Promotions

cDNA: 

• Sean Kim, Joseph E. Dinchuk, Monique N. Anthony, Tami Orcutt, Mary E. Zoeckler, Mary B. Sauer, Kathleen W. Mosure, Ragini Vuppugalla, James E. Grace, Jr., Jean Simmermacher, Heidi A. Dulac, Jennifer Pizzano, and Michael Sinz
  Evaluation of Cynomolgus Monkey Pregnane X Receptor, Primary Hepatocyte, and in Vivo Pharmacokinetic Changes in Predicting Human CYP3A4 Induction
  Drug Metab. Dispos., Jan 2010; 38: 16 - 24.
  ... ...hyperforin or 0.87 mg/capsule. Molecular Cloning of cynoPXR. A cynomolgus monkey liver cDNA panel was purchased from the Biochain Institute (Hayward, CA). Forward (nucleotide 1-27) and reverse (1274-1305) primers were selected based on a rhesus monkey PXR... ...
  
Ref. link

• Fenghua Yuan, Jimmy El Hokayem, Wen Zhou, and Yanbin Zhang
  FANCI Protein Binds to DNA and Interacts with FANCD2 to Recognize Branched Structures
  J. Biol. Chem., Sep 2009; 284: 24443 - 24452.
  ... ...of Recombinant FA Proteins cDNAs for human FANCI and FANCD2 were obtained by PCR amplification from a universal cDNA pool (BioChain Institute, Inc.). The FANCI cDNA matches the NCBI Reference Sequence NM_001113378, and the FANCD2 cDNA matches NM_001018115... ...
  
Ref. link

• Veronica J. Peschansky, Timothy J. Burbridge, Amy J. Volz, Christopher Fiondella, Zach Wissner-Gross, Albert M. Galaburda, Joseph J. Lo Turco, and Glenn D. Rosen
  The Effect of Variation in Expression of the Candidate Dyslexia Susceptibility Gene Homolog Kiaa0319 on Neuronal Migration and Dendritic Morphology in the Rat
  Cereb Cortex, Aug 2009; 10.1093/cercor/bhp154.
  ... ...Kiaa0319 as described below. The cDNAs prepared from frontal, parietal, and occipital lobes of human embryonic brain (20 weeks, Biochain Institute, Hayward, CA) were used as template to amplify the full-length coding sequence of Kiaa0319 using forward (5ATGGCGCCCCCCACAGGTGTG3... ...
  
Ref. link

• Dorothee Günzel, Salah Amasheh, Sandra Pfaffenbach, Jan F. Richter, P. Jaya Kausalya, Walter Hunziker, and Michael Fromm
  Claudin-16 affects transcellular Cl^\#8722; secretion in MDCK cells
  J. Physiol., Aug 2009; 587: 3777 - 3793.
  ... ...performed on MDCK-C7 cDNA and on commercial dog kidney cDNA (BioChain, Hayward, CA, USA) using HOTSTAR DNA polymerase (Qiagen, Hilden...performed on MDCK-C7 cDNA and on commercial dog kidney cDNA (BioChain, Hayward, CA, USA) using HOTSTAR DNA polymerase (Qiagen, Hilden... ...
  
Ref. link

• Hui-Wen Lo, Hu Zhu, Xinyu Cao, Amy Aldrich, and Francis Ali-Osman
  A Novel Splice Variant of GLI1 That Promotes Glioblastoma Cell Migration and Invasion
  Cancer Res., Aug 2009; 10.1158/0008-5472.CAN-09-0886.
  ... ...purchased from Sigma unless otherwise stated. cDNAs of normal tissues and genomic DNAs from peripheral leukocytes were from BioChain. Human GBM cell lines were established in our laboratory from primary specimens (7), with the exception of U87MG, T98G, U373MG... ...
  Ref. link
  
  
• Nandor Gabor Than, Roberto Romero, Morris Goodman, Amy Weckle, Jun Xing, Zhong Dong, Yi Xu, Federica Tarquini, Andras Szilagyi, Peter Gal, Zhuocheng Hou, Adi L. Tarca, Chong Jai Kim, Jung-Sun Kim, Saied Haidarian, Monica Uddin, Hans Bohn, Kurt Benirschke, Joaquin Santolaya-Forgas, Lawrence I. Grossman, Offer Erez, Sonia S. Hassan, Peter Zavodszky, Zoltan Papp, and Derek E. Wildman
  A primate subfamily of galectins expressed at the maternal–fetal interface that promote immune cell death
  PNAS, Jun 2009; 106: 9731 - 9736.
  ... ...PowerScript Reverse Transcriptase (BD Biosciences) for P. anubis and A. fusciceps samples. The cDNA for M. mulatta was purchased from Biochain Institute. The amplification of nucleotide sequences from genomic and complementary DNAs was performed by ``primer walk'' by... ...
  Ref. link
  
  
• Yuichi Hashimoto, Megumi Kurita, Sadakazu Aiso, Ikuo Nishimoto, and Masaaki Matsuoka
  Humanin Inhibits Neuronal Cell Death by Interacting with a Cytokine Receptor Complex or Complexes Involving CNTF Receptor /WSX-1/gp130
  Mol. Biol. Cell, Jun 2009; 20: 2864 - 2873.
  ... ...1996). C-terminally myc/6xHis-tagged human WSX-1 and mouse CREME9 cDNA were PCR-amplified from human and mouse embryo cDNAs (Biochain, Hayward, CA). A vector encoding C-terminally V5-tagged human CNTFR was purchased from Invitrogen (Carlsbad, CA). Rat IL-6Ralpha... ...
  Ref. link
  
  
• Chia-Wei Li, Gia Khanh Dinh, and J. Don Chen
  Preferential Physical and Functional Interaction of Pregnane X Receptor with the SMRT Isoform
  Mol. Pharmacol., Feb 2009; 75: 363 - 373.
  ... ...Zhang et al., 2004). Real-time PCR MOL #47845 11 Paired cDNAs from various human normal and tumor samples were purchased from BioChain Institute (Hayward, CA). Normal mouse and human liver cDNA libraries were purchased from Clontech. Total RNA was also isolated... ...
  
Ref. link

• Marina Miller, Jae Youn Cho, Alexa Pham, Joe Ramsdell, and David H. Broide
  Adiponectin and Functional Adiponectin Receptor 1 Are Expressed by Airway Epithelial Cells in Chronic Obstructive Pulmonary Disease
  J. Immunol., Jan 2009; 182: 684 - 691.
  ... ...AdipoR1, and AdipoR2 was conducted using RT-PCR primers and conditions as previously described (17). Human adipose tissue cDNA (BioChain), which is known to express adiponectin, AdipoR1, and AdipoR2, was used as a control. For Western blots, whole A549 cell lysates... ...
  
Ref. link

• Songqing Li, Shang L. Lian, Joanna J. Moser, Mark L. Fritzler, Marvin J. Fritzler, Minoru Satoh, and Edward K. L. Chan
  Identification of GW182 and its novel isoform TNGW1 as translational repressors in Ago2-mediated silencing
  J. Cell Sci., Dec 2008; 121: 4134 - 4144.
  ... ...lines (ATCC, Manassas, VA), and normal adult human testis (BioChain, Hayward, CA) using primer TNRC-1 (5-ATAATGCCAAGCGAGCTACAG...PCR amplification was conducted on the human testis cDNA (BioChain) using primer TNRC-5a [5-TTTGGAAGATCTATGAGAGAATTGGAAGCTAAAGCT-3... ...
  
Ref. link

• Shiho Kawamura, Kieran Hervold, Felipe-Andr¨¨s Ramirez-Weber, and Thomas B. Kornberg
  Two Patched Protein Subtypes and a Conserved Domain of Group I Proteins That Regulates Turnover
  J. Biol. Chem., Nov 2008; 283: 30964 - 30969.
  ... ...mRNA and the FirstChoice RLM-RACE kit (Ambion). Canis familiaris and Rhesus monkey (Macaca mulatta) cDNAs were purchased from BioChain Institute. Primer Design for Reverse Transcription-PCR-Primers were designed based upon predicted CTD sequences and were chosen... ...
  
Ref. link

• Osama M. H. Habayeb, Anthony H. Taylor, Stephen C. Bell, David J. Taylor, and Justin C. Konje
  Expression of the Endocannabinoid System in Human First Trimester Placenta and its Role in Trophoblast Proliferation
  Endocrinology, Oct 2008; 149: 5052 - 5060.
  ... ...CNR01LTN00 and CNR020TN00, respectively; University of Missouri-Rolla cDNA Resource Center, Rolla, MO), FAAH (12), and GAPDH (BioChain Institute Inc., Hayward, CA) cDNA targets adjusted so that a standard curve from 1-10,000,000 pmol cDNA could be constructed... ...
  
Ref. link


• Shiho Kawamura, Kieran Hervold, Felipe-Andres Ramirez-Weber, and Thomas B. Kornberg
  Two patched protein subtypes and a conserved domain of group I proteins that regulates turnover
  J. Biol. Chem., Sep 2008; 10.1074/jbc.M806242200
  ... ...total mRNA and FirstChoice? RLM-RACE (Ambion). Canus familiaris and Rhesus monkey (Macaca mulatto) cDNA were purchased from BioChain Institute. Primer design for Reverse Transcription PCRPrimers were designed based upon predicted CTD sequences and were chosen... ...
  
Ref. link


• Cynthia Shannon Weickert, Ana L. Miranda-Angulo, Jenny Wong, William R. Perlman, Sarah E. Ward, Vakkalanka Radhakrishna, Richard E. Straub, Daniel R. Weinberger, and Joel E. Kleinman
  Variants in the estrogen receptor alpha gene and its mRNA contribute to risk for schizophrenia
  Hum. Mol. Genet., Aug 2008; 17: 2293 - 2309.
  ... ...constructed by PCR amplification of full-length human wild-type ESR1 or delta7 ESR1 from commercially available MCF-7 cDNA (BioChain Institute, Inc. Hayward, CA, USA). Primer pairs used in the amplification contained both XhoI and BamI restriction sites. Primer... ...
  
Ref. link


• Masahiko Ito, Tomohide Shikano, Shoji Oda, Takashi Horiguchi, Satomi Tanimoto, Takeo Awaji, Hiroshi Mitani, and Shunichi Miyazaki
  Difference in Ca²⁺ Oscillation-Inducing Activity and Nuclear Translocation Ability of PLCZ1, an Egg-Activating Sperm Factor Candidate, Between Mouse, Rat, Human, and Medaka Fish
  Biol Reprod, Jun 2008; 78: 1081 - 1090.
  ... ...synthesized by superscript III (Invitrogen Corp., Carlsbad, CA) and human testis cDNA (PCR Ready First Strand cDNA; C1234260; BioChain Institute, Inc., Hayward, CA), respectively. The following primers were used for rat PLCZ1: 5-GGGGTACCGCCACCATGGAGAGCCATTATGA... ...
  
Ref. link


• Yuichi Kondo, Tomohiro Yoshimoto, Koubun Yasuda, Shizue Futatsugi-Yumikura, Mai Morimoto, Nobuki Hayashi, Tomoaki Hoshino, Jiro Fujimoto, and Kenji Nakanishi
  Administration of IL-33 induces airway hyperresponsiveness and goblet cell hyperplasia in the lungs in the absence of adaptive immune system
  Int. Immunol., Jun 2008; 20: 791 - 800.
  ... ...human IL-33 was made by Hokudo Co., Ltd (Sapporo, Japan). Briefly, IL-33 (mature form) was amplified from human lung cDNA (BioChain Institute) as a template and subcloned into pET28a vector (Novagen). BL21 (DE3) RIL was transformed and expressed recombinant... ...
  
Ref. link


• Yan Qun Chen, Ming-Shang Kuo, Shuyu Li, Hai H. Bui, David A. Peake, Philip E. Sanders, Stefan J. Thibodeaux, Shaoyou Chu, Yue-Wei Qian, Yang Zhao, David S. Bredt, David E. Moller, Robert J. Konrad, Anne P. Beigneux, Stephen G. Young, and Guoqing Cao
  AGPAT6 Is a Novel Microsomal Glycerol-3-phosphate Acyltransferase
  J. Biol. Chem., Apr 2008; 283: 10048 - 10057.
  ... ...Human AGPAT6-Human normal tissue cDNA panels were obtained from BioChain (Hayward, CA) and PrimGen (Bothell, WA). TaqMan real time quantitative...Procedures using human normal tissue cDNA panel obtained from BioChain (A) or PrimGen (B). Data were expressed as mean S.D. (n... ...
  
Ref. link


• Victoria L. Robinson, Ore Shalhav, Kristen Otto, Tomoko Kawai, Myriam Gorospe, and Carrie W. Rinker-Schaeffer
  Mitogen-Activated Protein Kinase Kinase 4/c-Jun NH₂-Terminal Kinase Kinase 1 Protein Expression Is Subject to Translational Regulation in Prostate Cancer Cell Lines
  Mol. Cancer Res., Mar 2008; 6: 501 - 508.
  ... ...amplified by PCR (primer sequences: 5-GAGTCAACGGATTTGGTCGT-3 and 5-TGAGCTTGACAAAGTGGTCG-3), and beta-actin was a 838-bp cDNA (BioChain). Drug Treatments Drug solutions and vehicle controls were prepared to final concentrations in the appropriate medium and... ...
  Ref. link
  
• Jennifer L. Strande, Anna Hsu, Jidong Su, Xiangping Fu, Garrett J. Gross, and John E. Baker
  Inhibiting Protease-Activated Receptor 4 Limits Myocardial Ischemia/Reperfusion Injury in Rat Hearts by Unmasking Adenosine Signaling
  J. Pharmacol. Exp. Ther., Mar 2008; 324: 1045 - 1054.
  ... ...from Sigma-Aldrich (St. Louis, MO) unless otherwise specified. PCR. Rat heart PCR Ready First Strand cDNA was purchased from BioChain Institute, Inc. (Hayward, CA). This consists of cDNA reverse transcribed from mRNA pooled from three rat hearts. Forward and... ...
  
Ref. link


• Sheli R. Radoshitzky, Jens H. Kuhn, Christina F. Spiropoulou, C¨¦sar G. Albariño, Dan P. Nguyen, Jorge Salazar-Bravo, Tatyana Dorfman, Amy S. Lee, Enxiu Wang, Susan R. Ross, Hyeryun Choe, and Michael Farzan
  Receptor determinants of zoonotic transmission of New World hemorrhagic fever arenaviruses
  PNAS, Feb 2008; 105: 2664 - 2669.
  ... ...provided by Colin Parrish (Cornell University, Ithaca, NY). R. norvegicus TfR1 (rTfR1) was cloned from a rat liver cDNA library (BioChain) by using the following primers: 5-AATAACTACTTCGAAGCCACCATGGATCAAGCCAGATCAGCATTCTC-3 and 5-AATAACTACCTCGAGTTAAAACTCATTGTCAATATTCCAAATGTCACCAG-3...
  Ref. Link
  
• YanQun Chen, Ming-Shang Kuo, Shuyu Li, Hai H. Bui, David A. Peake, Philip E. Sanders, Stefan J. Thibodeaux, Shaoyou Chu, Yue-Wei Qian, Yang Zhao, David S. Bredt, David E. Moller, Robert J. Konrad, Anne P. Beigneux, Stephen G. Young, and Guoqing Cao
  AGPAT6 Is a novel microsomal glycerol-3-phosphate acyltransferase (GPAT)
  J. Biol. Chem., Jan 2008; 10.1074/jbc.M708151200.
  ... ...AGPAT6--Human normal tissue cDNA panels were obtained from BioChain (Hayward, CA) and PrimGen (Bothell, WA). TaqMan real-time quantitative...Procedures using human normal tissue cDNA panel obtained from BioChain (A) or PrimGen (B). Data were expressed as mean ? SD (n = 3... ...
  Ref. link
  
  
• Jennifer L. Strande, Anna Hsu, Jidong Su, Xiangping Fu, Garrett J. Gross, and John E. Baker
  Inhibiting Protease-Activated Receptor 4 Limits Myocardial Ischemia/Reperfusion Injury in Rat Hearts by Unmasking Adenosine Signaling
  J. Pharmacol. Exp. Ther., Nov 2007; 10.1124/jpet.107.133595.
  ... ...obtained from Sigma (St. Louis, MO) unless otherwise specified. PCR Rat heart PCR Ready First Strand cDNA was purchased from BioChain Institute, Inc (Hayward, CA). This consists of cDNA reverse transcribed from mRNA pooled from three rat hearts. Forward and... ...
  Ref. link
  
  
• Isabelle Goulet, Gabrielle Gauvin, Sophie Boisvenue, and Jocelyn Côt?
  Alternative Splicing Yields Protein Arginine Methyltransferase 1 Isoforms with Distinct Activity, Substrate Specificity, and Subcellular Localization
  J. Biol. Chem., Nov 2007; 282: 33009 - 33021.
  ... ...kindly provided by Dr. Martin Pelchat (University of Ottawa). RT-PCR Analysis-Total human tissue cDNAs were obtained from BioChain (Hayward, CA). PCR were performed in 25-mul reaction mixture using TaqDNA polymerase (Qiagen). cDNAs were amplified using the... ...
  Ref. link
  
  
• Scott H. Long, Marc J. Berna, Michelle Thill, Andrea Pace, Tapas K. Pradhan, K. Martin Hoffmann, Jose Serrano, and Robert T. Jensen
  Secretin-Receptor and Secretin-Receptor-Variant Expression in Gastrinomas: Correlation with Clinical and Tumoral Features and Secretin and Calcium Provocative Test Results
  J. Clin. Endocrinol. Metab., Nov 2007; 92: 4394 - 4402.
  ... ...amplification. In all experiments, dilutions of standard were included, which was human pancreas (Panc) cDNA (lot no. A901107; BioChain Institute, Inc., Hayward, CA). Western blot Pooled tissue from cryosections containing more than 80% tumor was lysed in... ...
  Ref. link
  


• Glenn D. Rosen, Jilin Bai, Yu Wang, Christopher G. Fiondella, Steven W. Threlkeld, Joseph J. LoTurco, and Albert M. Galaburda
  Disruption of Neuronal Migration by RNAi of Dyx1c1 Results in Neocortical and Hippocampal Malformations
  Cereb Cortex, Nov 2007; 17: 2562 - 2572.
  ... ...Dyx1c1 as described below. The cDNA prepared from frontal, parietal, and occipital lobes of human embryonic brain (20 weeks, Biochain Institute, Hayward, CA) was amplified with respective forward and reverse primers (GGG AGA AAT TCA GAA AAT ATA TTT AC and TTA... ...
  Ref. link
  
  
• Isabelle Goulet, Gabrielle Gauvin, Sophie Boisvenue, and Jocelyn Cote
  Alternative splicing yields protein-arginine methyltransferase 1 isoforms with distinct activity, substrate specificity and subcellular localization
  J. Biol. Chem., Sep 2007; 10.1074/jbc.M704349200.
  ... ...was kindly provided by Dr. Martin Pelchat (University of Ottawa). RT-PCR analysis Total human tissue cDNAs were obtained from BioChain (Hayward, California). PCR were performed in 25 ?l reaction mixture using Taq DNA polymerase (Qiagen). cDNAs were amplified... ...
  Ref. link
  


• April Smith Torhan, Boonlert Cheewatrakoolpong, Lia Kwee, and Scott Greenfeder
  Cloning and characterization of the hamster and guinea pig nicotinic acid receptors
  J. Lipid Res., Sep 2007; 48: 2065 - 2071.
  ... ...GPR109A (nicotinic acid receptor) receptor Guinea pig and hamster genomic DNA and cDNA from various tissues were purchased from Biochain Institute, Inc. (Hayward, CA). The Advantage 2 PCR kit was purchased from Clontech (Mountain View, CA). All primers were synthesized... ...
  Ref. link
  
  
• Jeannette M Moebius, Darius Widera, Juergen Schmitz, Christian Kaltschmidt, and Christoph Piechaczek
  Impact of polysialylated CD56 on natural killer cell cytotoxicity
  BMC Immunol. 2007; 8: 13. Published online 2007 August 6. doi: 10.1186/1471-2172-8-13.
  ... ...Human normal adult brain cDNA (1 µl per PCR reaction) and human fetal brain cDNA (2 µl per PCR reaction) were purchased from Biochain Institute, Inc (Hayward, CA, USA).... ...
  Ref. link
  


• Waddah A. Alrefai, Xiaoming Wen, Wen Jiang, Jonathan P. Katz, Kris A Steinbrecher, Mitchell B Cohen, MD, Ifor R. Williams, Pradeep K. Dudeja, and Gary D. Wu
  Molecular Cloning and Promoter Analysis of Down-Regulated in Adenoma DRA
  Am J Physiol Gastrointest Liver Physiol, Aug 2007; 10.1152/ajpgi.00029.2007.
  ... ...small intestine, one step real time PCR was performed utilizing cDNA from duodenum, jejunum and ileum that were obtained from BioChain (Hayward, CA) DNase I footprinting-688(DRA)LUC was digested with Hind III and end labeled with 32 P using Klenow. After releasing... ...
  Ref. link
  


• Scott H. Long, Marc J. Berna, Michelle Thill, Andrea Pace, Tapas K. Pradhan, K. Martin Hoffmann, Jose Serrano, and Robert T. Jensen
  Secretin-Receptor and Secretin-Receptor-Variant Expression in Gastrinomas: Correlation with Clinical and Tumoral Features and Secretin and Calcium Provocative Test Results
  J. Clin. Endocrinol. Metab., Aug 2007; 10.1210/jc.2007-0986.
  ... ...5 min concluded the amplification. In all experiments, dilutions of standard were included, which was human pancreas cDNA (BioChain Institute, Inc., lot no. A901107, Hayward,CA.) Western BlotPooled tissue from cryosections containing >80% tumor were lysed... ...
  Ref. link
  


• Xudong Liao, Wei Wang, Shenghan Chen, and Qingyu Wu
  Role of glycosylation in corin zymogen activation
  J. Biol. Chem., Jul 2007; 10.1074/jbc.M703687200.
  ... ...A human corin cDNA fragment containing the entire open-reading frame was amplified by PCR from a human fetal heart library (BioChain, Hayward, CA) using Phusion High-Fidelity polymerase with sense primer 5'-AGA GAA AAG CGA CCA AGA TAA A-3' and anti-sense primer... ...
  Ref. link
  


• Nattachet Plengvidhya, Suwattanee Kooptiwut, Napat Songtawee, Asako Doi, Hiroto Furuta, Masahiro Nishi, Kishio Nanjo, Wiwit Tantibhedhyangkul, Watip Boonyasrisawat, Pa-thai Yenchitsomanus, Alessandro Doria, and Napatawn Banchuin
  PAX4 Mutations in Thais with Maturity Onset Diabetes of the Young
  J. Clin. Endocrinol. Metab., Jul 2007; 92: 2821 - 2826.
  ... ...PAX4 variant Full-length human wild-type PAX4 cDNA was amplified from PCR Ready First Strand cDNA of normal human placenta (BioChain Institute, Inc., PSA Vista, Singapore) by PCR using platinum Pfx DNA polymerase (Invitrogen, Leek, The Netherlands) and subcloned... ...
  Ref. link
  


• Marie Brulliard, Dalia Lorphelin, Olivier Collignon, Walter Lorphelin, Benoit Thouvenot, Emmanuel Gothi? Sandrine Jacquenet, Virginie Ogier, Olivier Roitel, Jean-Marie Monnez, Pierre Vallois, Frances T. Yen, Olivier Poch, Marc Guenneugues, Gilles Karcher, Pierre Oudet, and Bernard E. Bihain
  Nonrandom variations in human cancer ESTs indicate that mRNA heterogeneity increases during carcinogenesis
  PNAS, May 2007; 104: 7522 - 7527.
  ... ...Tissue Versus Normal Adjacent Tissue. cDNA from cancerous and adjacent normal kidney tissues obtained from the same individual (BioChain; CliniSciences, Montrouge, France) were amplified by PCR with oligonucleotides complementary to the ENO1 gene (positions 1505-1524... ...
  Ref. link
  


• Claudia Palena, Dmitry E. Polev, Kwong Y. Tsang, Romaine I. Fernando, Mary Litzinger, Larisa L. Krukovskaya, Ancha V. Baranova, Andrei P. Kozlov, and Jeffrey Schlom
  The Human T-Box Mesodermal Transcription Factor Brachyury Is a Candidate Target for T-Cell–Mediated Cancer Immunotherapy
  Clin. Cancer Res., Apr 2007; 13: 2471 - 2478.
  ... ...Commercially available tumor tissue-derived cDNAs, prepared from different individuals with different tumor types, were obtained from BioChain Institute Inc. (Hayward, CA). Total RNA from human cancer cell lines and normal CD19+ isolated B cells were prepared by using... ...
  Ref. link
  


• Jaime Kim, Karla A. Temple, Sara A. Jones, Kimberly N. Meredith, Juliana L. Basko, and Matthew J. Brady
  Differential Modulation of 3T3-L1 Adipogenesis Mediated by 11-Hydroxysteroid Dehydrogenase-1 Levels
  J. Biol. Chem., Apr 2007; 282: 11038 - 11046.
  ... ...ACT TAC AAA CAT. Replicate PCRs (final volume, 50 mul) were run using 2.5 ng of murine hepatic or adipocytic cDNA library (Biochain Institute Inc., Hayward, CA), 100 pmol of each primer, and 400 mum dNTPs in 60 mm Tris, pH 9.0, 15 mm ammonium sulfate, 2 mm... ...
  Ref. link
  


• Nattachet Plengvidhya, Suwattnee Kooptiwut, Napat Songtawee, Asako Doi, Hiroto Furata, Masahiro Nishi, Kishio Nanjo, Wiwit Tantibhedhyangkul, Watip Boonyasrisawat, Pa-thai Yenchitsomanus, Alessandro Doria, and Napatawn Banchuin
  PAX4 Mutations in Thais with Maturity-Onset Diabetes of the Young
  J. Clin. Endocrinol. Metab., Apr 2007; 10.1210/jc.2006-1927.
  ... ...Pax4 variant Full-length human wild-type PAX4 cDNA was amplified from PCR Ready First Strand cDNA of normal human placenta (BioChain Institute, Inc., Singapore) by PCR using platinum Pfx DNA polymerase (Invitrogen, Leek, Netherlands) and subcloned into a pcDNA... ...
  Ref. link
  


• Craig S. McLachlan, Melissa L. Chen, Clare N. Lynex, Denise L. M. Goh, Sydney Brenner, and Stacey K. H. Tay
  Changes in PDE4D Isoforms in the Hippocampus of a Patient With Advanced Alzheimer Disease
  Arch Neurol, Mar 2007; 64: 456 - 457.
  ... ...hippocampus by profiling PDE4D expression in the healthy adult and AD hippocampus. Methods Commercial complementary DNA (cDNA) (BioChain Institute, Hayward, Calif) was obtained for 3 normal adult human hippocampal samples and from a patient diagnosed with advanced... ...
  Ref. link
  


• Jaime Kim, Karla A. Temple, Sara A. Jones, Kimberly N. Meredith, Juliana L. Basko, and Matthew J. Brady
  Differential modulation of 3T3-L1 adipogenesis mediated by 11-hydroxysteroid dehydrogenase-1 levels
  J. Biol. Chem., Feb 2007; 10.1074/jbc.M606197200.
  ... ...TAC AAA CAT. Replicate PCR reactions (50 l final volume) were run using 2.5 ng of murine hepatic or adipocytic cDNA library (Biochain Institute Inc, Hayward, CA), 100 pmol of each primer and 400 M dNTPs in 60 mM Tris (pH 9.0)/15 mM ammonium sulfate/2 mM MgCl2... ...
  Ref. link
  


• Noel R. Monks, Shuqian Liu, Yongsheng Xu, Hui Yu, Adam S. Bendelow, and Jeffrey A. Moscow
  Potent cytotoxicity of the phosphatase inhibitor microcystin LR and microcystin analogues in OATP1B1- and OATP1B3-expressing HeLa cells
  Mol. Cancer Ther., Feb 2007; 6: 587 - 598.
  ... ...obtained from the National Cancer Institute Cooperative Human Tissue Network (Columbus, OH). Normal liver cDNA was purchased from Biochain Institute, Inc. (Hayward, CA). Microcystins LR and YR were purchased from Sigma (St. Louis, MO). Microcystin LF, LW, RR, and... ...
  Ref. link
  


• Eduardo R. Butelman, Marek Mandau, Kevin Tidgewell, Thomas E. Prisinzano, Vadim Yuferov, and Mary Jeanne Kreek
  Effects of Salvinorin A, a -Opioid Hallucinogen, on a Neuroendocrine Biomarker Assay in Nonhuman Primates with High -Receptor Homology to Humans
  J. Pharmacol. Exp. Ther., Jan 2007; 320: 300 - 306.
  ... ...OPRK1 ) cDNA. The coding region of the OPRK1 gene was obtained by PCR amplification of M. mulatta brain cDNA (obtained from BioChain, Hayward, CA) with the forward primer 5-TCCTCGCC TT CCTGCTGCA-3, located 30 nucleotides upstream of ATG codon, and the reverse... ...
  Ref. link
  


• Glenn D. Rosen, Jilin Bai, Yu Wang, Christopher G. Fiondella, Steven W. Threlkeld, Joseph J. LoTurco, and Albert M. Galaburda
  Disruption of Neuronal Migration by RNAi of Dyx1c1 Results in Neocortical and Hippocampal Malformations
  Cereb Cortex, Jan 2007; 10.1093/cercor/bhl162.
  ... ...Dyx1c1 as described below. The cDNA prepared from frontal, parietal, and occipital lobes of human embryonic brain (20 weeks, Biochain Institute, Hayward, CA) was amplified with respective forward and reverse primers (GGG AGA AAT TCA GAA AAT ATA TTT AC and TTA... ...
  Ref. link
  


• Eduardo R. Butelman, Marek Mandau, Kevin Tidgewell, Thomas E. Prisinzano, Vadim Yuferov, and Mary Jeanne Kreek
  Effects of Salvinorin A, a -Opioid Hallucinogen, on a Neuroendocrine Biomarker Assay in Nonhuman Primates with High -Receptor Homology to Humans
  J. Pharmacol. Exp. Ther., Jan 2007; 320: 300 - 306.
  ... ...OPRK1 ) cDNA. The coding region of the OPRK1 gene was obtained by PCR amplification of M. mulatta brain cDNA (obtained from BioChain, Hayward, CA) with the forward primer 5-TCCTCGCC TT CCTGCTGCA-3, located 30 nucleotides upstream of ATG codon, and the reverse... ...
  Ref. link
  


• Yoshiyuki Mochida, Duenpim Parisuthiman, Masaru Kaku, Jun-ichi Hanai, Vikas P. Sukhatme, and Mitsuo Yamauchi
  Nephrocan, a Novel Member of the Small Leucine-rich Repeat Protein Family, Is an Inhibitor of Transforming Growth Factor- Signaling
  J. Biol. Chem., Nov 2006; 281: 36044 - 36051.
  ... ...In addition, we cloned and sequenced a dog ortholog of NPN (GenBank accession number; DQ233647) using the dog kidney cDNA (BioChain Institute, Inc., Hayward, CA), and we found that the dog ortholog possesses a gene structure similar to that of mouse. At this... ...
  Ref. link
  


• Vincent Castronovo, David Waltregny, Philippe Kischel, Christoph Roesli, Giuliano Elia, Jascha-N. Rybak, and Dario Neri
  A Chemical Proteomics Approach for the Identification of Accessible Antigens Expressed in Human Kidney Cancer
  Mol. Cell. Proteomics, Nov 2006; 5: 2083 - 2091.
  ... ...clear cell carcinoma, granular cell carcinoma, transitional cell carcinoma, normal adult, and fetal kidney was purchased from BioChain (Hayward, CA). PCR was performed using the Hot Start Taq polymerase kit (Qiagen). PCR conditions were as follows: denaturation... ...
  Ref. link
  


• Eduardo R. Butelman, Marek Mandau, Kevin Tidgewell, Thomas E. Prisinzano, Vadim Yuferov, and Mary Jeanne Kreek
  Effects of salvinorin A, a -opioid hallucinogen, on a neuroendocrine biomarker assay in non-human primates with high -receptor homology to humans
  J. Pharmacol. Exp. Ther., Oct 2006; 10.1124/jpet.106.112417.
  ... ...OPRK1) cDNA: The coding region of the OPRK1 gene was obtained by PCR amplification of Macaca mulatta brain cDNA (obtained from BioChain, Hayward, CA) with the a forward primer 5-TCCTCGCC TT CCTGCTGCA-3, located 30 nucleotides upstream of ATG codon, and a reverse... ...
  Ref. link
  


• Kohsuke Kanekura, Ikuo Nishimoto, Sadakazu Aiso, and Masaaki Matsuoka
  Characterization of Amyotrophic Lateral Sclerosis-linked P56S Mutation of Vesicle-associated Membrane Protein-associated Protein B (VAPB/ALS8)
  J. Biol. Chem., Oct 2006; 281: 30223 - 30233.
  ... ...number NM_014231), and VAMP2 (GenBank accession number NM_014232) were amplified from a human postcentral gyrus cDNA library (Biochain, Hayward, CA) by PCR with a sense primer (5-CGGGATCCACCAATGGCGAAGGTGGAGCAGGTC-3) and an antisense primer (5-GGAATTCCTACAAGGCAATCTTCCCAATAATTAC-3... ...
  Ref. link
  


• Oleg V. Kovalenko, Claudia Wiese, and David Schild
  RAD51AP2, a novel vertebrate- and meiotic-specific protein, shares a conserved RAD51-interacting C-terminal domain with RAD51AP1/PIR51
  Nucleic Acids Res., Oct 2006; 34: 5081 - 5092.
  ... ...transcripts are present in cDNA samples from 16 different adult human tissues (Clontech), 5 different fetal human tissues (BioChain) and 7 different human cell lines (Clontech). The PCR primers used for RAD51AP1 were AP1-5: 5GATGACAAGCTCTACCAGAGAGAC3 and... ...
  Ref. link
  


• Yoshiyuki Mochida, Duenpim Parisuthiman, Masaru Kaku, Jun-ichi Hanai, Vikas P. Sukhatme, and Mitsuo Yamauchi
  Nephrocan, a novel member of the small leucine-rich repeat protein family, is an inhibitor of transforming growth factor-beta signaling
  J. Biol. Chem., Sep 2006; 10.1074/jbc.M604787200.
  ... ...In addition, we cloned and sequenced a dog ortholog of NPN (GenBankTM accession number; DQ233647) using the dog kidney cDNA (BioChain Institute, Inc., Hayward, CA), and we found that the dog ortholog possesses a similar gene structure to that of mouse. At this... ...
  Ref. link
  


• Nawajes A. Mandal and Radha Ayyagari
  Complement Factor H: Spatial and Temporal Expression and Localization in the Eye
  Invest. Ophthalmol. Vis. Sci., Sep 2006; 47: 4091 - 4097.
  ... ...TRIzol. Human major organ cDNAs from brain, liver, lungs, heart, spleen, pancreas, kidney, muscle, and placenta were obtained (BioChain Institute Inc., Hayward, CA) and were used for expression studies. Human retina quick-clone cDNA (Clontech) was also used for... ...
  Ref. link
  


• Ryu Takeya, Masahiko Taura, Tomoko Yamasaki, Seiji Naito, and Hideki Sumimoto
  Expression and function of Noxo1, an alternative splicing form of the NADPH oxidase organizer 1
  FEBS J., Aug 2006; 273: 3663 - 3677.
  ... ...cDNA panels and Human Fetal Neural Tissue cDNA panels (Biochain Institute, Hayward, CA, USA), according to the manufacturer's...analyzed by PCR using Human Fetal Neural Tissue cDNA panels (Biochain Institute). The PCR products were subjected to 10 polyacrylamide... ...
  Ref. link
  


• Silviu Locovei, Li Bao, and Gerhard Dahl
  Pannexin 1 in erythrocytes: Function without a gap
  PNAS, May 2006; 103: 7655 - 7659.
  ... ...Data were normalized to the control condition (incubation in Krebs solution). Human bone marrow cDNA was obtained from BioChain Institute (Hayward, CA). For PCR amplification, the primers gaggtatctgaaagcaccacttcaagtaccc and gaccactgctcttaatattctccagtacc... ...
  


• Ya Xu, Li Lu, Clifford Greyson, Mona Rizeq, Karin Nunley, Beata Wyatt, Michael R. Bristow, Carlin S. Long, and Gregory G. Schwartz
  The PPAR- activator fenofibrate fails to provide myocardial protection in ischemia and reperfusion in pigs
  Am J Physiol Heart Circ Physiol, May 2006; 290: H1798 - H1807.
  ... ...the porcine liver (CPT-Ia) and muscle (CPT-Ib) genes were amplified from normal pig heart and liver with PCR-ready cDNAs (BioChain, Hayward, CA) by using 20-mer primers complementary to bases 196-215 (forward) and 390-409 (reverse) for CPT-Ia and bases... ...
• Akira Kawata, Junko Iida, Mitsunobu Ikeda, Yuji Sato, Hiroki Mori, Ai Kansaku, Kazutaka Sumita, Naoyuki Fujiwara, Chiaki Rokukawa, Mamiko Hamano, Susumu Hirabayashi, and Yutaka Hata
  CIN85 Is Localized at Synapses and Forms a Complex with S-SCAM via Dendrin
  J. Biochem. (Tokyo), May 2006; 139: 931 - 939.
  ... ...5-gcggccgcctctcactgc-ctcttcct-3 for dendrin; 5-gaattcgtggaggccatagtggagtt-3 and 5-gtcgactattttgattgtagagctttc-3 for CIN85) on human brain cDNA (BioChain Institute Inc.). pET32a vector was purchased from Takara Biotechnology. pClneoMyc, pBudCE2 and pBTM116KM vectors were described... ...
  


• Morgan D. Fullerton, Laura Wagner, Zongfei Yuan, and Marica Bakovic
  Impaired trafficking of choline transporter-like protein-1 at plasma membrane and inhibition of choline transport in THP-1 monocyte-derived macrophages
  Am J Physiol Cell Physiol, Apr 2006; 290: C1230 - C1238.
  ... ...30 s at 72C, and a final extension for 10 min at 72C. The CHT1 mRNA in THP-1 cells was compared with human brain cDNA (BioChain) as a positive control using PCR conditions of 94C for 10 min, 40 cycles of 45 s at 94C, 45 s at 50C, and 45 s at 72C... ...
  
  
• M. Petroziello, Maureen C. Ryan, Leia Smith, Ronald Simon, Guido Sauter, Ezogelin Oflazoglu, Svetlana O. Doronina, Damon L. Meyer, Joseph A. Francisco, Paul Carter, Peter D. Senter, John A. Copland, Christopher G. Wood, and Alan F. Wahl
  Lymphocyte Activation Antigen CD70 Expressed by Renal Cell Carcinoma Is a Potential Therapeutic Target for Anti-CD70 Antibody-Drug Conjugates
  Che-Leung Law, Kristine A. Gordon, Brian E. Toki, Andrew K. Yamane, Michelle A. Hering, Charles G. Cerveny, Joseph
  Cancer Res., Feb 2006; 66: 2328 - 2337.
  ... ...hamster ovary cells and purified by protein A chromatography. Human RCC tumor and normal kidney cDNA were purchased from BioChain Institute (Hayward, CA). Fresh frozen RCC tumors were obtained from Bio RESEARCH Support (Boca Raton, FL). Staged frozen... ...
  


• Geoffrey W. Stone, Suzanne Barzee, Victoria Snarsky, Kristin Kee, Celsa A. Spina, Xiao-Fang Yu, and Richard S. Kornbluth
  Multimeric Soluble CD40 Ligand and GITR Ligand as Adjuvants for Human Immunodeficiency Virus DNA Vaccines
  J. Virol., Feb 2006; 80: 1762 - 1772.
  ... ...To construct the plasmid for a 2-trimer soluble form of murine CD40L (pAcrp30-CD40L), cDNA from mouse adipose tissue (BioChain Institute, Inc., Hayward, CA) was used to obtain a PCR product for the 5 untranslated region and 5 coding sequence of Acrp30... ...
  
  
• Tapan K. Bera, Ashley Saint Fleur, Yoomi Lee, Andre Kydd, Yoonsoo Hahn, Nicholas C. Popescu, Drazen B. Zimonjic, Byungkook Lee, and Ira Pastan
  POTE Paralogs Are Induced and Differentially Expressed in Many Cancers
  Cancer Res., Jan 2006; 66: 52 - 56.
  ... ...PCR-ready cDNAs from breast and colon cancers were purchased from OriGene (Gaithersburg, MD) and BioChain Institute, Inc. (Hayward, CA), respectively. PCR was done on cDNA from different normal and cancer tissues following the... ...
  


• Jutamas Ngampasutadol, Sanjay Ram, Anna M. Blom, Hanna Jarva, Ann E. Jerse, Egil Lien, Jon Goguen, Sunita Gulati, and Peter A. Rice
  From The Cover: Human C4b-binding protein selectively interacts with Neisseria gonorrhoeae and results in species-specific infection
  PNAS, Nov 2005; 102: 17142 - 17147.
  ... ...in ref. 18. Sequencing of Rhesus Macaque C4bp CCP1 and Sequence Alignment. Rhesus macaque liver cDNA was purchased from BioChain (Hayward, CA). CCP1 of rhesus C4bp was amplified by using primer pair 5-TCTTCCAAATGACCTTGATCGCTG-3 and 5-GGCTTGGTCTCCAAACGCCTATT-3... ...
  
• Chi-Liang Eric Yen, Charles H. Brown, IV, Mara Monetti, and Robert V. Farese, Jr.
  A human skin multifunctional O-acyltransferase that catalyzes the synthesis of acylglycerols, waxes, and retinyl esters
  J. Lipid Res., Nov 2005; 46: 2388 - 2397.
  ... ...were selected with Primer Express software (Applied Biosystems, Foster City, CA). Human cDNAs of various tissues were from BioChain (Hayward, CA). Insect cell expression studies MFAT cDNAs [with and without an N-terminal FLAG epitope: MGDYKDDDDG... ...
  


• Jonathan D Turner and Claude P Muller
  Structure of the glucocorticoid receptor (NR3C1) gene 5' untranslated region: identification, and tissue distribution of multiple new human exon 1
  J. Mol. Endocrinol., Oct 2005; 35: 283 - 292.
  ... ...CD19+ B cells and CD11c CD123+ (BDCA-4+) plasmacytoid dendritic cells. Hippocampal cDNA (dT16 primed) was obtained from BioChain (Gentaur, Brussels, Belgium). Isolation of mRNA, and reverse transcription Briefly, 106 purified cells or 10 mg of... ...
  
  
• Maria E Mycielska, Christopher P Palmer, William J Brackenbury, and Mustafa B. A Djamgoz
  Expression of Na⁺-dependent citrate transport in a strongly metastatic human prostate cancer PC-3M cell line: regulation by voltage-gated Na⁺ channel activity
  J. Physiol., Mar 2005; 563: 393 - 408.
  ... Human liver and kidney cDNAs were obtained from Biochain (USA). ... 
  ... The quality of cDNAs was verified using primers to {beta}-actin (Biochain). ...
  


• Kohsuke Kanekura, Yuichi Hashimoto, Yoshiko Kita, Jumpei Sasabe, Sadakazu Aiso, Ikuo Nishimoto, and Masaaki Matsuoka
  A Rac1/Phosphatidylinositol 3-Kinase/Akt3 Anti-apoptotic Pathway, Triggered by AlsinLF, the Product of the ALS2 Gene, Antagonizes Cu/Zn-superoxide Dismutase (SOD1) Mutant-induced Motoneuronal Cell Death
  Biol. Chem., Feb 2005; 280: 4532 - 4543.
  ... cDNA was PCR-amplified from cDNAs isolated from the frontal lobe of a human brain cerebrum (BioChain, Hayward, CA) with a sense primer (CGGGATCCATGGCTGCAATCCGAAAGAAGC) and an antisense primer (GGAATTCTCAGAGAATGGGACAGCCCC). ...
  ... A human RhoG cDNA was obtained from a human frontal lobe cDNA library (BioChain) by PCR with a sense primer (CGGGATCCATGCAGAGCATCAAGTGCGTG) and an antisense primer (GGAATTCTCACAAGAGGATGCAGGACC). cDNAs for RhoB, ...
  


• Toshihiro Uchida, Hideo Wada, Minoru Mizutani, Miho Iwashita, Hiroaki Ishihara, Toshiro Shibano, Misako Suzuki, Yumiko Matsubara, Kenji Soejima, Masanori Matsumoto, Yoshihiro Fujimura, Yasuo Ikeda, and Mitsuru Murata
  Identification of novel mutations in ADAMTS13 in an adult patient with congenital thrombotic thrombocytopenic purpura
  Blood, May 2004; 10.1182/blood-2004-02-0715
  ... ADAMTS13 cDNA (GenBank accession number NM139025) was PCR-amplified from a human fetal liver cDNA library (BioChain Institute Inc.), and cloned into 6 pcDNA3.1/myc-His. ...
  


• Kohsuke Kanekura, Yuichi Hashimoto, Takako Niikura, Sadakazu Aiso, Masaaki Matsuoka, and Ikuo Nishimoto
  Alsin, the Product of ALS2 Gene, Suppresses SOD1 Mutant Neurotoxicity through RhoGEF Domain by Interacting with SOD1 Mutants
  Biol. Chem., Apr 2004; 279: 19247 - 19256
  ... DNA Construction —Full-length alsin SF cDNA was obtained from human heart cDNA (BioChain) by PCR using a sense primer (ACTAGTACCATGGACCAAAGAAGAGAAGCTC) and an antisense primer (GCGGCCGCGCTACCAAGCCTTACCCCTTTTAAAG). ...
  ... EcoRI site to the NheI site of alsin LF, was obtained from human thalamus cDNA (BioChain) by PCR using a sense primer (GCTTCCATAGTGGAGCAGTGACAGAC) and an antisense primer (GCGGCCGCCTCAATGAGGCTCCATGCTGACC). ...
  


• Kou Miyazaki, Tomoyuki Fujita, Toshinori Ozaki, Chiaki Kato, Yuka Kurose, Maya Sakamoto, Shinsuke Kato, Takeshi Goto, Yasuto Itoyama, Masashi Aoki, and Akira Nakagawara
  NEDL1, a Novel Ubiquitin-protein Isopeptide Ligase for Dishevelled-1, Targets Mutant Superoxide Dismutase-1
  J. Biol. Chem., Mar 2004; 279: 11327 - 11335. 
  ... For reverse transcription (RT)-PCR analysis, cDNA derived from adult human neural system (BioChain Institute, Hayward, CA) was subjected to PCR amplification using the following primers: NEDL1 , 5′-CCGATTTGAGATCACTTCCTCC-3′ ...
  


• Susumu Hirabayashi, Makiko Tajima, Ikuko Yao, Wataru Nishimura, Hiroki Mori, and Yutaka Hata
  JAM4, a Junctional Cell Adhesion Molecule Interacting with a Tight Junction Protein, MAGI-1
  Mol. Cell. Biol., Jun 2003; 23: 4267 - 4282. ... of mouse JAM1 and mouse JAM4, respectively, were obtained by PCR on mouse lung cDNA (BioChain, Inc.) and kidney cDNA (Clontech). pGex4T-1 and pFLAG-CMV-1 were purchased from Amersham Pharmacia Biotech and ...


• Maurice Phil DeYoung, Matthew Tress, and Ramaswamy Narayanan
  Identification of Down's syndrome critical locus gene SIM2-s as a drug therapy target for solid tumors
  PNAS, Apr 2003; 100: 4760 - 4765. 
  ... Normal and fetal-tissue cDNAs were from CLONTECH and the Biochain Institute (San Leandro, CA).
  


• Thanh H. Vu, Nguyen V. Chuyen, Tao Li, and Andrew R. Hoffman
  Loss of Imprinting of IGF2 Sense and Antisense Transcripts in Wilms' Tumor
  Cancer Res., Apr 2003; 63: 1900 - 1905. 
  ... cDNAs from poly(A + ) RNA were also obtained from Clontech (Palo Alto, CA) and Biochain (San Leandro, CA). ...
  
  
• Hideto Jinno, Toshiko Tanaka-Kagawa, Nobumitsu Hanioka, Mayumi Saeki, Seiichi Ishida, Tetsuji Nishimura, Masanori Ando, Yoshiro Saito, Shogo Ozawa, and Jun-ichi Sawada
  Glucuronidation of 7-Ethyl-10-hydroxycamptothecin (SN-38), an Active Metabolite of Irinotecan (CPT-11), by Human UGT1A1 Variants, G71R, P229Q, and Y486D
  Drug Metab. Dispos., Jan 2003; 31: 108 - 113. 
  ...Human adult normal liver cDNA was purchased from BioChain Institute Inc. ...
  


• Tatsuya Sawasaki, Tomio Ogasawara, Ryo Morishita, and Yaeta Endo
  A cell-free protein synthesis system for high-throughput proteomics
  PNAS, Nov 2002; 99: 14652 - 14657. 
  ... These genes were cloned from tissue (heart, brain, kidney, liver, placenta) cDNAs (BioChain Institute, #0516001).
  


• Minori Kono, Hidetaka Nagata, Sinobu Umemura, Seiji Kawana, and R. Yoshiyuki Osamura
  In situ expression of corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) genes in human skin
  FASEB J, Aug 2001; 102541. 
  ... (pituitary gland and thalamus cDNA from BioChain...)