNA (Biochain, Hayward CA, USA) and Pfu Turbo, 2 kb products were amplified and subcloned using the TA cloning kit (Invitrogen), and sequenced... ...
    Ref. link


  • Elizabeth E. Brittle, Fushan Wang, John M. Lubinski, Ralph M. Bunte, and Harvey M. Friedman
    A Replication-Competent, Neuronal Spread-Defective, Live Attenuated Herpes Simplex Virus Type 1 Vaccine
    J. Virol., Sep 2008; 82: 8431 - 8441.
    ... ...Applied Biosystems). Standard curves were derived using 5 to 107 copies of HSV-1 DNA and 5 to 105 copies of murine cellular DNA (Biochain, Hayward, CA). RT qPCR results were expressed as the HSV-1 DNA copy number per 5 105 copies of murine adipsin. Explant... ...
    Ref. link


  • Daniel Diaczok, Christopher Romero, Janice Zunich, Ian Marshall, and Sally Radovick
    A Novel Dominant Negative Mutation of OTX2 Associated with Combined Pituitary Hormone Deficiency
    J. Clin. Endocrinol. Metab., Aug 2008; 10.1210/jc.2008-1189.
    ... ...informed consent and with appropriate Institutional Review Board approval. Control DNA (n=50) was obtained from healthy adults (Biochain, Hayward, CA). Genomic DNA was prepared from peripheral blood using DNeasy Tissue Kit (QIAGEN, Valencia, CA). DNA from 19 patients... ...
    Ref. link
  • Jian Qin, Robert C. Jones, and Ramesh Ramakrishnan
    Studying copy number variations using a nanofluidic platform
    Nucleic Acids Res., Aug 2008; 10.1093/nar/gkn518.
    ... ...We used digital arrays to analyze the ERBB2 copy numbers of 40 breast cancer and 8 normal breast tissue DNA samples from BioChain (Hayward, CA). All DNA samples were from Asian individuals except one normal sample that was from a Caucasian. Of the 40 breast... ...
    Ref. link


  • Seonhoe Kim, Ui Jin Lee, Mi Na Kim, Eun-Ju Lee, Ji Young Kim, Mi Young Lee, Sorim Choung, Young Joo Kim, and Young-Chul Choi
    MicroRNA miR-199a* Regulates the MET Proto-oncogene and the Downstream Extracellular Signal-regulated Kinase 2 (ERK2)
    J. Biol. Chem., Jun 2008; 283: 18158 - 18166.
    ... ...cells using the DNA Wizard Genomic DNA Purification Kit (Promega). DNA from human normal and tumor tissues were obtained from Biochain (Hayward, CA). Prior to treatment with bisulfite, DNA was digested with NcoI (New England Biolabs, Ipswich, MA). The digested... ...
    Ref. link


  • Zheng Chen, Mireille Montcouquiol, Rene Calderon, Nancy A. Jenkins, Neal G. Copeland, Matthew W. Kelley, and Konrad Noben-Trauth
    Jxc1/Sobp, Encoding a Nuclear Zinc Finger Protein, Is Critical for Cochlear Growth, Cell Fate, and Patterning of the Organ of Corti
    J. Neurosci., Jun 2008; 28: 6633 - 6641.
    ... ...purchased from Clontech Laboratories. Rat and chicken genomic DNA was purchased from Seegene. Rhesus genomic DNA was obtained from BioChain Institute, Takifugu rubripes genomic DNA was obtained from Genservice, and Anopheles gambiae flies were obtained from American... ...
    Ref. link


  • Yih-Jyh Shann, Ching Cheng, Chun-Hui Chiao, Dow-Tien Chen, Pei-Hsin Li, and Ming-Ta Hsu
    Genome-wide mapping and characterization of hypomethylated sites in human tissues and breast cancer cell lines
    Genome Res., May 2008; 18: 791 - 801. 
    ... ...addition, samples of genomic DNA of human brain, breast, liver, testis, leukocytes, and breast tumor tissues, were purchased from BioChain. Preparation of RNA Cells were rinsed twice with 1 PBS. Total RNA was extracted according to the RNeasy Mini Kit Spin Protocol... ...
    Ref. link


  • Kaiko Kunii, Lenora Davis, Julie Gorenstein, Harold Hatch, Masakazu Yashiro, Alessandra Di Bacco, Cem Elbi, and Bart Lutterbach
    FGFR2-Amplified Gastric Cancer Cell Lines Require FGFR2 and Erbb3 Signaling for Growth and Survival
    Cancer Res., Apr 2008; 68: 2340 - 2348.
    ... ...s at 95C, and 1 min at 60C). Data were normalized to RNase P and then to the calibrator sample (normal stomach genomic DNA, BioChain Institute D1234248). Fluorescence in situ hybridization analysis. KatoIII gastric carcinoma cells were treated with colcemid... ...
    Ref. link


  • Mathias Ehrich, Julia Turner, Peter Gibbs, Lara Lipton, Mara Giovanneti, Charles Cantor, and Dirk van den Boom
    Cytosine methylation profiling of cancer cell lines
    PNAS, Mar 2008; 105: 4844 - 4849.
    ... ...D123062), breast (D1234086), colon (D1234090), kidney (D1234142), leukocyte (D1234148), and lung (D1234152) were obtained from BioChain. Clinical Colon Cancer Tissue. Tissue colorectal cancer and normal colon tissue samples were obtained from the Royal Melbourne... ...
    Ref. Link


  • Lingbao Ai, Wan-Ju Kim, Berna Demircan, Lisa M. Dyer, Kevin J. Bray, Ryan R. Skehan, Nicole A. Massoll, and Kevin D. Brown
    The transglutaminase 2 gene (TGM2), a potential molecular marker for chemotherapeutic drug sensitivity, is epigenetically silenced in breast cancer
    Carcinogenesis, Mar 2008; 29: 510 - 518.
    ... ...30 s; 60C (for M primer set) or 56C (for U primer set), 30 s] and final extension at 72C for 10 min. Human placental gDNA (Biochain Institute, Hayward, CA) either unmodified or methylated in vitro with SssI methylase (NEB, Ipswich, MA) was used as validation... ...  
  • Ref. link
  • Anilkumar Bettegowda, Jianbo Yao, Aritro Sen, Qinglei Li, Kyung-Bon Lee, Yasuhiro Kobayashi, Osman V. Patel, Paul M. Coussens, James J. Ireland, and George W. Smith
    JY-1, an oocyte-specific gene, regulates granulosa cell function and early embryonic development in cattle
    PNAS, Nov 2007; 104: 17602 - 17607.
    ... ...RNA digestion and DNA precipitation. RNase-treated human genomic DNA (source: liver) was purchased from a commercial vendor (Biochain Institute., Hayward CA). Southern blot was prepared by digesting ?5 mg of genomic DNA per sample with EcoRI for... ...
    Ref. link


  • KyeongJin Kim, Hyeong Hoe Kim, Joon Hong Kim, Yung Hyun Choi, Young Hee Kim, and JaeHun Cheong
    Chemokine stromal cell-derived factor-1 induction by C/EBP?activation is associated with all-trans-retinoic acid-induced leukemic cell differentiation
    J. Leukoc. Biol., Nov 2007; 82: 1332 - 1339.
    ... ...was amplified by PCR from normal human spleen genomic DNA (BioChain Institute, Inc., Hayward, CA, USA) using the primer set, SDF-1-1918...GCT CGA GCG GTT ACT TGT TTA AAG C-3) from human liver cDNA (BioChain Institute). The PCR product was ligated into the pcDNA expression... ...
    Ref. link


  • Hirohide Yoshikawa, Kenichi Matsubara, Xiaoling Zhou, Shu Okamura, Takahiko Kubo, Yaeko Murase, Yuko Shikauchi, Manel Esteller, James G. Herman, Xin Wei Wang, and Curtis C. Harris
    WNT10B Functional Dualism: -Catenin/Tcf-dependent Growth Promotion or Independent Suppression with Deregulated Expression in Cancer
    Mol. Biol. Cell, Nov 2007; 18: 4292 - 4303.
    ... ...medium, supplemented with 10% fetal bovine serum. Normal DNA and RNA samples (liver, colon, and placenta) were purchased from Biochain Institute (Hayward, CA) and BD Biosciences (Palo Alto, CA). Primary HCC samples are as described previously (Yoshikawa et al... ...
    Ref. link


  • Changfa Guo, Husnain Kh. Haider, Winston S.N. Shim, Ru-San Tan, Lei Ye, Shujia Jiang, Peter K. Law, Philip Wong, and Eugene K.W. Sim
    Myoblast-based cardiac repair: Xenomyoblast versus allomyoblast transplantation
    J. Thorac. Cardiovasc. Surg., Nov 2007; 134: 1332 - 1339.
    ... ...QIAGEN), according to the manufacturers instructions. Male genomic DNA from human subjects (Research Instruments) or rats (Biochain) was used as standard after a serial dilution (5). Real-time PCR analysis was performed with the SYBR Green kit (ABgene). Briefly... ...
    Ref. link


  • April Smith Torhan, Boonlert Cheewatrakoolpong, Lia Kwee, and Scott Greenfeder
    Cloning and characterization of the hamster and guinea pig nicotinic acid receptors
    J. Lipid Res., Sep 2007; 48: 2065 - 2071.
    ... ...GPR109A (nicotinic acid receptor) receptor Guinea pig and hamster genomic DNA and cDNA from various tissues were purchased from Biochain Institute, Inc. (Hayward, CA). The Advantage 2 PCR kit was purchased from Clontech (Mountain View, CA). All primers were synthesized... ...
    Ref. link


  • Hirohide Yoshikawa, Kenichi Matsubara, Xiaoling Zhou, Shu Okamura, Takahiko Kubo, Yaeko Murase, Yuko Shikauchi, Manel Esteller, James G. Herman, Xin Wei Wang, and Curtis C. Harris
    WNT10B Functional Dualism: -Catenin/Tcf-dependent Growth Promotion or Independent Suppression with Deregulated Expression in Cancer
    Mol. Biol. Cell, Aug 2007; 10.1091/mbc.E06-10-0889.
    ... ...1640, supplemented with 10% fetal bovine serum. Normal DNA and RNA samples (liver, colon, and placenta) were purchased from Biochain Institute, Inc. (Hayward, CA) and BD Biosciences (Palo Alto, CA). Primary HCC samples are as described(Ye et al., 2003; Yoshikawa... ...
    Ref. link


  • KyeongJin Kim, Hyeong Hoe Kim, Joon Hong Kim, Yung Hyun Choi, Young Hee Kim, and JaeHun Cheong
    Chemokine stromal cell-derived factor-1 induction by C/EBP activation is associated with all-trans-retinoic acid-induced leukemic cell differentiation
    J. Leukoc. Biol., Jul 2007; 10.1189/jlb.1106697.
    ... ...was amplified by PCR from normal human spleen genomic DNA (BioChain Institute, Hayward, CA, USA) 1 Correspondence: Department of...GCT CGA GCG GTT ACT TGT TTA AAG C-3) from human liver cDNA (BioChain Institute). The PCR product was ligated into the pcDNA expression... ...
    Ref. link


  • Qiwei Yang, Colleen M. Kiernan, Yufeng Tian, Helen R. Salwen, Alexandre Chlenski, Babette A. Brumback, Wendy B. London, and Susan L. Cohn
    Methylation of CASP8, DCR2, and HIN-1 in Neuroblastoma Is Associated with Poor Outcome
    Clin. Cancer Res., Jun 2007; 13: 3191 - 3197.
    ... ...bisulfite using the CpGenome DNA Modification Kit (Intergen Co.). Genomic DNA from human normal adrenal tissue was purchased from BioChain Institute, Inc. As previously described (3), 1 mug of genomic DNA was denatured by NaOH and modified by sodium bisulfite, which... ...
    Ref. link


  • Helen C. Turner, Murat T. Budak, M. A. Murat Akinci, and J. Mario Wolosin
    Comparative Analysis of Human Conjunctival and Corneal Epithelial Gene Expression with Oligonucleotide Microarrays
    Invest. Ophthalmol. Vis. Sci., May 2007; 48: 2050 - 2061.
    ... ...sample in which the reverse transcriptase was omitted from the transcription reaction, and three contained human genomic DNA (Biochain, Hayward, CA). Products were analyzed by agarose (4%) gel chromatography. Relative amounts of the target genes in the corneal... ...
    Ref. link


  • Youngsoo Kim, Joon Won Yoon, Xiaokun Xiao, Nicholas M. Dean, Brett P. Monia, and Eric G. Marcusson
    Selective Down-Regulation of Glioma-Associated Oncogene 2 Inhibits the Proliferation of Hepatocellular Carcinoma Cells
    Cancer Res., Apr 2007; 67: 3583 - 3593
    ... ...Genomic DNA was either isolated from HCC cells using Genomic DNA Isolation kit (BioVision, Mountain View, CA) or purchased from Biochain Institute, Inc. (Hayward, CA) for normal human heart and liver tissues. PCR amplification was done using PfuUltra High-Fidelity... ...
    Ref. link


  • Vivianne Deng, Valerie Matagne, Fatima Banine, Matthew Frerking, Patricia Ohliger, Sarojini Budden, Jonathan Pevsner, Gregory A. Dissen, Larry S. Sherman, and Sergio R. Ojeda
    FXYD1 is an MeCP2 target gene overexpressed in the brains of Rett syndrome patients and Mecp2-null mice
    Hum. Mol. Genet., Mar 2007; 16: 640 - 650.
    ... ...Bisulfite PCR sequencing of human and mouse genomic DNA Genomic DNA from adult human brain and heart were purchased from BioChain, Inc. (Hayward, CA, USA). Genomic DNA from the mouse FC and CB was extracted as described (53). The presence of 5'-methylcytosines... ...
    Ref. link


  • Nashi Widodo, Custer C. Deocaris, Kamaljit Kaur, Kamrul Hasan, Tomoko Yaguchi, Kazuhiko Yamasaki, Takashi Sugihara, Tetsuro Ishii, Renu Wadhwa, and Sunil C. Kaul
    Stress Chaperones, Mortalin, and Pex19p Mediate 5-Aza-2' Deoxycytidine-Induced Senescence of Cancer Cells by DNA Methylation-Independent Pathway
    J. Gerontol. A Biol. Sci. Med. Sci., Mar 2007; 62: 246 - 255.
    ... ...and tumor-derived human cells and tumor tissues (59-61). In a panel of normal and tumor tissues from the same individuals (Biochain, Hayward, CA), we detected a higher level of expression of mortalin in tumor tissues as compared to their normal counterparts... ...
    Ref. link


  • Bart Lutterbach, Qinwen Zeng, Lenora J. Davis, Harold Hatch, Gaozhen Hang, Nancy E. Kohl, Jackson B. Gibbs, and Bo-Sheng Pan
    Lung Cancer Cell Lines Harboring MET Gene Amplification Are Dependent on Met for Growth and Survival
    Cancer Res., Mar 2007; 67: 2081 - 2088.
    ... ...cycles of 15 s 92C; and 1 min 60C) Data were normalized to RNase P and then to the calibrator sample (normal lung genomic DNA; BioChain Institute, Hayward, CA). ShRNA production and infection. shRNA sequences for Met were M1: GAAGATCACGAAGATCCCATTCAAGAGATGGGATCTTCGTGATCTTC... ...
    Ref. link


  • Shen Qu, Dongming Su, Jennifer Altomonte, Adama Kamagate, Jing He, German Perdomo, Tonia Tse, Yu Jiang, and H. Henry Dong
    PPAR mediates the hypolipidemic action of fibrates by antagonizing FoxO1
    Am J Physiol Endocrinol Metab, Feb 2007; 292: E421 - E434.
    ... ...mouse FoxO1 promoter 1,748/407 nucleotide (nt), including the 5-untranslated region, was cloned from Balb/C mouse genomic DNA (BioChain Institute, Hayward, CA) into the TA-cloning vector pCR2.1 (Invitrogen) by PCR using specific primers (for forward reaction... ...
    Ref. link


  • Shen Qu, Dongming Su, Jennifer Altomonte, Adama Kamagate, Jing He, German Perdomo, Tonia Tse, Yu Jiang, and H. Henry Dong
    PPAR- Mediates the Hypolipidemic Action of Fibrates by Antagonizing FoxO1
    Am J Physiol Endocrinol Metab, Sep 2006; 10.1152/ajpendo.00157.2006.
    ... ...2-kb mouse FoxO1 promoter (-1748/+407 nt) including the 5'-untranslated region (UTR) was cloned from Balb/C mouse genomic DNA (BioChain Institute Inc., Hayward, CA) into the TA-cloning vector pCR2.1 (Invitrogen) by PCR using specific primers (for forward reaction... ...
    Ref. link


  • Daniel A. Peiffer, Jennie M. Le, Frank J. Steemers, Weihua Chang, Tony Jenniges, Francisco Garcia, Kirt Haden, Jiangzhen Li, Chad A. Shaw, John Belmont, Sau Wai Cheung, Richard M. Shen, David L. Barker, and Kevin L. Gunderson
    High-resolution genomic profiling of chromosomal aberrations using Infinium whole-genome genotyping
    Genome Res., Sep 2006; 16: 1136 - 1148.
    ... ...leukemia cell line (HL-60) was also obtained from ATCC (ATCC No. HL60). The paired colon tumor genomic DNA was obtained from BioChain (A704198). For the DNA fragmentation experiments, cell line NA60136 was obtained from Coriell as was the cell line exhibiting... ...
    Ref. link


  • Emmanuel Zorn, Erik A. Nelson, Mehrdad Mohseni, Fabrice Porcheray, Haesook Kim, Despina Litsa, Roberto Bellucci, Elke Raderschall, Christine Canning, Robert J. Soiffer, David A. Frank, and Jerome Ritz
    IL-2 regulates FOXP3 expression in human CD4+CD25+ regulatory T cells through a STAT-dependent mechanism and induces the expansion of these cells in vivo
    Blood, Sep 2006; 108: 1571 - 1579.
    ... ...the UCSC genome browser, May 2004 assembly ( http://genome.ucsc.edu ). FOXP3 genomic DNA was amplified from human breast DNA (BioChain, Hayward, CA) using the following primers: 5-GGACGTCCCTTTCTGACTG-3 and 5-TCACCTACCACATCCACCAG-3. Amplified DNA was cloned using... ...
    Ref. link


  • Lingbao Ai, Wan-Ju Kim, Tae-You Kim, C. Robert Fields, Nicole A. Massoll, Keith D. Robertson, and Kevin D. Brown
    Epigenetic Silencing of the Tumor Suppressor Cystatin M Occurs during Breast Cancer Progression
    Cancer Res., Aug 2006; 66: 7899 - 7909.
    ... ...polyacrylamide gels and the gel was stained with ethidium bromide and directly visualized under UV illumination. Human placental gDNA (Biochain Institute, Hayward, CA) was used in primer validation experiments and methylated in vitro with SssI methylase (NEB, Ipswich... ...
    Ref. link


  • Erik A. Nelson, Sarah R. Walker, Wei Li, X. Shirley Liu, and David A. Frank
    Identification of human STAT5-dependent gene regulatory elements based on inter-species homology
    J. Biol. Chem., Jul 2006; 10.1074/jbc.M605001200.

    ... ...between human, chimp, mouse, and rat were selected for subsequent analysis. Reporter gene construction: Human breast DNA (BioChain, Hayward, CA) was amplified with primers spanning the conserved NCAM2 intronic region with the following sequences: ACACATCCTTCATACCAGGAAA... ...

  • Blow MJ, Grocock RJ, van Dongen S, Enright AJ, Dicks E, Futreal PA, Wooster R, Stratton MR.
    RNA editing of human microRNAs
    Genome Biol. 2006; 7(4): R27.
    ... ...For the initial screen of RNA editing in ten human tissues, total RNA and matching genomic DNA from the same tissue sample was obtained for human brain, heart, liver, lung, ovary, placenta, skeletal muscle, small intestine, spleen and testis from Biochain (Hayward, USA). ... ...
    Ref. link

  • Emmanuel Zorn, Erik A Nelson, Mehrdad Mohseni, Fabrice Porcheray, Haesook Kim, Despina Litsa, Roberto Bellucci, Elke Raderschall, Christine Canning, Robert J Soiffer, David A Frank, and Jerome Ritz
    IL-2 regulates FOXP3 expression in human CD4+CD25+ regulatory T cells through a STAT dependent mechanism and induces the expansion of these cells in vivo
    Blood, Apr 2006; 10.1182/blood-2006-02-004747.
    ... ...UCSC genome browser, May 2004 assembly (http://genome.ucsc.edu). FOXP3 genomic DNA was amplified from human breast DNA (BioChain, Hayward, CA) using the following primers: 5'-GGACGTCCCTTTCTGACTG-3' and 5'-TCACCTACCACATCCACCAG-3'. Amplified DNA was... ...


  • Gong X, Tsai SW, Yan B, Rubin LP.
    Cooperation between MEF2 and PPAR? in human intestinal ??carotene 15,15'-monooxygenase gene expression
    BMC Mol Biol. 2006; 7: 7.
    ... ...A 1022 bp BCMO1 promoter fragment spanning nt 79828775 to 79829795 [Ensembl Gene, ENSG00000135697] [54] was amplified by the polymerase chain reaction (PCR) from human liver genomic DNA (BioChain Institute, Hayward, CA) using a 5' primer .... ...
    Ref. link


  • Nadia Felli, Laura Fontana, Elvira Pelosi, Rosanna Botta, Desirée Bonci, Francesco Facchiano, Francesca Liuzzi, Valentina Lulli, Ornella Morsilli, Simona Santoro, Mauro Valtieri, George Adrian Calin, Chang-Gong Liu, Antonio Sorrentino, Carlo M. Croce, and Cesare Peschle
    MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation
    PNAS, Dec 2005; 102: 18081 - 18086.
    ... ..Plasmids and Constructs. PGL3-3' UTR plasmid. Kit 3' UTR was cloned from human spleen genomic DNA (BioChain, Hayward, CA) by using the forward primer 5'-CTCGAGCGTCTTAGTCCAAACCCAG-3' and the reverse primer 5'-CTCGAGCAAGGACAAAAGATCT-3...

  • Erez Y. Levanon, Martina Hallegger, Yaron Kinar, Ronen Shemesh, Kristina Djinovic-Carugo, Gideon Rechavi, Michael F. Jantsch, and Eli Eisenberg
    Evolutionarily conserved human targets of adenosine to inosine RNA editing

    Nucleic Acids Res., Feb 2005; 33: 1162 - 1168.
    ... RNA and genomic DNA (gDNA) isolated simultaneously from the same tissue sample were purchased from Biochain Institute (Hayward, CA). ...

  • Qiwei Yang, Peter Zage, David Kagan, Yufeng Tian, Roopa Seshadri, Helen R. Salwen, Shuqing Liu, Alexandre Chlenski, and Susan L. Cohn
    Association of Epigenetic Inactivation of RASSF1A with Poor Outcome in Human Neuroblastoma

    Clin. Cancer Res., Dec 2004; 10: 8493 - 8500.
    ... Genomic DNA from human normal adrenal and brain tissues were purchased from BioChain Institute, Inc. ...

  • Daniel P. Morse, P. Joseph Aruscavage, and Brenda L. Bass
    RNA hairpins in noncoding regions of human brain and Caenorhabditis elegans mRNA are edited by adenosine deaminases that act on RNA
    PNAS, Jun 2002; 99: 7906 - 7911. we used poly(A) + RNA and genomic DNA isolated from the same individual (purchased from BioChain Institute, Hayward, CA) to ensure differences between genomic and cDNA sequences were due to RNA ...

Antibody:

  • Chang Whan Lee, Tae Hoon Kim, Heung Man Lee, Seung Hoon Lee, Sung Ho Lee, Joon Hyuk Yoo, Yeon Soo Kim, and Sang Hag Lee
    Upregulation of Elafin and Cystatin C in the Ethmoid Sinus Mucosa of Patients With Chronic Sinusitis
    Arch Otolaryngol Head Neck Surg, Aug 2009; 135: 771 - 775.
    ... ...anti-elafin polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, California) or rabbit anti-cystatin C polyclonal antibody (BioChain Institute Inc, Hayward, California). The color was developed using 3, 3-diaminobenzidine. For Western blot analysis, equal... ...
    Ref. link


  • David E. Ott, Lori V. Coren, and Teresa Shatzer
    The Nucleocapsid Region of Human Immunodeficiency Virus Type 1 Gag Assists in the Coordination of Assembly and Gag Processing: Role for RNA-Gag Binding in the Early Stages of Assembly
    J. Virol., Aug 2009; 83: 7718 - 7727.
    ... ...Perkin Elmer Life Sciences, Inc. Proteins were detected by developing blots with horseradish peroxidase-conjugated anti-goat (Biochain Institute, Hayward, CA) or anti-mouse (Millipore Corp., Telemuca, CA) secondary antibody and an Immun-star horseradish peroxidase... ...
    Ref. link


  • Rachael M. Crist, Siddhartha A. K. Datta, Andrew G. Stephen, Ferri Soheilian, Jane Mirro, Robert J. Fisher, Kunio Nagashima, and Alan Rein
    Assembly Properties of Human Immunodeficiency Virus Type 1 Gag-Leucine Zipper Chimeras: Implications for Retrovirus Assembly
    J. Virol., Mar 2009; 83: 2216 - 2225.
    ... ...Ott, AIDS Vaccine Program, SAIC-Frederick). The secondary antibody was a rabbit anti-goat-horseradish peroxidase conjugate (BioChain Institute, Inc.). Both antibodies were used at a dilution of 1:10,000. Isolation of RNA from VLPs. RNA was extracted from... ... 
    Ref. link


  • Lori M. Roberts, Kathleen Woodford, Mei Zhou, Deborah S. Black, Jill E. Haggerty, Emily H. Tate, Kent K. Grindstaff, Wondwessen Mengesha, Chandrasekaran Raman, and Noa Zerangue
    Expression of the Thyroid Hormone Transporters Monocarboxylate Transporter-8 (SLC16A2) and Organic Ion Transporter-14 (SLCO1C1) at the Blood-Brain Barrier
    Endocrinology, Dec 2008; 149: 6251 - 6261.
    ... ...fetal parietal lobe (female, 37 wk), hippocampus (female, 82 yr), and choroid plexus (female, 70 yr) were purchased from BioChain Institute (Hayward, CA). qPCR RNeasy RNA Isolation Kit and QIAshredder homogenizer columns (QIAGEN, Valencia, CA) were... ...
    Ref. link


  • Luca Paoluzzi, Mithat Gonen, Govind Bhagat, Richard R. Furman, Jeffrey R. Gardner, Luigi Scotto, Volodia D. Gueorguiev, Mark L. Heaney, Katia Manova, and Owen A. O'Connor
    The BH3-only mimetic ABT-737 synergizes the antineoplastic activity of proteasome inhibitors in lymphoid malignancies
    Blood, Oct 2008; 112: 2906 - 2916.
    ... ...polyclonal antibodies were used: Bax (N20; Santa Cruz Biotechnology, Santa Cruz, CA), Bak (NT; GeneTex, San Antonio, TX), Puma (Biochain Institute, Hayward, CA), Noxa (Calbiochem, San Diego, CA), Mcl-1 (Rockland, Gilbertsville, PA), Bcl-2 (clone 100; Upstate... ...
    Ref. link


  • Dietrich B. Conze, Chuan-Jin Wu, James A. Thomas, Allison Landstrom, and Jonathan D. Ashwell
    Lys63-Linked Polyubiquitination of IRAK-1 Is Required for Interleukin-1 Receptor- and Toll-Like Receptor-Mediated NF-{kappa}B Activation
    Mol. Cell. Biol., May 2008; 28: 3538 - 3547.
    ... ...antibody (FL-419) were purchased from Santa Cruz Biotechnology. The anti-TRAF6 (CT) polyclonal antibody was purchased from Biochain Institute. The anti-NEMO MAb (C73-764) was purchased from BD Pharmingen. The anti-phospho-p38 polyclonal antibody (Thr 180... ...
    Ref. link


  • T. E. Weber, C. J. Ziemer, and B. J. Kerr
    Effects of adding fibrous feedstuffs to the diet of young pigs on growth performance, intestinal cytokines, and circulating acute-phase proteins
    J Anim Sci, Apr 2008; 86: 871 - 881.
    ... ...15 min at 37C. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was detected using a mouse anti-GAPDH monoclonal antibody (BioChain Institute Inc., Hayward, CA) diluted at 1:2,000 in blocking solution. The GAPDH reaction complexes were visualized as described... ...
    Ref. link


  • Peter I. Lobo, Kailo H. Schlegel, Clinton E. Spencer, Mark D. Okusa, Christopher Chisholm, Nino Mchedlishvili, Andrew Park, Constance Christ, and Christopher Burtner
    Naturally Occurring IgM Anti-Leukocyte Autoantibodies (IgM-ALA) Inhibit T Cell Activation and Chemotaxis
    J. Immunol., Feb 2008; 180: 1780 - 1791.
    ... ...Abs in the Western blot procedure: polyclonal rabbit IgG Abs to CD3 (Santa Cruz Biotechnology), CD4 (RD Systems), or CXCR4 (Biochain); monoclonal mouse IgG Abs to CCR5 (clone CTC, N-terminal) and CXCR4 (clone 4G10 N-terminal). Immunoprecipitation technique... ...
    Ref. link


  • Peter I. Lobo, Kailo H. Schlegel, Wen Yuan, Gregory C. Townsend, and Jennifer A. White
    Inhibition of HIV-1 Infectivity through an Innate Mechanism Involving Naturally Occurring IgM Anti-Leukocyte Autoantibodies
    J. Immunol., Feb 2008; 180: 1769 - 1779.
    ... ...in the Western blot procedure: polyclonal rabbit IgG Abs to CD3 (Santa Cruz Biotechnology, CA), CD4 (RD Systems), or CXCR4 (Biochain); monoclonal mouse IgG Abs to CCR5 (clone CTC, N-terminal) and CXCR4 (clone 4G10 N-terminal). HIV-1 viral isolates R5 isolates... ...
    Ref. link


  • Lori V. Coren, James A. Thomas, Elena Chertova, Raymond C. Sowder, II, Tracy D. Gagliardi, Robert J. Gorelick, and David E. Ott
    Mutational Analysis of the C-Terminal Gag Cleavage Sites in Human Immunodeficiency Virus Type 1
    J. Virol., Sep 2007; 81: 10047 - 10054.
    ... ...Proteins were detected by developing blots with either horseradish peroxidase-conjugated anti-goat, anti-rabbit (both from Biochain Institute, Hayward, CA), or anti-mouse (Life Technologies, Inc., Gaithersburg, MD) secondary antibody and the Immun-star horseradish... ...
    Ref. link


  • EYTAN R. BARNEA
    Applying Embryo-Derived Immune Tolerance to the Treatment of Immune Disorders
    Ann. N.Y. Acad. Sci., Sep 2007; 1110: 602 - 618.
    ... ...USA). The antibodies were used to stain fetal tissues (14-18 weeks) placed on two microarrays (60 tissues each) obtained from BioChain Inc. (Hayward, CA, USA). Immunohistochemistry Staining of the slides was carried out using standard techniques. Slides... ...
    Ref. link


  • Lori V. Coren, James A. Thomas, Elena Chertova, Raymond C. Sowder, II, Tracy D. Gagliardi, Robert J. Gorelick, and David E. Ott
    Mutational Analysis of the C-Terminal Gag Cleavage Sites in Human Immunodeficiency Virus Type 1
    J. Virol., Jul 2007; 10.1128/JVI.02496-06.
    ... ...Wellesley, MA). Proteins were detected by developing blots with either HRP-conjugated12 anti-goat, anti-rabbit (both from Biochain Institute, Hayward, CA), or anti-mouse (Life13 Technologies, Inc., Gaithersburg, MD) secondary antibody and the Immun-star... ...
    Ref. link


  • Samuel J. Rulli, Jr., Catherine S. Hibbert, Jane Mirro, Thoru Pederson, Shyam Biswal, and Alan Rein
    Selective and Nonselective Packaging of Cellular RNAs in Retrovirus Particles
    J. Virol., Jun 2007; 81: 6623 - 6631.
    ... ...Ott, AIDS Vaccine Program, SAIC-Frederick), followed by the appropriate horseradish peroxidase-labeled secondary antibody (BioChain Institute, Inc.). The protein of interest was quantitated using Supersignal West Dura extended-duration substrate (Pierce... ...
    Ref. link


  • Samuel J. Rulli, Jr., Catherine S. Hibbert, Jane Mirro, Thoru Pederson, Shyam Biswal, and Alan Rein
    SELECTIVE AND NON-SELECTIVE PACKAGING OF CELLULAR RNAS IN RETROVIRUS PARTICLES
    J. Virol., Mar 2007; 10.1128/JVI.02833-06.
    ... ...Vaccine Program, SAIC-Frederick) followed by176 ACCEPTED 9 the appropriate horseradish peroxidase-labeled secondary antibody (BioChain Institute,177 Inc.). The protein of interest was quantitated using Supersignal West Dura extended178 duration substrate (Pierce... ...
    Ref. link


  • Li XL, Shuai JB, Fang WH.
    Protection of Carassius auratus Gibelio against infection by Aeromonas hydrophila using specific immunoglobulins from hen egg yolk
    J Zhejiang Univ Sci B. 2006 Nov; 7(11): 922-928. published online before print October 17, 2006
    ... ...One hundred microlitres of HRP conjugated rabbit anti-chicken IgG (BioChain Institute, Inc., Hayward, USA) at 500-fold dilution with PBST with 0.05 BSA was added to the wells after another three washings.... ...
    Ref. link


  • David E. Ott, Lori V. Coren, and Tracy D. Gagliardi
    Redundant Roles for Nucleocapsid and Matrix RNA-Binding Sequences in Human Immunodeficiency Virus Type 1 Assembly
    J. Virol., Nov 2005; 79: 13839 - 13847.
    ... ...Proteins were detected by developing blots with a horseradish peroxidase (HRP)-conjugated anti-goat secondary antibody (BioChain Institute, Hayward, CA) and the Immun-star HRP substrate kit (Bio-Rad, Hercules, CA) on LumiFilm (Roche Applied Science... ...

  • David E. Ott, Lori V. Coren, Tracy D. Gagliardi, and Kunio Nagashima
    Heterologous Late-Domain Sequences Have Various Abilities To Promote Budding of Human Immunodeficiency Virus Type 1
    J. Virol., Jul 2005; 79: 9038 - 9045.
    ... ...Frederick, MD). Proteins were detected by development with horseradish peroxidase-conjugated anti-goat secondary antibody (BioChain Institute, Hayward CA) and the Immun-star horseradish peroxidase substrate kit (Bio-Rad, Hercules, CA) on LumiFilm, Roche... ...

  • Ott DE, Coren LV, Gagliardi TD, Nagashima K.
    Heterologous Late-Domain Sequences Have Various Abilities To Promote Budding of Human Immunodeficiency Virus Type 1
    J Virol. 2005 Jul; 79(14): 9038-9045.
    ... ...Proteins were detected by development with horseradish peroxidase-conjugated anti-goat secondary antibody (Biochain Institute, Hayward CA) and the Immun-star horseradish peroxidase substrate kit ... ...
    Ref. link


  • MEMBRANE TRANSPORT STRUCTURE FUNCTION AND BIOGENESIS:
    Antony S. Dimitrov, Xiaodong Xiao, Dimiter S. Dimitrov, and Robert Blumenthal
    Early Intermediates in HIV-1 Envelope Glycoprotein-mediated Fusion Triggered by CD4 and Co-receptor Complexes
    J. Biol. Chem., Aug 2001; 276: 30335 - 30341. ... performed using the T4¨C4 anti CD4 antibody (NIH AIDS R&RRP), a rabbit polyclonal anti-CXCR4 antibody (Biochain Institute, Hayward, CA), and a goat polyclonal anti-CCR5 antibody (Santa Cruz Biotechnology Inc., Santa Cruz, ...

Tissue Section:

  • Mary Ellen Maddalena, Jaclyn Fox, Jianqing Chen, Weiwei Feng, Aldo Cagnolini, Karen E. Linder, Michael F. Tweedle, Adrian D. Nunn, and Laura E. Lantry
    177Lu-AMBA Biodistribution, Radiotherapeutic Efficacy, Imaging, and Autoradiography in Prostate Cancer Models with Low GRP-R Expression
     
    J. Nucl. Med., Dec 2009; 50: 2017 - 2024.
     
    ... ...controls were frozen sections of human prostate carcinoma (Biochain). To establish the growing fraction of the tumors, immunohistochemistry...Positive controls were human breast carcinoma frozen sections (Biochain). The immunohistochemistry slides were graded in a range from... ...
    Ref. link


  • Karen J. Meaburn, Prabhakar R. Gudla, Sameena Khan, Stephen J. Lockett, and Tom Misteli
    Disease-specific gene repositioning in breast cancer
     
    J. Cell Biol., Dec 2009; 187: 801 - 812.
     
    ... ...Normal Absence of cancer; 56 y BioChain T2234086 5 microm N6 Normal NAT; 50 y BioChain TMA core A2 4 microm N7 Normal...C7 IDC TMN stage T4N3M1; 50 y BioChain TMA core C1 4 microm C8 IDC... ...
    Ref. link


  • Caterina Bianco, Catherine Cotten, Enza Lonardo, Luigi Strizzi, Christina Baraty, Mario Mancino, Monica Gonzales, Kazuhide Watanabe, Tadahiro Nagaoka, Colin Berry, Andrew E. Arai, Gabriella Minchiotti, and David S. Salomon
    Cripto-1 Is Required for Hypoxia to Induce Cardiac Differentiation of Mouse Embryonic Stem Cells
     
    Am. J. Pathol., Nov 2009; 175: 2146 - 2158.
     
    ... ...Porcine Heart Tissue Sections Paraffin and frozen tissue sections from patients who suffered acute MI (AMI) were purchased from Biochain Institute (Hayward, CA): eight AMI serial human heart tissue sections and six non-AMI (congenital heart disease or hypertension... ... 
    Ref. link


  • Tomomi Ueki, Jae-Hyun Park, Toshihiko Nishidate, Kyoko Kijima, Koichi Hirata, Yusuke Nakamura, and Toyomasa Katagiri
    Ubiquitination and Downregulation of BRCA1 by Ubiquitin-Conjugating Enzyme E2T Overexpression in Human Breast Cancer Cells
     
    Cancer Res., Nov 2009; 69: 8752 - 8760.
     
    ... ...analysis Slides of paraffin-embedded breast cancer tissues and other normal human tissues (lung, heart, liver, and kidney; Biochain) were processed for antigen retrieval by the antigen retrieval solution pH9 (DAKO Cytomation), and treated with peroxidase... ...
    Ref. link


  • Sergey A. Shiryaev, Albert G. Remacle, Alexei Y. Savinov, Andrei V. Chernov, Piotr Cieplak, Ilian A. Radichev, Roy Williams, Tatiana N. Shiryaeva, Katarzyna Gawlik, Tatiana I. Postnova, Boris I. Ratnikov, Alexei M. Eroshkin, Khatereh Motamedchaboki, Jeffrey W. Smith, and Alex Y. Strongin
    Inflammatory Proprotein Convertase-Matrix Metalloproteinase Proteolytic Pathway in Antigen-presenting Cells as a Step to Autoimmune Multiple Sclerosis
     
    J. Biol. Chem., Oct 2009; 284: 30615 - 30626.
     
    ... ...oblongata of healthy and MS patients were purchased from the BioChain Institute (Hayward, CA). The frozen human brain tissue samples...blotting with the MBP antibody. The extracts were purchased from BioChain Institute (Hayward, CA). The representative samples are shown... ...
    Ref. link


  • Stefan A. Kaden, Stefanie Kurig, Katrin Vasters, Kay Hofmann, Kurt S. Zaenker, Juergen Schmitz, and Gregor Winkels
    Enhanced Dendritic Cell-Induced Immune Responses Mediated by the Novel C-Type Lectin Receptor mDCAR1
     
    J. Immunol., Oct 2009; 183: 5069 - 5078.
     
    ... ...R35-95), rIgG2b (A95-1), all from BD Biosciences. Immunofluorescence microscopy Frozen splenic tissue sections (5-10 um; BioChain) derived from BALB/c mice were incubated for 15 h at 4C with the following mAb conjugates diluted in PBS containing 1% BSA... ...
    Ref. link


  • Jeanne L. Theis, J. Martijn Bos, Jason D. Theis, Dylan V. Miller, Joseph A. Dearani, Hartzell V. Schaff, Bernard J. Gersh, Steve R. Ommen, Richard L. Moss, and Michael J. Ackerman
    Expression Patterns of Cardiac Myofilament Proteins: Genomic and Protein Analysis of Surgical Myectomy Tissue From Patients With Obstructive Hypertrophic Cardiomyopathy
    Circ Heart Fail, Jul 2009; 2: 325 - 333.
    ... ...Healthy flash-frozen heart tissue was obtained from the interventricular septum of a disease-free, accidental death victim (Biochain, Hayward, Calif). Healthy tissue was flash frozen in liquid nitrogen, to compare protein levels with the HCM myectomy tissue... ...
    Ref. link


  • TEODORA NIKOLOVA, MARKUS CHRISTMANN, and BERND KAINA
    FEN1 is Overexpressed in Testis, Lung and Brain Tumors
    Anticancer Res, Jul 2009; 29: 2453 - 2459.
    ... ...glioblastoma multiforme (n=13) and astrocytoma (n=7)] were compared with commercially available extracts from normal human cerebellum (BioChain, Hayward, CA, USA). For preparation of total tumor tissue extracts, the frozen tissue was crushed in a mortar and transferred... ...
    Ref. link


  • Tadashi Matsumoto, Kazuhiro Minegishi, Hitoshi Ishimoto, Mamoru Tanaka, Jon D. Hennebold, Takahide Teranishi, Yoshihisa Hattori, Masataka Furuya, Takayuki Higuchi, Satoshi Asai, Seon Hye Kim, Kei Miyakoshi, and Yasunori Yoshimura
    Expression of Ovary-Specific Acidic Protein in Steroidogenic Tissues: A Possible Role in Steroidogenesis
    Endocrinology, Jul 2009; 150: 3353 - 3359.
    ... ...derived from human and mouse tissues were purchased from CLONTECH Laboratories (Mountain View, CA), Zyagen (San Diego, CA), and BioChain (Hayward, CA). Reverse transcription reactions with random primers were carried out with Omniscript reverse transcriptase... ...
    Ref. link


  • Barry W. Larman, Michele J. Karolak, Derek C. Adams, and Leif Oxburgh
    Chordin-like 1 and Twisted Gastrulation 1 Regulate BMP Signaling following Kidney Injury
    J. Am. Soc. Nephrol., May 2009; 20: 1020 - 1031.
    ... ...Technology and goat anti-rabbit Alexa Fluor 568 (Molecular Probes). Formalin-fixed human kidney sections were purchased from the Biochain Institute (Hayward, CA) and Zyagen Laboratories (San Diego, CA). Proximal tubules and nuclei were marked as described already... ...
    Ref. link


  • Ayuko A. Iverson, Cheryl Gillett, Paul Cane, Christopher D. Santini, Thomas M. Vess, Lauren Kam-Morgan, Alice Wang, Marcia Eisenberg, Charles M. Rowland, Janice J. Hessling, Samuel E. Broder, John J. Sninsky, Andrew Tutt, Steven Anderson, and Sheng-Yung P. Chang
    A Single-Tube Quantitative Assay for mRNA Levels of Hormonal and Growth Factor Receptors in Breast Cancer Specimens
    J. Mol. Diagn., Mar 2009; 11: 117 - 130.
    ... ...determine FFPE section-to-section reproducibility, five sequential sections from each of 10 breast cancer tumor FFPE samples (BioChain Institute, Hayward, CA) were obtained. Before RNA was isolated, the slide was checked to ensure that all sections from each... ...
    Ref. link


  • Ke Zen, Dan-Qing Liu, Li-Min Li, Celia X-J Chen, Ya-Lan Guo, Bihn Ha, Xi Chen, Zhen-Yu Zhang, and Yuan Liu
    The Heparan Sulfate Proteoglycan Form of Epithelial CD44v3 Serves as a CD11b/CD18 Counter-receptor during Polymorphonuclear Leukocyte Transepithelial Migration
    J. Biol. Chem., Feb 2009; 284: 3768 - 3776.
    ... ...on coverslides followed by air drying before immunostaining was performed. Normal human colon sections were purchased from Biochain (Hayward, CA). Recombinant human TNF-alpha and interferon-gamma were purchased from Upstate Biotechnology and used at 20 and... ...
    Ref. link



  • Liliane Benkoël, Jean-Paul Bernard, Marie-Jos?Payan-Defais, Lydie Crescence, Cécile Franceschi, Mireille Delmas, Mehdi Ouaissi, Bernard Sastre, Jos?Sahel, Anne-Marie Benoliel, Pierre Bongrand, Françoise Silvy, Laurent Gauthier, François Romagn? Dominique Lombardo, and Eric Mas
    Monoclonal antibody 16D10 to the COOH-terminal domain of the feto-acinar pancreatic protein targets pancreatic neoplastic tissues
    Mol. Cancer Ther., Feb 2009; 8: 282 - 291.
    ... ...Frozen tissue slides of a PDAC provided by BioChain were also studied. Adjacent nontumoral...paraffin-embedded sections. Tissue provided by BioChain. All controls and patients were Caucasians...studied as negative tissue controls (BioChain). Formalin-fixed, paraffin-embedded tissue... ...
    Ref. link


  • Adam Palermo, Regis Doyonnas, Nidhi Bhutani, Jason Pomerantz, Ozan Alkan, and Helen M. Blau
    Nuclear reprogramming in heterokaryons is rapid, extensive, and bidirectional
    FASEB J, Jan 2009; 10.1096/fj.08-122903.
    ... ...Universal Total RNA (SuperArray, Frederick, MD, USA). Mouse reference RNA was a mixture of Universal RNA: Mouse Normal Tissues (BioChain, Hayward, CA, USA), Universal Mouse Reference RNA (Strat-agene, La Jolla, CA, USA), and RNA from whole mouse E17.5 embryos... ...
    Ref. link


  • Katherine Elena Varley and Robi David Mitra
    Nested Patch PCR enables highly multiplexed mutation discovery in candidate genes
    Genome Res., Nov 2008; 18: 1844 - 1850.
    ... ...tissue from an 81-yr-old male was obtained from Biochain ( www.biochain.com ), catalog no. D8235090-PP-10. Targets were...either the colon tumor or the adjacent normal tissue (Biochain, catalog no. D8235090-PP-10). This reaction was... ...
    Ref. link


  • Masashi Akiyama, Kaori Sakai, Chitoshi Takayama, Teruki Yanagi, Yasuko Yamanaka, James R. McMillan, and Hiroshi Shimizu
    CGI-58 Is an {alpha}/¦Â-Hydrolase within Lipid Transporting Lamellar Granules of Differentiated Keratinocytes
    Am. J. Pathol., Nov 2008; 173: 1349 - 1360.
    ... ...tissue slides of human liver and brain were purchased from BioChain Institute Inc. (Hayward, CA). Normal human adult liver or brain...normal mouse and human tissue extracts were purchased from BioChain Institute, Inc. (Hayward, CA). Cell lysates (100 ug of protein... ...
    Ref. link


  • Lori M. Roberts, Kathleen Woodford, Mei Zhou, Deborah S. Black, Jill E. Haggerty, Emily H. Tate, Kent K. Grindstaff, Wondwessen Mengesha, Chandrasekaran Raman, and Noa Zerangue
    Expression of the thyroid hormone transporters MCT8 (SLC16A2) and OATP14 (SLCO1C1) at the blood-brain barrier
    Endocrinology, Aug 2008; 10.1210/en.2008-0378.
    ... ...parietal lobe (female, 37 weeks), hippocampus (female, 82 years), and choroid plexus (female, 70 years) were purchased from BioChain Institute (Hayward, CA, USA). Quantitative PCR RNeasy RNA Isolation Kit and Qiashredder homogenizer columns (Qiagen, Valencia... ...
    Ref. link


  • Jing Chen, Jean Lozach, Eliza Wickham Garcia, Bret Barnes, Shujun Luo, Ivan Mikoulitch, Lixin Zhou, Gary Schroth, and Jian-Bing Fan
    Highly sensitive and specific microRNA expression profiling using BeadArray technology
    Nucleic Acids Res., Aug 2008; 36: e87.
    ... ...experiments, small RNA molecules were enriched using Invitrogen's PureLink miRNA Isolation Kit. FFPE samples were purchased from Biochain Institute, Inc., and RNA was extracted using Qiagen's RNeasy FFPE Kit. miRNA profiling on universal BeadArray platform... ...
    Ref. link


  • Yasunaga Ono, Naohisa Oda, Shin Ishihara, Atsushi Shimomura, Nobuki Hayakawa, Atsushi Suzuki, Akihiko Horiguchi, Takao Senda, Shuichi Miyakawa, and Mitsuyasu Itoh
    Insulinoma cell calcium-sensing receptor influences insulin secretion in a case with concurrent familial hypocalciuric hypercalcemia and malignant metastatic insulinoma.
    Eur. J. Endocrinol., Jul 2008; 159: 81 - 86.
    ... ...for both pancreatic and kidney tissues were purchased from BioChain Institute Inc. (Hayward, CA, USA). RT-PCR for the detection...thickness were prepared. Section of parathyroid purchased from BioChain Institute Inc. was used as a positive control. Immunohistochemistry... ...
    Ref. link


  • Kevin A. Glenn, Rick F. Nelson, Hsiang M. Wen, Adam J. Mallinger, and Henry L. Paulson
    Diversity in Tissue Expression, Substrate Binding, and SCF Complex Formation for a Lectin Family of Ubiquitin Ligases
    J. Biol. Chem., May 2008; 283: 12717 - 12729.
    ... ...and pelleting debris by centrifugation at 16,000 g, 4 C for 15 min. Mouse tissue preparations from a commercial supplier (BioChain, Hayward, CA) produced similar results. Immunoprecipitation (IP) Nondenatured lysates from 10-cm plates were incubated... ...
    Ref. link


  • Eric Soupene, Vladimir Serikov, and Frans A. Kuypers
    Characterization of an acyl-coenzyme A binding protein predominantly expressed in human primitive progenitor cells
    J. Lipid Res., May 2008; 49: 1103 - 1112.
    ... ...protein array (human adult normal tissues Biochain Institute, Inc.) was performed as follows...according to the manufacturers instructions (Biochain Institute, Inc.). Immunohistochemistry...antibody on a MegaWestern protein array (Biochain Institute, Inc.) representing 30 different... ...
    Ref. link


  • Kathryn B. Horwitz, Wendy W. Dye, Joshua Chuck Harrell, Peter Kabos, and Carol A. Sartorius
    Rare steroid receptor-negative basal-like tumorigenic cells in luminal subtype human breast cancer xenografts
    PNAS, Apr 2008; 105: 5774 - 5779.
    ... ...Cancerous Breast Tis- sue. Normal human breast tissue was obtained from US Biomax. Breast cancer tissue arrays were purchased from Biochain. These were stained using a DAB system for CK5 and PR as described. Were also stained fluorescently for CK5 and PR. For analyses... ...
    Ref. link


  • Melissa L. Palmer, Katherine R. Schiller, and Scott M. O'Grady
    Apical SK potassium channels and Ca2+-dependent anion secretion in endometrial epithelial cells
    J. Physiol., Feb 2008; 586: 717 - 726.
    ... ...DNase-free RNA isolated from porcine brain was purchased from BioChain Institute Inc. (Hayward, CA, USA). Dulbeccos modified Eagles...DNase-free RNA isolated from porcine brain was purchased from BioChain Institute Inc. (Hayward, CA, USA). Dulbecco's modified Eagle's... ...
    Ref. Link


  • David A. Taylor-Fishwick, Angela Bowman, MariCarmen Korngiebel-Rosique, and Aaron I. Vinik
    Pancreatic Islet Immunoreactivity to the Reg Protein INGAP
    J. Histochem. Cytochem., Feb 2008; 56: 183 - 191.
    ... ...Committee, Eastern Virginia Medical School. Immunohistochemistry Monkey, human, and rat pancreas sections were supplied by Biochain (Hayward, CA). Harvested mouse pancreata were fixed in 10% formalin (Fisher Chemicals Fair Lawn, NJ) and paraffin embedded... ...
    Ref. link


  • Jascha-N. Rybak, Christoph Roesli, Manuela Kaspar, Alessandra Villa, and Dario Neri
    The Extra-domain A of Fibronectin Is a Vascular Marker of Solid Tumors and Metastases
    Cancer Res., Nov 2007; 67: 10948 - 10957.
    ... ...of freshly frozen tissue specimens. In many cases, freshly frozen tissue sections in microarray format were obtained from BioChain. To verify successful in vivo biotinylation, staining of biotinylated structures was done as described in ref. (15) using streptavidin... ...
    Ref. link


  • Mingyan Zhou, Li Xia, and Joanne Wang
    Metformin Transport by a Newly Cloned Proton-Stimulated Organic Cation Transporter (Plasma Membrane Monoamine Transporter) Expressed in Human Intestine
    Drug Metab. Dispos., Oct 2007; 35: 1956 - 1962.
    ... ...localization of PMAT in human small intestine, commercial slides containing human small intestine tissue were purchased from BioChain Institute Inc. (Hayward, CA). Slides were rinsed twice with PBS and fixed for 30 min at room temperature with 4% (v/v) paraformaldehyde... ...
    Ref. link


  • Yasuna Kobayashi, Ayumi Tsuchiya, Tomofumi Hayashi, Noriko Kohyama, Masayuki Ohbayashi, and Toshinori Yamamoto
    Isolation and Characterization of Polyspecific Mouse Organic Solute Carrier Protein 1 (mOscp1)
    Drug Metab. Dispos., Jul 2007; 35: 1239 - 1245.
    ... ...2005). A 5-mum wax section of mouse testis was obtained from BioChain Institute, Inc. (Hayward, CA) and sectioning was carried out...2005). A 5- m wax section of mouse testis was obtained from BioChain Institute, Inc. (Hayward, CA) and sectioning was carried out... ...