Promotions

Genomic DNA:

• C.L. Galindo, L.J. McIver, J.F. McCormick, M.A. Skinner, Y. Xie, R.A. Gelhausen, K. Ng, N.M. Kumar, and H.R. Garner
  Global Microsatellite Content Distinguishes Humans, Primates, Animals, and Plants
  Mol. Biol. Evol., Dec 2009; 26: 2809 - 2819.
  ... ...genomic DNA was purchased from Coriell Cell Repositories (Camden, NJ), and Arabidopsis and corn genomic DNA was purchased from Biochain Institute, Inc. (Hayward, CA). Alaskan husky and Angus bull genomic DNA was graciously provided by John Fondon III (University... ...
  Ref. link
  
  
• Kazumori Kawakami, Hiroshi Hirata, Soichiro Yamamura, Nobuyuki Kikuno, Sharanjot Saini, Shahana Majid, Yuichiro Tanaka, Ken Kawamoto, Hideki Enokida, Masayuki Nakagawa, and Rajvir Dahiya
  Functional Significance of Wnt Inhibitory Factor-1 Gene in Kidney Cancer
  Cancer Res., Nov 2009; 69: 8603 - 8610.
  ... ...EpiTect Bisulfite kit (Qiagen) following the manufacturer's directions. The genomic DNA from adult human normal kidney tissue (BioChain) was also modified and used as a control. Primers for bisulfite genomic sequencing PCR were designed by using the online program... ...
  Ref. link
  
  
• Leah R Villegas, Theodore J Kottom, and Andrew H. Limper
  Characterization of PCEng2 a -1,3-Endoglucanase Homologue in Pneumocystis carinii with Activity in Cell Wall Regulation
  Am. J. Respir. Cell Mol. Biol., Sep 2009; 10.1165/rcmb.2009-0131OC.
  ... ...restriction enzyme (HindIII or EcoRI, Promega, Inc.) for 4 hours at 37°C. Genomic DNA (10µg) from normal rat lung tissue (BioChain) was also digested under the same conditions as controls. The digested genomic DNA was then electrophoresed through a 1% agarose... ...
  Ref. link
  
  
• Huiqing Chen, Kyunghee Yang, Suyoung Choi, James H. Fischer, and Hyunyoung Jeong
  Up-Regulation of UDP-Glucuronosyltransferase (UGT) 1A4 by 17β-Estradiol: A Potential Mechanism of Increased Lamotrigine Elimination in Pregnancy
  Drug Metab. Dispos., Sep 2009; 37: 1841 - 1847.
  ... ...construct the pGL3-UGT1A4 plasmid, the upstream region of UGT1A4 (-2399 to +28) was PCR-amplified using human genomic DNA (Biochain, Hayward, CA) as the template and a pair of primers: forward and reverse primers of 5-TGCCTACCACAGACACTAAG-3 and 5-TCAGCAGAAGCCACCGAC-3... ...
  Ref. link
  
  
• Sivan Osenberg, Dan Dominissini, Gideon Rechavi, and Eli Eisenberg
  Widespread cleavage of A-to-I hyperediting substrates
  RNA, Sep 2009; 15: 1632 - 1639.
  ... ...Experimental materials and methods Human adult hippocampus total RNA and genomic DNA from the same subject were purchased from Biochain. For RT-PCR, each RNA sample was treated with DNase I (Invitrogen) and reverse transcribed using M-MLV RT and random hexamers... ...
  Ref. link
  
  
• Hui-Wen Lo, Hu Zhu, Xinyu Cao, Amy Aldrich, and Francis Ali-Osman
  A Novel Splice Variant of GLI1 That Promotes Glioblastoma Cell Migration and Invasion
  Cancer Res., Aug 2009; 10.1158/0008-5472.CAN-09-0886.
  ... ...purchased from Sigma unless otherwise stated. cDNAs of normal tissues and genomic DNAs from peripheral leukocytes were from BioChain. Human GBM cell lines were established in our laboratory from primary specimens (7), with the exception of U87MG, T98G, U373MG... ...
  Ref. link
  
  
• Hehuang Xie, Min Wang, Maria de F. Bonaldo, Christina Smith, Veena Rajaram, Stewart Goldman, Tadanori Tomita, and Marcelo B. Soares
  High-throughput sequence-based epigenomic analysis of Alu repeats in human cerebellum
  Nucleic Acids Res., Jul 2009; 37: 4331 - 4340.
  ... ...those in the remainder Alu elements. DNA samples Human genomic DNA samples for fetal adrenal gland tissues were purchased (BioChain Inc., Hayward, CA). Human snap-frozen cerebellum and cortex tissues were obtained from the tissue bank of the Department of... ...
  Ref. link
  
  
• Paul N. Kongkham, Paul A. Northcott, Young Shin Ra, Yukiko Nakahara, Todd G. Mainprize, Sidney E. Croul, Christian A. Smith, Michael D. Taylor, and James T. Rutka
  An Epigenetic Genome-Wide Screen Identifies SPINT2 as a Novel Tumor Suppressor Gene in Pediatric Medulloblastoma
  Cancer Res., Dec 2008; 68: 9945 - 9953.
  ... ...culture were purchased from Wisent, Inc. Normal human fetal and adult cerebellar genomic DNA and RNA samples were purchased from Biochain. 5-aza-dC treatment protocol, reverse transcription-PCR/quantitative real-time PCR, and affymetrix HG U133 plus 2.0 expression... ...
  Ref. link
  
  
• Daniel Diaczok, Christopher Romero, Janice Zunich, Ian Marshall, and Sally Radovick
  A Novel Dominant Negative Mutation of OTX2 Associated with Combined Pituitary Hormone Deficiency
  J. Clin. Endocrinol. Metab., Nov 2008; 93: 4351 - 4359.
  ... ...informed consent and with appropriate institutional review board approval. Control DNA (n 50) was obtained from healthy adults (Biochain, Hayward, CA). Genomic DNA was prepared from peripheral blood using the DNeasy Tissue Kit (QIAGEN, Inc., Valencia, CA). DNA... ...
  Ref. link
  
  
• Willemijn M. Gommans, Nicholas E. Tatalias, Christina P. Sie, Dylan Dupuis, Nicholas Vendetti, Lauren Smith, Rikhi Kaushal, and Stefan Maas
  Screening of human SNP database identifies recoding sites of A-to-I RNA editing
  RNA, Oct 2008; 14: 2074 - 2085.
  ... ...RNA editing analysis For experimental validation, human brain total RNA and gDNA isolated from the same specimen (Biochain) were used and processed using standard protocols for reverse transcription and PCR (see Supplemental Table S1 for primer sequences... ...
  Ref. link
  
  
• Yi-Chun Liao, Yi-Ping Shih, and Su Hao Lo
  Mutations in the Focal Adhesion Targeting Region of Deleted in Liver Cancer-1 Attenuate Their Expression and Function
  Cancer Res., Oct 2008; 68: 7718 - 7722.
  ... ...Materials and Methods Mutation analysis. Prostate cDNA and colon genomic DNA samples were purchased from OriGene Technologies and BioChain, respectively. DNA fragments were amplified by PCR using DLC-1 primers 5-GGCAGCCTGCCCTCTCCCAAGGAA (forward) and 5-CAGGGCTGAGTCCGAATCTCCCTC-3... ...
  Ref. link
  
  
• Maile Reed Brown, Jack Kronengold, Valeswara-Rao Gazula, Charalampos G. Spilianakis, Richard A. Flavell, Christian A. von Hehn, Arin Bhattacharjee, and Leonard K. Kaczmarek
  Amino-termini isoforms of the Slack K⁺ channel, regulated by alternative promoters, differentially modulate rhythmic firing and adaptation
  J. Physiol., Sep 2008; 10.1113/jphysiol.2008.160861. 
  ... ...amino-terminus (forward primer CCCATCTTCTTCCTTCCCTGAGCCGTC and reverse primer ATCCTGCGGGAGCGCTTGGCGC). Using PCR-ready rat genomic DNA (Biochain, Hayward CA, USA) and Pfu Turbo, 2 kb products were amplified and subcloned using the TA cloning kit (Invitrogen), and sequenced... ...
  Ref. link
  
  
• Elizabeth E. Brittle, Fushan Wang, John M. Lubinski, Ralph M. Bunte, and Harvey M. Friedman
  A Replication-Competent, Neuronal Spread-Defective, Live Attenuated Herpes Simplex Virus Type 1 Vaccine
  J. Virol., Sep 2008; 82: 8431 - 8441.
  ... ...Applied Biosystems). Standard curves were derived using 5 to 107 copies of HSV-1 DNA and 5 to 105 copies of murine cellular DNA (Biochain, Hayward, CA). RT qPCR results were expressed as the HSV-1 DNA copy number per 5 105 copies of murine adipsin. Explant... ...
  Ref. link
  
  
• Daniel Diaczok, Christopher Romero, Janice Zunich, Ian Marshall, and Sally Radovick
  A Novel Dominant Negative Mutation of OTX2 Associated with Combined Pituitary Hormone Deficiency
  J. Clin. Endocrinol. Metab., Aug 2008; 10.1210/jc.2008-1189.
  ... ...informed consent and with appropriate Institutional Review Board approval. Control DNA (n=50) was obtained from healthy adults (Biochain, Hayward, CA). Genomic DNA was prepared from peripheral blood using DNeasy Tissue Kit (QIAGEN, Valencia, CA). DNA from 19 patients... ...
  Ref. link
  
• Jian Qin, Robert C. Jones, and Ramesh Ramakrishnan
  Studying copy number variations using a nanofluidic platform
  Nucleic Acids Res., Aug 2008; 10.1093/nar/gkn518.
  ... ...We used digital arrays to analyze the ERBB2 copy numbers of 40 breast cancer and 8 normal breast tissue DNA samples from BioChain (Hayward, CA). All DNA samples were from Asian individuals except one normal sample that was from a Caucasian. Of the 40 breast... ...
  Ref. link
  
  
• Seonhoe Kim, Ui Jin Lee, Mi Na Kim, Eun-Ju Lee, Ji Young Kim, Mi Young Lee, Sorim Choung, Young Joo Kim, and Young-Chul Choi
  MicroRNA miR-199a^* Regulates the MET Proto-oncogene and the Downstream Extracellular Signal-regulated Kinase 2 (ERK2)
  J. Biol. Chem., Jun 2008; 283: 18158 - 18166.
  ... ...cells using the DNA Wizard Genomic DNA Purification Kit (Promega). DNA from human normal and tumor tissues were obtained from Biochain (Hayward, CA). Prior to treatment with bisulfite, DNA was digested with NcoI (New England Biolabs, Ipswich, MA). The digested... ...
  Ref. link
  
  
• Zheng Chen, Mireille Montcouquiol, Rene Calderon, Nancy A. Jenkins, Neal G. Copeland, Matthew W. Kelley, and Konrad Noben-Trauth
  Jxc1/Sobp, Encoding a Nuclear Zinc Finger Protein, Is Critical for Cochlear Growth, Cell Fate, and Patterning of the Organ of Corti
  J. Neurosci., Jun 2008; 28: 6633 - 6641.
  ... ...purchased from Clontech Laboratories. Rat and chicken genomic DNA was purchased from Seegene. Rhesus genomic DNA was obtained from BioChain Institute, Takifugu rubripes genomic DNA was obtained from Genservice, and Anopheles gambiae flies were obtained from American... ...
  Ref. link
  
  
• Yih-Jyh Shann, Ching Cheng, Chun-Hui Chiao, Dow-Tien Chen, Pei-Hsin Li, and Ming-Ta Hsu
  Genome-wide mapping and characterization of hypomethylated sites in human tissues and breast cancer cell lines
  Genome Res., May 2008; 18: 791 - 801. 
  ... ...addition, samples of genomic DNA of human brain, breast, liver, testis, leukocytes, and breast tumor tissues, were purchased from BioChain. Preparation of RNA Cells were rinsed twice with 1 PBS. Total RNA was extracted according to the RNeasy Mini Kit Spin Protocol... ...
  Ref. link
  
  
• Kaiko Kunii, Lenora Davis, Julie Gorenstein, Harold Hatch, Masakazu Yashiro, Alessandra Di Bacco, Cem Elbi, and Bart Lutterbach
  FGFR2-Amplified Gastric Cancer Cell Lines Require FGFR2 and Erbb3 Signaling for Growth and Survival
  Cancer Res., Apr 2008; 68: 2340 - 2348.
  ... ...s at 95C, and 1 min at 60C). Data were normalized to RNase P and then to the calibrator sample (normal stomach genomic DNA, BioChain Institute D1234248). Fluorescence in situ hybridization analysis. KatoIII gastric carcinoma cells were treated with colcemid... ...
  Ref. link
  
  
• Mathias Ehrich, Julia Turner, Peter Gibbs, Lara Lipton, Mara Giovanneti, Charles Cantor, and Dirk van den Boom
  Cytosine methylation profiling of cancer cell lines
  PNAS, Mar 2008; 105: 4844 - 4849.
  ... ...D123062), breast (D1234086), colon (D1234090), kidney (D1234142), leukocyte (D1234148), and lung (D1234152) were obtained from BioChain. Clinical Colon Cancer Tissue. Tissue colorectal cancer and normal colon tissue samples were obtained from the Royal Melbourne... ...
  Ref. Link
  
  
• Lingbao Ai, Wan-Ju Kim, Berna Demircan, Lisa M. Dyer, Kevin J. Bray, Ryan R. Skehan, Nicole A. Massoll, and Kevin D. Brown
  The transglutaminase 2 gene (TGM2), a potential molecular marker for chemotherapeutic drug sensitivity, is epigenetically silenced in breast cancer
  Carcinogenesis, Mar 2008; 29: 510 - 518.
  ... ...30 s; 60C (for M primer set) or 56C (for U primer set), 30 s] and final extension at 72C for 10 min. Human placental gDNA (Biochain Institute, Hayward, CA) either unmodified or methylated in vitro with SssI methylase (NEB, Ipswich, MA) was used as validation... ...  
  
Ref. link

• Anilkumar Bettegowda, Jianbo Yao, Aritro Sen, Qinglei Li, Kyung-Bon Lee, Yasuhiro Kobayashi, Osman V. Patel, Paul M. Coussens, James J. Ireland, and George W. Smith
  JY-1, an oocyte-specific gene, regulates granulosa cell function and early embryonic development in cattle
  PNAS, Nov 2007; 104: 17602 - 17607.
  ... ...RNA digestion and DNA precipitation. RNase-treated human genomic DNA (source: liver) was purchased from a commercial vendor (Biochain Institute., Hayward CA). Southern blot was prepared by digesting ?5 mg of genomic DNA per sample with EcoRI for... ...
  Ref. link
  
  
• KyeongJin Kim, Hyeong Hoe Kim, Joon Hong Kim, Yung Hyun Choi, Young Hee Kim, and JaeHun Cheong
  Chemokine stromal cell-derived factor-1 induction by C/EBP?activation is associated with all-trans-retinoic acid-induced leukemic cell differentiation
  J. Leukoc. Biol., Nov 2007; 82: 1332 - 1339.
  ... ...was amplified by PCR from normal human spleen genomic DNA (BioChain Institute, Inc., Hayward, CA, USA) using the primer set, SDF-1-1918...GCT CGA GCG GTT ACT TGT TTA AAG C-3) from human liver cDNA (BioChain Institute). The PCR product was ligated into the pcDNA expression... ...
  Ref. link
  


• Hirohide Yoshikawa, Kenichi Matsubara, Xiaoling Zhou, Shu Okamura, Takahiko Kubo, Yaeko Murase, Yuko Shikauchi, Manel Esteller, James G. Herman, Xin Wei Wang, and Curtis C. Harris
  WNT10B Functional Dualism: -Catenin/Tcf-dependent Growth Promotion or Independent Suppression with Deregulated Expression in Cancer
  Mol. Biol. Cell, Nov 2007; 18: 4292 - 4303.
  ... ...medium, supplemented with 10% fetal bovine serum. Normal DNA and RNA samples (liver, colon, and placenta) were purchased from Biochain Institute (Hayward, CA) and BD Biosciences (Palo Alto, CA). Primary HCC samples are as described previously (Yoshikawa et al... ...
  Ref. link
  
  
• Changfa Guo, Husnain Kh. Haider, Winston S.N. Shim, Ru-San Tan, Lei Ye, Shujia Jiang, Peter K. Law, Philip Wong, and Eugene K.W. Sim
  Myoblast-based cardiac repair: Xenomyoblast versus allomyoblast transplantation
  J. Thorac. Cardiovasc. Surg., Nov 2007; 134: 1332 - 1339.
  ... ...QIAGEN), according to the manufacturers instructions. Male genomic DNA from human subjects (Research Instruments) or rats (Biochain) was used as standard after a serial dilution (5). Real-time PCR analysis was performed with the SYBR Green kit (ABgene). Briefly... ...
  Ref. link
  


• April Smith Torhan, Boonlert Cheewatrakoolpong, Lia Kwee, and Scott Greenfeder
  Cloning and characterization of the hamster and guinea pig nicotinic acid receptors
  J. Lipid Res., Sep 2007; 48: 2065 - 2071.
  ... ...GPR109A (nicotinic acid receptor) receptor Guinea pig and hamster genomic DNA and cDNA from various tissues were purchased from Biochain Institute, Inc. (Hayward, CA). The Advantage 2 PCR kit was purchased from Clontech (Mountain View, CA). All primers were synthesized... ...
  Ref. link
  
  
• Hirohide Yoshikawa, Kenichi Matsubara, Xiaoling Zhou, Shu Okamura, Takahiko Kubo, Yaeko Murase, Yuko Shikauchi, Manel Esteller, James G. Herman, Xin Wei Wang, and Curtis C. Harris
  WNT10B Functional Dualism: -Catenin/Tcf-dependent Growth Promotion or Independent Suppression with Deregulated Expression in Cancer
  Mol. Biol. Cell, Aug 2007; 10.1091/mbc.E06-10-0889.
  ... ...1640, supplemented with 10% fetal bovine serum. Normal DNA and RNA samples (liver, colon, and placenta) were purchased from Biochain Institute, Inc. (Hayward, CA) and BD Biosciences (Palo Alto, CA). Primary HCC samples are as described(Ye et al., 2003; Yoshikawa... ...
  Ref. link
  


• KyeongJin Kim, Hyeong Hoe Kim, Joon Hong Kim, Yung Hyun Choi, Young Hee Kim, and JaeHun Cheong
  Chemokine stromal cell-derived factor-1 induction by C/EBP activation is associated with all-trans-retinoic acid-induced leukemic cell differentiation
  J. Leukoc. Biol., Jul 2007; 10.1189/jlb.1106697.
  ... ...was amplified by PCR from normal human spleen genomic DNA (BioChain Institute, Hayward, CA, USA) 1 Correspondence: Department of...GCT CGA GCG GTT ACT TGT TTA AAG C-3) from human liver cDNA (BioChain Institute). The PCR product was ligated into the pcDNA expression... ...
  Ref. link
  
  
• Qiwei Yang, Colleen M. Kiernan, Yufeng Tian, Helen R. Salwen, Alexandre Chlenski, Babette A. Brumback, Wendy B. London, and Susan L. Cohn
  Methylation of CASP8, DCR2, and HIN-1 in Neuroblastoma Is Associated with Poor Outcome
  Clin. Cancer Res., Jun 2007; 13: 3191 - 3197.
  ... ...bisulfite using the CpGenome DNA Modification Kit (Intergen Co.). Genomic DNA from human normal adrenal tissue was purchased from BioChain Institute, Inc. As previously described (3), 1 mug of genomic DNA was denatured by NaOH and modified by sodium bisulfite, which... ...
  Ref. link
  
  
• Helen C. Turner, Murat T. Budak, M. A. Murat Akinci, and J. Mario Wolosin
  Comparative Analysis of Human Conjunctival and Corneal Epithelial Gene Expression with Oligonucleotide Microarrays
  Invest. Ophthalmol. Vis. Sci., May 2007; 48: 2050 - 2061.
  ... ...sample in which the reverse transcriptase was omitted from the transcription reaction, and three contained human genomic DNA (Biochain, Hayward, CA). Products were analyzed by agarose (4%) gel chromatography. Relative amounts of the target genes in the corneal... ...
  Ref. link
  
  
• Youngsoo Kim, Joon Won Yoon, Xiaokun Xiao, Nicholas M. Dean, Brett P. Monia, and Eric G. Marcusson
  Selective Down-Regulation of Glioma-Associated Oncogene 2 Inhibits the Proliferation of Hepatocellular Carcinoma Cells
  Cancer Res., Apr 2007; 67: 3583 - 3593
  ... ...Genomic DNA was either isolated from HCC cells using Genomic DNA Isolation kit (BioVision, Mountain View, CA) or purchased from Biochain Institute, Inc. (Hayward, CA) for normal human heart and liver tissues. PCR amplification was done using PfuUltra High-Fidelity... ...
  Ref. link
  
  
• Vivianne Deng, Valerie Matagne, Fatima Banine, Matthew Frerking, Patricia Ohliger, Sarojini Budden, Jonathan Pevsner, Gregory A. Dissen, Larry S. Sherman, and Sergio R. Ojeda
  FXYD1 is an MeCP2 target gene overexpressed in the brains of Rett syndrome patients and Mecp2-null mice
  Hum. Mol. Genet., Mar 2007; 16: 640 - 650.
  ... ...Bisulfite PCR sequencing of human and mouse genomic DNA Genomic DNA from adult human brain and heart were purchased from BioChain, Inc. (Hayward, CA, USA). Genomic DNA from the mouse FC and CB was extracted as described (53). The presence of 5'-methylcytosines... ...
  Ref. link
  
  
• Nashi Widodo, Custer C. Deocaris, Kamaljit Kaur, Kamrul Hasan, Tomoko Yaguchi, Kazuhiko Yamasaki, Takashi Sugihara, Tetsuro Ishii, Renu Wadhwa, and Sunil C. Kaul
  Stress Chaperones, Mortalin, and Pex19p Mediate 5-Aza-2' Deoxycytidine-Induced Senescence of Cancer Cells by DNA Methylation-Independent Pathway
  J. Gerontol. A Biol. Sci. Med. Sci., Mar 2007; 62: 246 - 255.
  ... ...and tumor-derived human cells and tumor tissues (59-61). In a panel of normal and tumor tissues from the same individuals (Biochain, Hayward, CA), we detected a higher level of expression of mortalin in tumor tissues as compared to their normal counterparts... ...
  Ref. link
  
  
• Bart Lutterbach, Qinwen Zeng, Lenora J. Davis, Harold Hatch, Gaozhen Hang, Nancy E. Kohl, Jackson B. Gibbs, and Bo-Sheng Pan
  Lung Cancer Cell Lines Harboring MET Gene Amplification Are Dependent on Met for Growth and Survival
  Cancer Res., Mar 2007; 67: 2081 - 2088.
  ... ...cycles of 15 s 92C; and 1 min 60C) Data were normalized to RNase P and then to the calibrator sample (normal lung genomic DNA; BioChain Institute, Hayward, CA). ShRNA production and infection. shRNA sequences for Met were M1: GAAGATCACGAAGATCCCATTCAAGAGATGGGATCTTCGTGATCTTC... ...
  Ref. link
  
  
• Shen Qu, Dongming Su, Jennifer Altomonte, Adama Kamagate, Jing He, German Perdomo, Tonia Tse, Yu Jiang, and H. Henry Dong
  PPAR mediates the hypolipidemic action of fibrates by antagonizing FoxO1
  Am J Physiol Endocrinol Metab, Feb 2007; 292: E421 - E434.
  ... ...mouse FoxO1 promoter 1,748/407 nucleotide (nt), including the 5-untranslated region, was cloned from Balb/C mouse genomic DNA (BioChain Institute, Hayward, CA) into the TA-cloning vector pCR2.1 (Invitrogen) by PCR using specific primers (for forward reaction... ...
  Ref. link
  
  
• Shen Qu, Dongming Su, Jennifer Altomonte, Adama Kamagate, Jing He, German Perdomo, Tonia Tse, Yu Jiang, and H. Henry Dong
  PPAR- Mediates the Hypolipidemic Action of Fibrates by Antagonizing FoxO1
  Am J Physiol Endocrinol Metab, Sep 2006; 10.1152/ajpendo.00157.2006.
  ... ...2-kb mouse FoxO1 promoter (-1748/+407 nt) including the 5'-untranslated region (UTR) was cloned from Balb/C mouse genomic DNA (BioChain Institute Inc., Hayward, CA) into the TA-cloning vector pCR2.1 (Invitrogen) by PCR using specific primers (for forward reaction... ...
  Ref. link
  


• Daniel A. Peiffer, Jennie M. Le, Frank J. Steemers, Weihua Chang, Tony Jenniges, Francisco Garcia, Kirt Haden, Jiangzhen Li, Chad A. Shaw, John Belmont, Sau Wai Cheung, Richard M. Shen, David L. Barker, and Kevin L. Gunderson
  High-resolution genomic profiling of chromosomal aberrations using Infinium whole-genome genotyping
  Genome Res., Sep 2006; 16: 1136 - 1148.
  ... ...leukemia cell line (HL-60) was also obtained from ATCC (ATCC No. HL60). The paired colon tumor genomic DNA was obtained from BioChain (A704198). For the DNA fragmentation experiments, cell line NA60136 was obtained from Coriell as was the cell line exhibiting... ...
  Ref. link
  
  
• Emmanuel Zorn, Erik A. Nelson, Mehrdad Mohseni, Fabrice Porcheray, Haesook Kim, Despina Litsa, Roberto Bellucci, Elke Raderschall, Christine Canning, Robert J. Soiffer, David A. Frank, and Jerome Ritz
  IL-2 regulates FOXP3 expression in human CD4+CD25+ regulatory T cells through a STAT-dependent mechanism and induces the expansion of these cells in vivo
  Blood, Sep 2006; 108: 1571 - 1579.
  ... ...the UCSC genome browser, May 2004 assembly ( http://genome.ucsc.edu ). FOXP3 genomic DNA was amplified from human breast DNA (BioChain, Hayward, CA) using the following primers: 5-GGACGTCCCTTTCTGACTG-3 and 5-TCACCTACCACATCCACCAG-3. Amplified DNA was cloned using... ...
  Ref. link
  


• Lingbao Ai, Wan-Ju Kim, Tae-You Kim, C. Robert Fields, Nicole A. Massoll, Keith D. Robertson, and Kevin D. Brown
  Epigenetic Silencing of the Tumor Suppressor Cystatin M Occurs during Breast Cancer Progression
  Cancer Res., Aug 2006; 66: 7899 - 7909.
  ... ...polyacrylamide gels and the gel was stained with ethidium bromide and directly visualized under UV illumination. Human placental gDNA (Biochain Institute, Hayward, CA) was used in primer validation experiments and methylated in vitro with SssI methylase (NEB, Ipswich... ...
  Ref. link
  
  
• Erik A. Nelson, Sarah R. Walker, Wei Li, X. Shirley Liu, and David A. Frank
  Identification of human STAT5-dependent gene regulatory elements based on inter-species homology
  J. Biol. Chem., Jul 2006; 10.1074/jbc.M605001200.
  ... ...between human, chimp, mouse, and rat were selected for subsequent analysis. Reporter gene construction: Human breast DNA (BioChain, Hayward, CA) was amplified with primers spanning the conserved NCAM2 intronic region with the following sequences: ACACATCCTTCATACCAGGAAA... ...
  


• Blow MJ, Grocock RJ, van Dongen S, Enright AJ, Dicks E, Futreal PA, Wooster R, Stratton MR.
  RNA editing of human microRNAs
  Genome Biol. 2006; 7(4): R27.
  ... ...For the initial screen of RNA editing in ten human tissues, total RNA and matching genomic DNA from the same tissue sample was obtained for human brain, heart, liver, lung, ovary, placenta, skeletal muscle, small intestine, spleen and testis from Biochain (Hayward, USA). ... ...
  Ref. link
  
• Emmanuel Zorn, Erik A Nelson, Mehrdad Mohseni, Fabrice Porcheray, Haesook Kim, Despina Litsa, Roberto Bellucci, Elke Raderschall, Christine Canning, Robert J Soiffer, David A Frank, and Jerome Ritz
  IL-2 regulates FOXP3 expression in human CD4+CD25+ regulatory T cells through a STAT dependent mechanism and induces the expansion of these cells in vivo
  Blood, Apr 2006; 10.1182/blood-2006-02-004747.
  ... ...UCSC genome browser, May 2004 assembly (http://genome.ucsc.edu). FOXP3 genomic DNA was amplified from human breast DNA (BioChain, Hayward, CA) using the following primers: 5'-GGACGTCCCTTTCTGACTG-3' and 5'-TCACCTACCACATCCACCAG-3'. Amplified DNA was... ...
  
  
• Gong X, Tsai SW, Yan B, Rubin LP.
  Cooperation between MEF2 and PPAR? in human intestinal ??carotene 15,15'-monooxygenase gene expression
  BMC Mol Biol. 2006; 7: 7.
  ... ...A 1022 bp BCMO1 promoter fragment spanning nt 79828775 to 79829795 [Ensembl Gene, ENSG00000135697] [54] was amplified by the polymerase chain reaction (PCR) from human liver genomic DNA (BioChain Institute, Hayward, CA) using a 5' primer .... ...
  Ref. link
  


• Nadia Felli, Laura Fontana, Elvira Pelosi, Rosanna Botta, Desirée Bonci, Francesco Facchiano, Francesca Liuzzi, Valentina Lulli, Ornella Morsilli, Simona Santoro, Mauro Valtieri, George Adrian Calin, Chang-Gong Liu, Antonio Sorrentino, Carlo M. Croce, and Cesare Peschle
  MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation
  PNAS, Dec 2005; 102: 18081 - 18086.
  ... ..Plasmids and Constructs. PGL3-3' UTR plasmid. Kit 3' UTR was cloned from human spleen genomic DNA (BioChain, Hayward, CA) by using the forward primer 5'-CTCGAGCGTCTTAGTCCAAACCCAG-3' and the reverse primer 5'-CTCGAGCAAGGACAAAAGATCT-3...
  


• Erez Y. Levanon, Martina Hallegger, Yaron Kinar, Ronen Shemesh, Kristina Djinovic-Carugo, Gideon Rechavi, Michael F. Jantsch, and Eli Eisenberg
  Evolutionarily conserved human targets of adenosine to inosine RNA editing
  Nucleic Acids Res., Feb 2005; 33: 1162 - 1168.
  ... RNA and genomic DNA (gDNA) isolated simultaneously from the same tissue sample were purchased from Biochain Institute (Hayward, CA). ...
  
  
• Qiwei Yang, Peter Zage, David Kagan, Yufeng Tian, Roopa Seshadri, Helen R. Salwen, Shuqing Liu, Alexandre Chlenski, and Susan L. Cohn
  Association of Epigenetic Inactivation of RASSF1A with Poor Outcome in Human Neuroblastoma
  Clin. Cancer Res., Dec 2004; 10: 8493 - 8500.
  ... Genomic DNA from human normal adrenal and brain tissues were purchased from BioChain Institute, Inc. ...
  


• Daniel P. Morse, P. Joseph Aruscavage, and Brenda L. Bass
  RNA hairpins in noncoding regions of human brain and Caenorhabditis elegans mRNA are edited by adenosine deaminases that act on RNA
  PNAS, Jun 2002; 99: 7906 - 7911. we used poly(A) + RNA and genomic DNA isolated from the same individual (purchased from BioChain Institute, Hayward, CA) to ensure differences between genomic and cDNA sequences were due to RNA ...